Figures and data in Membrane affinity difference between MinD monomer and dimer is not crucial for MinD gradient formation in Bacillus subtilis

Figures
Tables
Additional files

11 figures, 1 table and 5 additional files

Figures

Figure 1 with 1 supplement

Download asset Open asset

Localization of monomeric and dimeric MinD variants.

Cellular localization of (A) wild-type MinD, (B) MinD K16A, (C) MinD G12V, and (D) MinD D40A. Localization was monitored by an N-terminal monomeric GFP (mGFP) fusion. Fusion proteins were expressed in either a Δ*minD* or Δ*minCD* background. Fluorescence images (left panels) and corresponding phase contrast images (inset) are shown in the left panels. Some minicells are indicated with red arrows. Scale bar is 2 μm. Middle panels show the transverse fluorescence intensity profiles (FIPs) with standard deviations calculated using an average of at least 30 cells (Δ*minCD* background) per dataset. Right panels depict the longitudinal FIPs using the Δ*minCD* background. The manually shaded red areas highlight the polar gradients. Additional examples for wild-type MinD and the D40A variants are shown in Figure 1—figure supplement 1. (E) Transversal FIP with standard deviations of exponentially growing wild-type cells stained with fluorescence membrane dye FM5-95, and wild-type cells expressing GFP are shown as controls. (F) Membrane affinities, with median values, estimated from the valley/peak ratios shown in the middle panels of (**A–D**) and controls (E). (G) Longitudinal FIP along the exponentially growing wild-type cells stained with the fluorescence membrane dye FM5-95. Strains used in (A) LB249 and LB305, (B) LB250 and LB306, (C) LB251 and LB307, (D) LB252 and LB308, (E) LB609 and (G) 168.

Figure 1—source data 1 Fluorescence intensity data Figure 1.: https://cdn.elifesciences.org/articles/101520/elife-101520-fig1-data1-v1.xlsx
Download elife-101520-fig1-data1-v1.xlsx

Figure 1—figure supplement 1

Download asset Open asset

Longitudinal fluorescence intensity profiles (FIPs) of GFP-MinD wild-type and D40A variants.

(A) Additional examples of longitudinal FIPs of GFP-MinD and GFP-MinD-D40A shown in Figure 1. Polar and septal areas were selected manually based on the fluorescence gradient. Polar areas are indicated in red. (B) Quantification of pixel intensities, with median values at poles and septa in the longitudinal FIP relative to the intensity of the total integrated intensity. Significance of difference was confirmed using a t-test.

Figure 1—figure supplement 1—source data 1 Fluorescence intensity data Figure 1—figure supplement 1.: https://cdn.elifesciences.org/articles/101520/elife-101520-fig1-figsupp1-data1-v1.xlsx
Download elife-101520-fig1-figsupp1-data1-v1.xlsx

Figure 2

Download asset Open asset

Effect of a *minJ* deletion on MinD-GFP localization.

(A) Fluorescence microscopy images of Δ*minCD* and Δ*minJ*Δ*minCD* mutant cells expressing different monomeric GFP (mGFP)-MinD variants. Corresponding phase contrast images are shown in the insets. (B) Quantification of related septal fluorescence intensities, with median values at septa (n>100). Since the strongly filamentous Δ*minJ* strain is delicate to handle, cells were grown on agarose patches on microscopy slides. Scale bar is 5 μm. Strains used for wt: LB405 and LB409, K16A: LB406 and LB410, G12V: LB407 and LB411, and D40A: LB408 and LB412.

Figure 2—source data 1 Fluorescence intensity data Figure 2.: https://cdn.elifesciences.org/articles/101520/elife-101520-fig2-data1-v1.xlsx
Download elife-101520-fig2-data1-v1.xlsx

Figure 3

Download asset Open asset

Membrane recruitment of MinC by MinD variants.

Fluorescence microscopy images of cells expressing different monomeric GFP (mGFP)-MinD variants (cyan) and mCherry-MinC (red). Corresponding phase contrast images are shown in the insets. (A) Wild-type MinD, (B) MinD K16A, (C) MinD G12V, (D) MinD D40A, (E) MinD I260E, (F) MinD D40A, I260E. Right panels show the transverse fluorescence intensity profiles (FIPs) with standard deviations averaged over at least 30 cells. White arrows in (D) highlight colocalization. Scale bar is 2 μm. mGFP-MinD variants and mCherry-MinC were expressed in a Δ*minCD* background strain. Strains used: (A) LB318, (B) LB319, (C) LB320, (D) LB321, (E) LB643, and (F) LB644.

Figure 3—source data 1 Fluorescence intensity data Figure 3.: https://cdn.elifesciences.org/articles/101520/elife-101520-fig3-data1-v1.xlsx
Download elife-101520-fig3-data1-v1.xlsx

Figure 4

Download asset Open asset

Membrane association of different amphipathic helices.

(A) Schematic presentation of the tandem amphipathic helix and the weak amphipathic helix from Hepatitis C virus protein NS4B_241-253. (B) Fluorescence microscopy images and transverse fluorescence intensity profiles (FIPs) with standard deviations of cells expressing the different amphipathic helix sequences fused to the C-terminus of GFP. A strain expressing cytoplasmic GFP was included for comparison. Scale bar is 2 μm. Strains used: FBB043 (GFP-AH_MinD), FBB05 (GFP-AH_2x), FBB046 (GFP-AH_NS4B), LB609 (GFP). (C) Average membrane affinities calculated from the transverse FIPs (n>30). Significance of difference was confirmed using a t-test.

Figure 4—source data 1 Fluorescence intensity data Figure 4.: https://cdn.elifesciences.org/articles/101520/elife-101520-fig4-data1-v1.xlsx
Download elife-101520-fig4-data1-v1.xlsx

Figure 5 with 1 supplement

Download asset Open asset

Membrane affinity affects MinD gradient.

Fluorescence microscopy and fluorescence intensity profiles (FIPs) with standard deviations of cells expressing monomeric GFP (mGFP)-MinD containing either the native amphipathic helix (wt) (A), the tandem MinD amphipathic helix (2xAH) (B), or the weak Hepatitis C virus protein NS4B amphipathic helix (NS4B-AH) (C). The manually shaded red areas highlight the polar gradients. Additional examples are shown in Figure 5—figure supplement 1. (D) Relative membrane affinities with median values of the different mGFP-MinD variants were calculated from transverse FIPs (n>30). Significance of difference was confirmed using a t-test. The MinD variants were expressed in a Δ*minD* background. Phase contrast images are shown as insets. Some double septa are indicated with red arrows. Scale bar is 2 μm. Red areas in the intensity profiles highlight the polar gradients. Strains used in (A) LB249, (B) LB507, and (C) LB508.

Figure 5—source data 1 Fluorescence intensity data Figure 5.: https://cdn.elifesciences.org/articles/101520/elife-101520-fig5-data1-v1.xlsx
Download elife-101520-fig5-data1-v1.xlsx

Figure 5—figure supplement 1

Download asset Open asset

Longitudinal fluorescence intensity profiles (FIPs) of monomeric GFP (mGFP)-MinD with different membrane anchors.

(A) Additional examples of longitudinal FIPs from cells expressing mGFP-MinD variants with different membrane affinities shown in Figure 5. Polar and septal areas were selected manually based on the fluorescence gradient. Polar areas are indicated in red. (B) Calculated pixel intensities and median values at poles and septa in the longitudinal FIP relative to the integrated area of intensity.

Figure 5—figure supplement 1—source data 1 Fluorescence intensity data Figure 5—figure supplement 1.: https://cdn.elifesciences.org/articles/101520/elife-101520-fig5-figsupp1-data1-v1.xlsx
Download elife-101520-fig5-figsupp1-data1-v1.xlsx

Figure 6

Download asset Open asset

Functionality of MinD with different membrane affinities.

(A) Minicell formation in cells expressing monomeric GFP (mGFP)-MinD with different membrane affinities. The MinD variants were expressed in a Δ*minD* background (n>300). Standard deviations are indicated. (B) Cell length distributions of the different strains (n>300). Strains used: 1901 (Δ*minD*), LB249 (wild-type MinD), LB507 (2xAH), and LB508 (NS4B-AH).

Figure 6—source data 1 Minicell and cell length data Figure 6.: https://cdn.elifesciences.org/articles/101520/elife-101520-fig6-data1-v1.xlsx
Download elife-101520-fig6-data1-v1.xlsx

Figure 7 with 1 supplement

Download asset Open asset

Increased MinD membrane affinity affects MinC recruitment.

Fluorescence microscopy images of cells expressing monomeric GFP (mGFP)-MinD (cyan) and mCherry-MinC (red), with either the native membrane anchor (A), the tandem amphipathic helix (B), or the weak Hepatitis C virus protein NS4B-derived amphipathic helix (C). Corresponding phase contrast images are shown in insets. Scale bar is 2 μm. Transverse fluorescence intensity profiles (FIPs) with standard deviations are shown in the right panels (n>30). Right panels depict the longitudinal FIPs with manually shaded red areas to highlight the polar gradients. Additional examples are shown in Figure 7—figure supplement 1. The mGFP-MinD variants and mCherry-MinC were expressed in a Δ*minCD* background strain. Strains used: (A) LB318, (B) LB584, (C) LB559.

Figure 7—source data 1 Fluorescence intensity data Figure 7.: https://cdn.elifesciences.org/articles/101520/elife-101520-fig7-data1-v1.xlsx
Download elife-101520-fig7-data1-v1.xlsx

Figure 7—figure supplement 1

Download asset Open asset

Longitudinal fluorescence intensity profiles (FIPs) of mCherry-MinC in cells expressing different monomeric GFP (mGFP)-MinD membrane-binding variants.

Additional examples of longitudinal FIPs from cells expressing mCherry-MinC and mGFP-MinD variants with different membrane affinities are shown in Figure 7. Upper FIPs and lower FIPs depict MinD and MinC gradients, respectively. The latter is indicated by ‘MinC’.

Figure 7—figure supplement 1—source data 1 Fluorescence intensity data Figure 7—figure supplement 1.: https://cdn.elifesciences.org/articles/101520/elife-101520-fig7-figsupp1-data1-v1.xlsx
Download elife-101520-fig7-figsupp1-data1-v1.xlsx

Figure 8

Download asset Open asset

Kinetic Monte Carlo simulations of MinD localization.

Whole-cell kinetic Monte Carlo simulations of MinD distribution, taking into account dimer-to-monomer transition rates (ATPase activity), membrane affinities, and MinJ interaction (schematic model). The following conditions have been simulated: (A) Start situation whereby (i) diffusion along the membrane is 10-fold slower compared to cytoplasm, (ii) MinD dimer diffuses 2-fold slower compared to the monomer in both environments, (iii) 10% stronger membrane affinity for dimer, (iv) membrane dwell time of monomers and dimers on average 1.4–4.5 s, (v) dimerization and monomerization rates such that dimers and monomers are approximately in a 1:1 ratio, (vi) transition from dimer to monomer occurs stochastically with a half-life of approximately 1/s, and (vii) MinD dimers in close proximity to polar regions (peak MinJ concentration) will remain attached for some time, so that approximately 25% of MinD dimers are associated with the polar caps, representing MinJ. (B) Same as simulation A, but membrane-attached monomers have a 2-fold higher chance of forming dimers compared to cytoplasmic monomers. (C) Same as simulation A, but MinJ also stimulates MinD dimerization. (D) Same as simulation C, but MinD ATPase activity, i.e., dimer-to-monomer transition, only occurs at the membrane. (E) Same as simulation D, but with a 10-fold higher ATPase activity, i.e., dimer-to-monomer transition. (F) Same as simulation C, but MinD dimers are not retained by MinJ. (G) Same as simulation C, but diffusion rates of monomer and dimer are the same. (H) Same as simulation C, but the membrane affinity of MinD monomers and dimers is the same. (I) Same as simulation C, but membrane affinity of MinD is stronger, such that the diffusion is a further 10-fold slower on the membrane. (J) Same as simulation C, but membrane affinity of MinD is 2-fold weaker. (K) Same as simulation C, but now MinD dimers can also form tetramers. Graphs indicate the average lateral projection of MinD in simulated cells.

Appendix 1—figure 1

Download asset Open asset

Amino acid sequence alignment between *E. coli* and *B. subtilis* MinD proteins.

The *E. coli* and *B. subtilis* MinD proteins share 44% identical residues. The five conserved motifs of the ATPase protein family are framed in blue. The exchanged conserved amino acids are highlighted in blue (G12V, K16A, D40A). The C-terminal membrane-targeting amphipathic helices are framed in red (MTS).

Appendix 1—figure 2

Download asset Open asset

Western blot analysis of GFP-MinD variants.

Western blot analysis of strains expressing different mGFP-MinD protein fusions. Cells were grown in LB medium at 37°C until early exponential phase, followed by induction for three doubling times with 0.1% xylose. Anti-GFP primary antibody was used to detect the different fusion proteins. Strains used: LB305 (wt), LB306 (K16A), LB307 (G12V), LB308 (D40A), LB507 (2xAH), LB508 (NS4B-AH). Black arrowhead indicates full-length mGFP-MinD (~57.7 kDa), the asterisk indicates a nonspecific band.

Appendix 1—figure 2—source data 1 Original Western blot Appendix 1—figure 2.: https://cdn.elifesciences.org/articles/101520/elife-101520-app1-fig2-data1-v1.zip
Download elife-101520-app1-fig2-data1-v1.zip
Appendix 1—figure 2—source data 2 Original Western blot with markings Appendix 1—figure 2.: https://cdn.elifesciences.org/articles/101520/elife-101520-app1-fig2-data2-v1.zip
Download elife-101520-app1-fig2-data2-v1.zip

Appendix 1—figure 3

Download asset Open asset

Effect of membrane potential dissipation on membrane binding.

Fluorescence images of cells expressing mGFP-MinD variants with the wild-type amphipathic helix (wt) (A) and the strong (2xAH) membrane binding amphipathic helix (B). Corresponding phase contrast images are shown in the insets. The membrane potential was dissipated by the proton-ionophore carbonyl cyanide m-chlorophenylhydrazone (CCCP) (100 μM for 10 min). mGFP-MinD fusions were expressed from the ectopic *amyE* locus using a xylose-inducible promoter and a Δ*minD* background. Strains used: (A) LB249, (B) LB507.

Tables

Key resources table

Reagent type (species) or resource	Designation	Source or reference	Identifiers	Additional information
Strain, strain background (B. subtilis)	168	Barbe et al., 2009		Wild-type
Strain, strain background (B. subtilis)	1901	Marston et al., 1998		minD::erm
Strain, strain background (B. subtilis)	3381	van Baarle and Bramkamp, 2010		minC::km
Strain, strain background (B. subtilis)	3309	van Baarle and Bramkamp, 2010		minCD::km
Strain, strain background (B. subtilis)	RD021	Bramkamp et al., 2008		minJ::tet
Strain, strain background (B. subtilis)	LB249	This paper		minD::erm amyE::spc Pxyl-mGFP-minD
Strain, strain background (B. subtilis)	LB250	This paper		minD::erm amyE::spc Pxyl-mGFP-minD(K16A)
Strain, strain background (B. subtilis)	LB251	This paper		minD::erm amyE::spc Pxyl-mGFP-minD(G12V)
Strain, strain background (B. subtilis)	LB252	This paper		minD::erm amyE::spc Pxyl-mGFP-minD(D40A)
Strain, strain background (B. subtilis)	LB305	This paper		minCD::km amyE::spc Pxyl-mGFP-minD
Strain, strain background (B. subtilis)	LB306	This paper		minCD::km amyE::spc Pxyl-mGFP-minD(K16A)
Strain, strain background (B. subtilis)	LB307	This paper		minCD::km amyE::spc Pxyl-mGFP-minD(G12V)
Strain, strain background (B. subtilis)	LB308	This paper		minCD::km amyE::spc Pxyl-mGFP-minD(D40A)
Strain, strain background (B. subtilis)	LB318	This paper		minCD::km amyE::spc Pxyl-mGFP-minD aprE::cat Pspac-mCherry-minC
Strain, strain background (B. subtilis)	LB319	This paper		minCD::km amyE::spc Pxyl-mGFP-minD(K16A) aprE::cat Pspac-mCherry-minC
Strain, strain background (B. subtilis)	LB320	This paper		minCD::km amyE::spc Pxyl-mGFP-minD(G12V) aprE::cat Pspac-mCherry-minC
Strain, strain background (B. subtilis)	LB321	This paper		minCD::km amyE::spc Pxyl-mGFP-minD(D40A) aprE::cat Pspac-mCherry-minC
Strain, strain background (B. subtilis)	LB405	This paper		minCD::km amyE::spc Pxyl-mGFP-minD
Strain, strain background (B. subtilis)	LB406	This paper		minCD::km amyE::spc Pxyl-mGFP-minD(K16A)
Strain, strain background (B. subtilis)	LB407	This paper		minCD::km amyE::spc Pxyl-mGFP-minD(G12V)
Strain, strain background (B. subtilis)	LB408	This paper		minCD::km amyE::spc Pxyl-mGFP-minD(D40A)
Strain, strain background (B. subtilis)	LB409	This paper		minCD::km minJ::tet amyE::spc Pxyl-mGFP-minD
Strain, strain background (B. subtilis)	LB410	This paper		minCD::km minJ::tet amyE::spc Pxyl-mGFP-minD(K16A)
Strain, strain background (B. subtilis)	LB411	This paper		minCD::km minJ::tet amyE::spc Pxyl-mGFP-minD(G12V)
Strain, strain background (B. subtilis)	LB412	This paper		minCD::km minJ::tet amyE::spc Pxyl-mGFP-minD(D40A)
Strain, strain background (B. subtilis)	LB507	This paper		minD::erm amyE::spc Pxyl-mGFP-minD-BsMTS-tandem(2xAH with linker in between)
Strain, strain background (B. subtilis)	LB508	This paper		minD::erm amyE::spc Pxyl-mGFP-minD-HCV-NS4B-AH
Strain, strain background (B. subtilis)	LB559	This paper		amyE::spc Pxyl-mGFP-minD-HCV-NS4B-AH aprE::cat Pspac-mCherry-minC minCD::km
Strain, strain background (B. subtilis)	LB584	This paper		amyE::spc Pxyl-mGFP-minD-BsMTS-tandem(2xAH with linker in between) aprE::cat Pspac-mCherry-minC minCD::km
Strain, strain background (B. subtilis)	FBB043	This paper		amyE::spc Pxyl-GFP-AH(MinD)
Strain, strain background (B. subtilis)	FBB053	This paper		amyE::spc Pxyl-GFP-BsMTS-tandem(MinD)
Strain, strain background (B. subtilis)	FBB046	This paper		amyE::spc Pxyl-GFP-AH(NS4B)
Strain, strain background (B. subtilis)	LB609	This paper		amyE::spc Phyperspank-sfGFP (from pDR111-N015-sfGFP)
Strain, strain background (B. subtilis)	LB643	This paper		amyE::spc Pxyl-mGFP-minD(I260E) aprE::cat Pspac-mCherry-minC minCD::km
Strain, strain background (B. subtilis)	LB644	This paper		amyE::spc Pxyl-mGFP-minD(D40A I260E) aprE::cat Pspac-mCherry-minC minCD::km
Recombinant DNA reagent	pAPNC213	Morimoto et al., 2002	Plasmid	bla aprE3’ spc Pspac-lacI aprE5’
Recombinant DNA reagent	pDR111-N015-sfGFP	Nordholt et al., 2017	Plasmid	bla amyE3’ spc Phyperspank-lacI-sfGFP amyE5’
Recombinant DNA reagent	pHJS113	Strahl and Hamoen, 2010	Plasmid	bla amyE3’ spc Pxyl-GFP-minD(K16A) amyE5’
Recombinant DNA reagent	pSG1729	Lewis and Marston, 1999	Plasmid	bla amyE3’ spc Pxyl-GFP amyE5’
Recombinant DNA reagent	pSG1730	Marston et al., 1998	Plasmid	bla amyE3’ spc Pxyl-GFP-minD amyE5’
Recombinant DNA reagent	pSG2	Fort and Errington, 1985	Plasmid	bla cat
Recombinant DNA reagent	pSS153	Syvertsson et al., 2021	Plasmid	bla aprE3’ Phag-mCherry-cat aprE5’
Recombinant DNA reagent	pAPNCcat	This paper	Plasmid	bla aprE3’ cat Pspac-lacI aprE5’
Recombinant DNA reagent	pHJS112	This paper	Plasmid	bla aprE3’ cat Pspac-mCherry aprE5’
Recombinant DNA reagent	pHJS115	This paper	Plasmid	bla amyE3’ spc Pxyl-GFP-minD(G12V) amyE5’
Recombinant DNA reagent	pHJS116	This paper	Plasmid	bla amyE3’ spc Pxyl-GFP-minD(D40A) amyE5’
Recombinant DNA reagent	pHJS117	This paper	Plasmid	bla amyE3’ spc Pxyl-GFP-MTS(minD) amyE5’
Recombinant DNA reagent	pHJS119	This paper	Plasmid	bla amyE3’ spc Pxyl-GFP-MTS(minD)-tandem (with linker in between) amyE5’
Recombinant DNA reagent	pHJS121	This paper	Plasmid	bla amyE3’ spc Pxyl-GFP-NS4B-AH amyE5’
Recombinant DNA reagent	pHJS123	This paper	Plasmid	bla amyE3’ spc Pxyl-GFP-minD-BsMTS-tandem (with linker in between) amyE5’
Recombinant DNA reagent	pHJS125	This paper	Plasmid	bla amyE3’ spc Pxyl-GFP-minD-NS4B-AH amyE5’
Recombinant DNA reagent	pLB11	This paper	Plasmid	bla aprE3’ cat Pspac-mCherry-minC aprE5’
Recombinant DNA reagent	pLB21	This paper	Plasmid	bla amyE3’ spc Pxyl-mGFP-minD amyE5’
Recombinant DNA reagent	pLB22	This paper	Plasmid	bla amyE3’ spc Pxyl-mGFP-minD(K16A) amyE5’
Recombinant DNA reagent	pLB23	This paper	Plasmid	bla amyE3’ spc Pxyl-mGFP-minD(G12V) amyE5’
Recombinant DNA reagent	pLB24	This paper	Plasmid	bla amyE3’ spc Pxyl-mGFP-minD(D40A) amyE5’
Recombinant DNA reagent	pLB49	This paper	Plasmid	bla amyE3’ spc Pxyl-mGFP-minD-BsMTS-tandem(with linker in between) amyE5’
Recombinant DNA reagent	pLB50	This paper	Plasmid	bla amyE3’ spc Pxyl-mGFP-minD-NS4B-AH amyE5’
Recombinant DNA reagent	pLB71	This paper	Plasmid	bla amyE3’ spc Pxyl-mGFP-minD(I260E) amyE5’
Recombinant DNA reagent	pLB72	This paper	Plasmid	bla amyE3’ spc Pxyl-mGFP(D40A I260E)-minD amyE5’
Sequence-based reagent	LB1	This paper	PCR primers	GCGCGGGATCCATGAAGACCAAAAAGCAGCAATATG
Sequence-based reagent	LB2	This paper	PCR primers	CGCGCGAATTCTCACATTCCTCCCTCAAGCCTTG
Sequence-based reagent	HS05	This paper	PCR primers	GCTAATTTTATTGCAATAACAGGTG (To linearize pAPNC213)
Sequence-based reagent	HS06	This paper	PCR primers	GACCGTTAGCGTTTAAGTACATC (To linearize pAPNC213)
Sequence-based reagent	HS07	This paper	PCR primers	TAAACGCTAACGGTCCAGTAATATTGACTTTTAAAAAAGG (cat cassette)
Sequence-based reagent	HS08	This paper	PCR primers	TGCAATAAAATTAGCTTATAAAAGCCAGTCATTAGGCC (cat cassette)
Sequence-based reagent	HS437	This paper	PCR primers	GCGCGGTCGACACATAAGGAGGAACTACTATGGTC (mCherry)
Sequence-based reagent	HS438	This paper	PCR primers	(mCherry)
Sequence-based reagent	HS508	This paper	PCR primers	CACAGAATAGTCTTTTAAGTAAGTC (aprE)
Sequence-based reagent	HS509	This paper	PCR primers	CCGGAACATCAGGATGCTGAC (aprE)
Sequence-based reagent	HS410	This paper	PCR primers	CCTGTCCACACAATCTAAACTTTCGAAAGATCCC (A206K mutation in GFP)
Sequence-based reagent	HS411	This paper	PCR primers	GGGATCTTTCGAAAGTTTAGATTGTGTGGACAGG (A206K mutation in GFP)
Sequence-based reagent	HS112	This paper	PCR primers	GCGGAGTAGGTGCGACAACAACATCTG (K16A mutation in MinD)
Sequence-based reagent	HS113	This paper	PCR primers	CAGATGTTGTTGTCGCACCTACTCCGC (K16A mutation in MinD)
Sequence-based reagent	HS205	This paper	PCR primers	GGAATGATGGCTAAGGAAAAGTCATTTTTCGG (I260E mutation in MinD)
Sequence-based reagent	HS206	This paper	PCR primers	CCGAAAAATGACTTTTCCTTAGCCATCATTCC (I260E mutation in MinD)
Sequence-based reagent	HS320	This paper	PCR primers	CTTCGGGAAAAGTGGGAGTAGGTAAG (G12V mutation in MinD)
Sequence-based reagent	HS321	This paper	PCR primers	CTTACCTACTCCCACTTTTCCCGAAG (G12V mutation in MinD)
Sequence-based reagent	HS322	This paper	PCR primers	GCTTAGTAGATACTGCGATAGGACTGCGC (D40A mutation in MinD)
Sequence-based reagent	HS323	This paper	PCR primers	GCGCAGTCCTATCGCAGTATCTACTAAGC (D40A mutation in MinD)
Sequence-based reagent	FB135	This paper	PCR primers	CTTCGGATCCACGGGCCCCCCCTCGAGTTGGGTGAGGCTATCGTAATAAC (minD)
Sequence-based reagent	FB136	This paper	PCR primers	CTAGAACTAGAATTCTTAAGATCTTACTCCGAAAAATG (MinD MTS)
Sequence-based reagent	FB149	This paper	PCR primers	CTTCGGATCCACGGATCAGGAGTGCTTGAAGAGCAAAACAAAGG (MinD MTS)
Sequence-based reagent	FB138	This paper	PCR primers	CTAGAACTAGAATTCTTATGATCTCACTCCAAAAAATGATTTAATTTTCGCCATCATTCCTTTGTTTTGTTCTTCCAGCACTCCTCCAGATCTTACTCCGAAAAATGAC (MinD MTS with 2xAH with linker)
Sequence-based reagent	FB141	This paper	PCR primers	CTAGAACTAGAATTCTTAAATCCATTGGTGCAGTCTTCTCAGCAGTTGTGTCACTGTCAGTGATGACAGAATGCCGTTTTGCTCTTCAAGCACCTG (HCV-NS4B-AH)