Proteome dynamics reveal Leiomodin 1 as a key regulator of myogenic differentiation
- Leibniz Institute on Aging - Fritz Lipmann Institute (FLI), Germany
- Département de Pharmacologie - Physiologie, Université de Sherbrooke, Canada
- Faculty of Health Sciences, Brandenburg Technische Universität Cottbus-Senftenberg, Germany
- Faculty of Environmental and Natural Sciences, Brandenburg-Technische Universität Cottbus-Senftenberg, Germany
Figures
Figure 1
Analysis of the proteome shows dynamic alterations during myogenic differentiation.
(A) Experimental workflow for analyzing the 5-day differentiation time course using mass spectrometry (Supplementary file 1) and qRT-PCR. Primary myoblasts isolated from five individual mice were seeded and differentiated for up to 5 days. (B) Principal component analysis (PCA) of proteomics data. Ellipses represent a 95% confidence interval for each day of differentiation. (C) qRT-PCR analysis showing the relative mRNA expression of Pax7, MyoD, and Myogenin, normalized to Gapdh and day 0. (D) Mass-spectrometry-based quantification of PAX7, MYOD, and MYOGENIN protein levels normalized to day 0. (E) Pie chart for proteome dynamics. 6098 protein groups were subjected to k-means clustering analysis, 2259 were unaffected, while 3839 protein groups showed significant changes (Absolute AVG log2 ratio >0.58 and Q value<0.25) in expression levels in at least one-time point compared to day 0. Protein groups were classified into six clusters based on their expression dynamics using k-means clustering. (F) Clusters showing distinct protein abundance dynamics during myogenic differentiation and KEGG pathways enriched (FDR <0.05) in each cluster (Supplementary file 1). (G) Proteins from cluster 2 were chosen according to KEGG pathway annotation: striated muscle contraction and function, motor protein activity and cytoskeletal dynamics. The protein–protein interaction network was visualized with STRING (Szklarczyk et al., 2011), edge confidence: medium 0.4. For (C) and (D): In all bar plots, each symbol represents a biological replicate, and the error bars indicate the SD. One-way, ANOVA. *: q value ≤0.05, **: q value ≤0.01, ***: q value ≤0.001.
Figure 2 with 1 supplement
LMOD1 increases during early myogenic differentiation and is upregulated in aged MuSCs.
(A) Protein quantification of LMOD1, LMOD2, and LMOD3 during myogenic differentiation, based on mass spectrometry data and normalized to the protein amount of day 0. Error bars indicate SD, and colored dots indicate the mean value of the biological replicates (n=5). (B) LMOD1, LMOD2, and LMOD3 protein abundance estimated from mass spectrometry data in different skeletal muscles (gastrocnemius, G; soleus, S; tibialis anterior, TA; extensor digitorum longus, EDL). Displayed values are averages of n=5 samples from individual mice. Mass spectrometry data from Schüler et al., 2021. (C) LMOD1 and LMOD2 protein quantity in MuSCs obtained from young (n=10), old (n=8), and geriatric (n=5) mice; nd = not detected. Mass spectrometry data from Schüler et al., 2021. (D) Representative immunofluorescence images of LMOD1 (purple), PAX7 (green), and Hoechst (blue) of TA sections from n=3 individual mice per age group: young (3-month-old), old (18-months-old), and geriatric (33-months-old) mice. Scale bar: 5 µm. (E) Ratio of PAX7 +and LMOD1 + cells normalized to the cells positive for PAX7+ (Figure 3—figure supplement 1C) and (F) Quantification of the percentage of PAX7 + cells showing nuclear LMOD1 localization. Related to Figure 2—figure supplement 1. For (E) and (F): One-way ANOVA. *: q value ≤0.05, **: q value ≤0.01, ***: q value ≤0.001. In all bar plots, each black dot represents a biological replicate, and the error bars indicate the SD. (G). Muscle regeneration time course: Immunoblot of LMOD1 (76 kDa) levels in regenerating TA muscle after injury. Quantification of LMOD1 levels was normalized to the respective entire lane of the Ponceau staining and relative to the LMOD1 signal at day 0. Each symbol represents a biological replicate, and error bars represent SD. One-way ANOVA; **: p-value ≤0.01, ***: p-value ≤0.001. (H) Representative immunofluorescence images of LMOD1 (purple), PAX7 (green), LAMININ (grey), and Hoechst (blue) of TA sections at different days post-injury from young mice (3 months old). Scale bar: 50 µm. The following figure supplement is available for Figure 2: Figure 2—figure supplement 1.
-
Figure 2—source data 1
Raw unedited western blot gels.
LMOD1 detection and Ponceau staining from four individual mice during cardiotoxin-induced muscle regeneration.
- https://cdn.elifesciences.org/articles/104331/elife-104331-fig2-data1-v1.zip
-
Figure 2—source data 2
Uncropped and labeled gel panels.
- https://cdn.elifesciences.org/articles/104331/elife-104331-fig2-data2-v1.zip
Figure 2—figure supplement 1
LMOD1 in MuSCs and skeletal muscle.
(A) LMOD1 protein coverage in proteomics data from MuSCs. Multiple unique (proteotypic) peptides were identified. Data from Schüler et al., 2021. (B) Barplot showing log2 fold changes of Lmod1 mRNA abundance in activated vs. quiescent MuSCs (in young and old) from previously published transcriptome data sets (GSE81096; Lukjanenko et al., 2016) and (GSE47177; Liu et al., 2013). *: adjusted p-value <0.05, ***: adjusted p-value <0.001; a - activated, q - quiescent, o - old, y - young. (C) Immunofluorescence images of TA sections from different mice (n=3) per age group of young (3 months old) and geriatric (33 months old) mice. PAX7 (green), LMOD1 (purple), and Hoechst (blue). (D) Number of PAX7 + cells per mm2 cells in muscle sections from young, old, and geriatric mice and (E) Quantification of PAX7 + cells showing cytoplasmic LMOD1 localization. For (D) and (E): One-way ANOVA; *: p-value ≤0.05, ***: p-value ≤0.001, ns: not significant. In all bar plots, each black dot represents a biological replicate, and the error bars indicate the SD. Related to Figure 2.
Figure 3 with 1 supplement
Knockdown of Lmod1 impairs myogenic differentiation and reduces muscle regeneration, while overexpression enhances it.
(A) Schematic of the Lmod1 knockdown experiment after 3 days of differentiation. siRNA directed against Lmod1 or scramble (siCtrl) control was used to transfect primary myoblasts isolated from individual mice. Differentiation was induced by a change to differentiation medium at 0 hr. (B) Overview of quantified different cell types based on their expression of myogenic markers; Myogenin (red), Myosin heavy chain (MHC) (green), and Hoechst (blue). Scale bar: 50 µm. (a) Non-proliferating myoblasts: Hoechst+/Myogenin-/MHC- and undifferentiated. (b) Myogenin+/MHC-: Myogenin positive, MHC negative, just started to differentiate. (c) Myogenin+/MHC+: co-express both in the process of differentiation. (d) Myogenin-/MHC+: non-elongated. (e) Fully differentiated myotubes: quantified by nuclei count to assess the fusion process. (C) Representative immunofluorescence images after three days of differentiation and siCtrl or siLmod1 transfection; MHC (green), nuclei (blue). Scale bar: 50 µm. (D–F). Quantification of the number of nuclei per myotube (D), Myogenin-/MHC + cells (E) and length of differentiated myotubes (in µm) (F) Paired t-test; *: p-value ≤0.05, **: p-value ≤0.01. (G) Schematic of the Lmod2 and Lmod1/Lmod2 double knockdown experiment after 3 days of differentiation. siRNA against Lmod1, Lmod2, both or scramble (siCtrl) was used to transfect primary myoblasts. Differentiation was induced by a change to differentiation medium at 0 hr. (H) Representative immunofluorescence images of siLmod2 and siLmod1/Lmod2 double knockdown after 3 days of differentiation; devMHC (green), nuclei (blue). Scale bar: 50 µm. (I - K) Quantification of the number of nuclei per myotube (I), Myogenin-/MHC + cells (J), Length of differentiated myotubes (in µm) (K) One-way ANOVA; *: p-value ≤0.05, ns: not significant. (L) Experimental schematic for analysis of in vivo CTX-induced injury of TA muscles combined with injection of self-delivering siRNAs at 3 days post injury. n=4 mice per group, 3 months old. (M) Representative immunofluorescence images of MYOGENIN (green), LAMININ (grey), and Hoechst (blue) of TA-sections 5 days post-injury from young mice (3 months old). (N) Quantification of the number of Myogenin + cells normalized per area. Unpaired t-test; *: p-value ≤0.05. (O) Illustration of the experimental setup. Primary myoblasts isolated from individual mice stably overexpressing (OE) LMOD1 (purple) or GFP (green) were seeded and either collected during proliferation (3d proli), after 1 day (1d diff), 3 days (3d diff), or 5 days (5d diff) of differentiation. Differentiation was induced by a change to differentiation medium at 0 hr. Cells were harvested for immunofluorescence analysis (IF), qRT-PCR, immunoblot (WB), or mass spectrometry (MS). (P) Representative immunofluorescence images of primary myoblasts after one day of differentiation, showing either stable expression of LMOD1 or GFP. devMHC (green), MYOGENIN (red), and nuclei (blue). Scale bar is 50 µm. (Q) and (R) Quantification of nuclei per myotube of GFP OE or LMOD1 OE cells (Q) and cells expressing Myogenin+/MHC +defined as just differentiated cells (R) after 1 day of differentiation. Paired t-test *: p-value ≤0.05. In all bar plots, each symbol represents a biological replicate, and the error bars indicate the SD. The following figure supplement is available for Figure 3: Figure 3—figure supplement 1.
Figure 3—figure supplement 1
Validation of knockdown efficiency and statistical analysis of siLmod1/Lmod2 knockdown and LMOD1 overexpression.
(A) Schematic of the Lmod1 knockdown experiment under proliferating conditions. siRNA directed against Lmod1 or scramble (siCtrl) control was used to transfect primary myoblasts isolated from individual mice. (B) qRT-PCR analysis showing the relative expression of Lmod1 after siLmod1 knockdown compared to siCtrl transfected cells, normalized to Gapdh expression levels. (C) Immunoblot and quantification of LMOD1 after transfections with siLmod1 and siCtrl and two days of proliferation normalized to GAPDH. Paired t-test: *: p-value ≤ 0.05. (D) Immunofluorescence analysis of primary myoblasts stained for the proliferation marker Ki67 (red) and Hoechst (blue). Scale bar: 100 µm. (E) Quantification of cell populations identified by immunofluorescence staining: non-proliferating myoblasts being Hoechst+/Ki67- and cells being Hoechst+/Ki67+ in siCtrl and siLmod1 transfected conditions and the total counted cells per condition. (F) and (G) Validation of the siLmod1 knockdown compared to siCtrl transfected cells under differentiation conditions. qRT-PCR for Lmod1 normalized to Gapdh expression levels (F) and immunoblot analysis with quantification of LMOD1 signal normalized to GAPDH (G) Paired t-test *: p-value ≤0.05, ***. (H) Quantification of cell populations identified by immunofluorescence staining: non-proliferating myoblasts/reserve cells (Hoechst+/Myogenin-/MHC-) , Myogenin+/MHC- cells, Myogenin+/MHC+, fully differentiated myotubes, and total counted cells under differentiating conditions. (I) Representative images of primary myoblasts transfected with a non-targeting control siRNA (siCtrl) or an siRNA targeting Lmod1 (siLmod1). Apoptotic cells were identified by TUNEL staining (green), and all nuclei were counterstained with Hoechst (blue). Bar graph showing the percentage of TUNEL-positive nuclei. (J) and (K) Validation of the siLmod1 or siLmod2 (single) or siLmod1/Lmod2 (double) knockdown compared to siCtrl transfected cells under differentiation conditions. qRT-PCR for Lmod1 and Lmod2 normalized to Gapdh expression levels (J) and representative immunoblot with quantification of LMOD2 (62 kDa) normalized to GAPDH (K). One-way ANOVA *: p-value ≤0.05 or numbers are indicated. ns: not significant. (L) Quantification of cell populations (in %) identified by immunofluorescence staining after siLmod1 (single), siLmod2 (single), and siLmod1/2 (double) knockdown under differentiating conditions: non-proliferating myoblasts (Hoechst+/Myogenin-/MHC-) cells, Myogenin+/MHC- cells, Myogenin+/MHC+, fully differentiated myotubes, and total counted cells under differentiating conditions. Related to Figure 3I and J. (M and N) Validation of LMOD1 OE compared to GFP OE cells after 1 day of differentiation. Relative Lmod1 expression assessed by qRT-PCR was compared to GFP OE cells and normalized to Gapdh expression levels (M) and immunoblot with quantification of LMOD1 normalized to GAPDH (N). Paired t-test: *: p-value ≤0.05. (O and P) Quantification of cell populations identified by immunofluorescence staining after LMOD1 OE compared to GFP OE: non-proliferating myoblasts (Hoechst+/Myogenin-/MHC-) cells, Myogenin+/MHC- cells, Myogenin+/MHC+, fully differentiated myotubes, total counted cells after, and myotube length (in µm) (O). Paired t-test: numbers are indicated, ns: not significant. Related to Figure 3N and O. (Q) Gene set enrichment analysis (GSEA) was based on a gene set containing proteins that significantly increased at 1 day of differentiation compared to 0 hr/proliferating primary myoblasts (AVG Log2 Ratio >0.58 and Q value <0.05, 189 proteins) from the proteomic data generated in (Figure 1A). The GSEA was performed using this gene set on the comparison of LMOD1 OE vs. GFP OE at 1 day of differentiation (Supplementary file 2). In all bar plots, each symbol or black dot represents a biological replicate, and the error bars indicate the SD.
-
Figure 3—figure supplement 1—source data 1
Raw unedited western blot gels for Figure 3—figure supplement 1, panels C, G, K, and N.
Panel C: LMOD1, GAPDH, and Ponceau - siLmod1 knockdown validation. Panel G: LMOD1, GAPDH, and Ponceau - LMOD1 overexpression validation. Panel K: LMOD1, LMOD2, and GAPDH - siLmod1/siLmod2 double knockdown validation. Panel N: LMOD1, GFP, and Ponceau - LMOD1 overexpression vs GFP control.
- https://cdn.elifesciences.org/articles/104331/elife-104331-fig3-figsupp1-data1-v1.zip
-
Figure 3—figure supplement 1—source data 2
Uncropped and labeled gel panels for Figure 3—figure supplement 1, panels C, G, K, and N.
- https://cdn.elifesciences.org/articles/104331/elife-104331-fig3-figsupp1-data2-v1.zip
Figure 4 with 1 supplement
LMOD1 interacts with SIRT1.
(A) BioID workflow. Lmod1 and Lmod2 were C-terminally fused to a promiscuous biotin ligase (BirA*) and expressed in HEK293T cells. BirA* alone served as a control (Ctrl) to assess non-specific biotinylation. Overexpression of fusion proteins was induced by addition of tetracycline. Exogenous biotin was introduced to label interaction partners in close proximity. Biotinylated proteins were captured using streptavidin enrichment, followed by mass spectrometry analysis to identify and quantify proximal interactors. (B) and (C) Immunofluorescence analyses of LMOD1-BirA*-FLAG and LMOD2-BirA*-FLAG in HEK293T cells 4 days after seeding without addition of any substance (-tet/-bio), with addition of only tetracycline for 4 days (+tet/-bio) or with addition of both tetracycline for 4 days and biotin for 1 day (+tet/+bio); FLAG (green), streptavidin (red), nuclei (blue). Scale bar: 20 µm. (D) Principal component analysis (PCA) of the BioID data. Ellipses represent 95% confidence intervals. (E) Volcano plot of proteins enriched by streptavidin pull-down and analyzed by mass spectrometry from LMOD1-BirA* and LMOD2-BirA*. n=4 biological replicates (Supplementary file 3) (F) Quantification of selected unique interaction partners of LMOD1-BirA* and LMOD2-BirA* in comparison to BirA*-Ctrl. Each symbol represents a biological replicate, error bars indicate the SD. One-way ANOVA, *: p-value ≤ 0.05, **: p-value ≤0.01. (G) Validation of the SIRT1-LMOD1 interaction. Cells expressing either GFP or SIRT1-GFP were used for co-immunoprecipitation using GFP-trap. The eluates from the GFP-trap were analyzed by immunoblot using antibodies directed to BirA* or GFP. For quantification, BirA* was normalized to SIRT1-GFP intensity. (H) Representative images of proximity ligation assay (PLA; red) in primary myoblasts during proliferation and after 1 day of differentiation. Scale bar: 10 µm. (I) Representative immunofluorescence images of SIRT1 (gray), PAX7 (red), LAMININ (green), and Hoechst (blue) of uninjured TA section (day 0) and 5 days post-injury from young mice (3 months old). The following figure supplement is available for Figure 4: Figure 4—figure supplement 1.
-
Figure 4—source data 1
Raw unedited western blot gels for Figure 4G.
BirA* and GFP detection from GFP-trap co-immunoprecipitation validating LMOD1–SIRT1 interaction.
- https://cdn.elifesciences.org/articles/104331/elife-104331-fig4-data1-v1.zip
-
Figure 4—source data 2
Uncropped and labeled gel panels for Figure 4G.
- https://cdn.elifesciences.org/articles/104331/elife-104331-fig4-data2-v1.zip
Figure 4—figure supplement 1
BioID for LMOD1 and LMOD2.
(A) Immunoblot of BirA* fusion proteins performed on lysates from HEK293T cells stably transfected with LMOD1-BirA*-FLAG, LMOD2-BirA*-FLAG or Ctrl-BirA*-FLAG following 24 hr incubation with (+tet) or without (−tet) tetracycline. Middle panel, streptavidin-HRP blot following induction of BirA* fusion proteins with tetracycline and supplementation of biotin for 24 hr. Ponceau stainings were used as loading control. HRP: horseradish peroxidase. (B) Volcano plot of proteins enriched by streptavidin pull-down and analyzed by mass spectrometry from LMOD1-BirA* and (C) LMOD2-BirA* compared to BirA*-Ctrl. Significantly enriched (AVG Log2 Ratio >0.58 and Q value <0.05), known interaction partners for LMOD1 and LMOD2 are highlighted in red, SIRT1 is highlighted in yellow (Figure 4 – figure supplement 1). (D) Quantification of LMOD1 and LMOD2 protein abundance after overexpressing the LMOD1-BirA* and LMOD2-BirA* fusion proteins in comparison to BirA*-Ctrl. (E) Quantification of selected known interaction partners of LMOD1-BirA* and LMOD2-BirA* in comparison to BirA*-Ctrl. For (D) and (E), each symbol represents a biological replicate, and error bars indicate the SD. One-way ANOVA, *: p-value ≤ 0.05, **: p-value ≤ 0.01.
-
Figure 4—figure supplement 1—source data 1
Raw unedited western blot gels for Figure 4—figure supplement 1, panel A.
FLAG/LMOD1/LMOD2, Ponceau, and streptavidin detection. Validation of BirA* fusion protein expression for BioID.
- https://cdn.elifesciences.org/articles/104331/elife-104331-fig4-figsupp1-data1-v1.zip
-
Figure 4—figure supplement 1—source data 2
Uncropped and labeled gel panels for Figure 4—figure supplement 1, panel A.
- https://cdn.elifesciences.org/articles/104331/elife-104331-fig4-figsupp1-data2-v1.zip
Figure 5 with 1 supplement
Overexpression of LMOD1 influences the subcellular localization of SIRT1.
(A) Representative immunofluorescence staining of LMOD1 and SIRT1 at different time points of myogenic differentiation; LMOD1 (purple), SIRT1 (yellow), nuclei (Hoechst, blue). Scale bar: 20 µm. (B and C) Cytoplasmic to nuclear SIRT1 (B) and LMOD1 (C) ratio at different days of differentiation, n=50 cells were analyzed per biological replicate per time point. (D–F) Correlation of the cytoplasmic to nuclear ratio of LMOD1 and SIRT1 at 2 days of proliferation (R2=0.47) (D), 1 day differentiation (R2=0.42) (E) and 2 days of differentiation (R2=0.08) (F) (G) SIRT1 protein abundance upon LMOD1 OE at different time points, 3 days proliferation (3dp), 1 day differentiation (1dd), 3 days differentiation (3dd), 5 days differentiation (5dd). Each symbol represents a biological replicate (n=4, primary myoblasts); error bars indicate SD. (H - K) Representative immunoblot of SIRT1 in the nuclear (H and I) and cytoplasmic (J and K) fraction, comparing GFP and LMOD1 OE at early time points of differentiation (0 hr: undifferentiated/proliferating, 6 hr, 12 hr, 24 hr of differentiated primary myoblasts). SIRT1 signal was analyzed in n=3 immunoblots and was normalized to the respective entire lane of the Ponceau staining. In bar plots, each symbol represents a biological replicate, and the error bars indicate the SD. Paired t-test *: p-value ≤0.05, ns: not significant. The following figure supplement is available for Figure 5: Figure 5—figure supplement 1.
-
Figure 5—source data 1
Raw unedited western blot gels for Figure 5H and J.
SIRT1 and Ponceau detection from nuclear (panel H) and cytoplasmic (panel J) fractions across three biological replicates.
- https://cdn.elifesciences.org/articles/104331/elife-104331-fig5-data1-v1.zip
-
Figure 5—source data 2
Uncropped and labeled gel panels for Figure 5H and J.
- https://cdn.elifesciences.org/articles/104331/elife-104331-fig5-data2-v1.zip
Figure 5—figure supplement 1
Subcellular localization of LMOD1 and SIRT1 during myogenic differentiation.
(A and B) Total immunofluorescence intensity (nucleus and cytoplasm) of LMOD1 (A) and SIRT1 (B) during different time points of myogenic differentiation. (C) Representative immunoblot of the nuclear-cytoplasmic fractionation experiment in primary myoblasts at different time points: 2d proliferation, 1d differentiation, and 2d differentiation. SIRT1 and LMOD1 signal was analyzed in (n=3) immunoblots and normalized to the respective entire lane of the Ponceau staining. ALDOA signal was used as a cytoplasmic marker, and Histone 4 (H4) was used as a nuclear marker. Immunoblot analyses of LMOD1 and SIRT1 intensity for each cellular compartment are depicted in the bar plots. One-way ANOVA *: p-value ≤ 0.05, ns: not significant. (D) Immunoblot showing LMOD1 and SIRT1 protein abundance at different time points of myogenic differentiation (0 hr=proliferating conditions, 6 hr differentiation, 12 hr differentiation, 24 hr differentiation). Quantification of immunoblots for LMOD1 and SIRT1 shown in bar plots normalized to GAPDH. For all bar plots, each symbol represents a biological replicate, and the error bars indicate the SD.
-
Figure 5—figure supplement 1—source data 1
Raw unedited western blot gels for Figure 5—figure supplement 1, panels C and D.
Panel C: LMOD1, SIRT1, ALDOA, Histone H4, and Ponceau – subcellular fractionation Panel D: LMOD1, SIRT1, GAPDH, and Ponceau – subcellular fractionation of LMOD1 overexpressing cells.
- https://cdn.elifesciences.org/articles/104331/elife-104331-fig5-figsupp1-data1-v1.zip
-
Figure 5—figure supplement 1—source data 2
Uncropped and labeled gel panels for Figure 5—figure supplement 1, panels C and D.
- https://cdn.elifesciences.org/articles/104331/elife-104331-fig5-figsupp1-data2-v1.zip
Figure 6 with 1 supplement
Reduced SIRT1 signaling can partially reverse siLmod1-induced impaired myogenic differentiation.
(A) Illustration of the experimental setup. Primary myoblasts were co-transfected with Lmod1-specific siRNA (siLmod1) and siRNA against Sirt1 (siSirt1) (depicted in orange) or treated with SIRT1 inhibitor EX527 (depicted in pink), simultaneously to the induction of differentiation. (B/F) Representative immunofluorescence images after Lmod1 and Sirt1 knockdown with siRNA at day 3 of differentiation (B) or after Lmod1 knockdown and addition of 25 µM EX527 at day 3 of differentiation (F); MYOGENIN (red), devMHC (green), nuclei (Hoechst, blue). (C - E) Quantification of the number of nuclei per myotube (C), percentage of Myogenin-/MHC + cells (D), and measured length of differentiated myotubes (E) after siRNA transfection of SIRT1 and LMOD1. One-way ANOVA *: p-value ≤0.05, **: p-value ≤0.01. (G - I) Quantification of the number of nuclei per myotube (G), percentage of Myogenin-/MHC + cells (H), and measured length of differentiated myotubes (I) after siRNA knockdown of LMOD1 and EX527 treatment to inhibit SIRT1. One-way ANOVA *: p-value ≤0.05, **: p-value ≤0.01. (J). Illustration of the experimental setup for the RNA-Seq experiment. Primary myoblasts were first seeded and then transfected with siRNA against LMOD1 or SIRT1 or siCtrl. After 2 days of incubation, the primary myoblasts were transfected a second time with siRNA and induced to differentiate simultaneously. After 1 day of differentiation, cells were harvested, and RNA was isolated for library preparation and RNAseq analysis. (K) Heatmap indicating oppositely differentially expressed SIRT1 target genes from siSirt1 vs siCtrl and siLmod1 vs siCtrl with a log2 FC ratio >0.58. SIRT1 target genes identified from ChipSeq experiment published in ((Supplementary file 4) Ryall et al., 2015). For all bar plots, each symbol represents a biological replicate, and the error bars indicate the SD. The following figure supplement is available for Figure 6: Figure 6—figure supplement 1.
Figure 6—figure supplement 1
Reduced SIRT1 signaling can partially reverse siLmod1-induced impaired myogenic differentiation.
(A) Immunoblot validation of the LMOD1 and SIRT1 single knockdown and double knockdown (siLmod1/siSirt1) or a scrambled siRNA. Primary myoblasts were transfected at the initiation of differentiation and harvested after 3 days of differentiation. One-way ANOVA: *: p-value ≤0.05. **: p-value ≤0.01. (B) qRT-PCR analysis showing the relative expression of Sirt1 and Lmod1 in siLmod1 or siSirt1 single knockdown or double knockdown compared to siCtrl-transfected cells, normalized to Gapdh expression levels. Paired t-test *: p-value ≤0.05 **: p-value ≤0.01. (C) and (D) Percentage of cell populations found in immunofluorescence staining: non-proliferating myoblasts (Hoechst+/Myogenin-/MHC-) cells, Myogenin+/MHC- cells, Myogenin+/MHC+, fully differentiated myotubes, and total counted cells under differentiating conditions after siRNA-mediated knockdown of LMOD1 and SIRT1 (C.) related to Figure 6C-E or siRNA mediated knockdown of LMOD1 and EX527 treatment to inhibit SIRT1 (D.) related to Figure 6G-I (E) Normalized RNA-seq read counts of Lmod1 and Sirt1 after 1 day of differentiation after siCtrl and siLmod1 and siCtrl and siSirt1 knockdown (Figure 5—figure supplement 1). Paired t-test *: p-value ≤ 0.05 ***: p-value ≤ 0.001. For all bar plots, each symbol represents a biological replicate, and the error bars indicate the SD. (F) Working model: During the proliferation stage, SIRT1 is found in the nucleus, repressing the expression of myogenic regulating factors. However, at the onset of myogenic differentiation, LMOD1 interacts with SIRT1 and affects its subcellular localization, leading to decreased levels of SIRT1 in the nucleus. This reduction in SIRT1 levels results in the de-repression of MRFs and the initiation of differentiation.
-
Figure 6—figure supplement 1—source data 1
Raw unedited western blot gels for Figure 6 - figure supplement 1, panel A.
LMOD1, SIRT1, and GAPDH detection - validation of single and double knockdown of Lmod1 and Sirt1.
- https://cdn.elifesciences.org/articles/104331/elife-104331-fig6-figsupp1-data1-v1.zip
-
Figure 6—figure supplement 1—source data 2
Uncropped and labeled gel panels for Figure 6 - figure supplement 1, panel A.
- https://cdn.elifesciences.org/articles/104331/elife-104331-fig6-figsupp1-data2-v1.zip
Author response image 1
Specificity of antibodies detecting LMOD1.
Representative immunofluorescence images of LMOD1 in primary myoblast cultures following siLmod1 knockdown, LMOD1 overexpression, or controls transfected with a non-targeting siRNA (siCtrl) after one day of differentiation. LMOD1 (purple), SIRT1 (yellow), and nuclei (Hoechst, blue). Scale bar: 10 µm.
Author response image 2
Knockdown efficiency of siRNAs targeting Lmod1 and Lmod2 following using the same self-delivering siRNA in proliferating primary myoblasts as used in in vivo experiments.
Self-delivering Accell siRNA was added to primary myoblasts cultured in low serum media for 48 hours. Relative mRNA expression levels of Lmod1 and Lmod2 were measured after self-delivering Accell siRNA transfection targeting either Lmod1 (siLmod1) or Lmod2 (siLmod2). Expression levels were compared to control siRNA-transfected cells (siCtrl) and normalized to Gapdh expression.
Author response image 3
Co-staining of LMOD1 and Phalloidin in differentiating myocytes.
Example image showing immunofluorescence staining of LMOD1 (purple) and F-actin (green; Phalloidin) in differentiating primary myocytes. LMOD1 appears to accumulate at the ends of elongated myocytes and co-localizes with actin structures (highlighted in boxes), suggesting a potential role in myotube elongation and guidance during differentiation.
Tables
Table 1
Primers for cloning.
| Primer name | Sequence (5′–3′’) |
|---|---|
| Lmod1 sequencing primer (forward) | CTT GTG GCC GTT TAC GTC |
| Lmod1 sequencing primer (reverse) | CCCACTTGCTTGCTTTCATC |
| GFP sequencing primer (forward) | TAATACGACTCACTATAGGG |
| GFP sequencing primer (forward) | CGACTCACTATAGGGAGAGCGGC |
| pMSCV.puro sequencing primer (forward) | CGAGACCTCATCACCCAGG |
| T7 (forward) | TAATACGACTCACTATAGGG |
| pJet1.2 sequencing primer (forward) | CGACTCACTATAGGGAGAGCGGC |
| Lmod1_pcr_(forward) | CACCATGTCCAAAGTAGCTAAGTACCG |
| Lmod1.wSTOP (reverse) | TTATTGAAGTAGCTTGGGCACC |
| Lmod1.woSTOP (reverse) | TTGAAGTAGCTTGGGCACC |
| Lmod2.pcr (forward) | CACCATGTCTACGTTTGGCTACAGAAG |
| Lmod2.woSTOP (reverse) | TCTCAGAGCTTCGGGAACTTC |
| Lmod2.wSTOP (reverse) | TTATCTCAGAGCTTCGGGAACTTC |
Table 2
Primers for qRT-PCR.
| Primer name | Sequence (5′–3′) |
|---|---|
| GAPDH (forward) | ATGCCAGTGAGCTTCCCGTC |
| GAPDH (reverse) | CATCACCATCTTCCAGGAGC |
| Lmod1 (forward) | AAAAGACAGGAGTGTCAAGAAC |
| Lmod1 (reverse) | CCCCAGAACCTATGCCCTC |
| Lmod2 (forward) | ACCTTATCCCGATTTGCTGAAG |
| Lmod2 (reverse) | ACCTTGAGCATGTCTGCAATG |
| MyoD (forward) | CTACAGTGGCGACTCAGAT |
| MyoD (reverse) | CACTGTAGTAGGCGGTGTC |
| Myogenin (forward) | CAGTACATTGAGCGCCTAC |
| Myogenin (reverse) | AAGGCAACAGACATATCCTC |
| Pax7 (forward) | TCTTACTGCCCACCCACCTA |
| Pax7 (reverse) | CACGTTTTTGGCCAGGTAAT |
| Sirt1 (forward) | TGATTGGCACCGATCCTCG |
| Sirt1 (reverse) | CCACAGCGTCATATCATCCAG |
| 18 S (forward) | CCATCCAATCGGTAGTAGCG |
| 18 S (reverse) | GTAACCCGTTGAACCCCATT |
Table 3
Antibody list.
| Antibody name | Source | Product number |
|---|---|---|
| Monoclonal rat IgG2a Sca1-FITC | eBioscience | 11-5981-85RRID:AB_465334 |
| Monoclonal rat IgG2a Sca1-PE (Ly-6A/E-PE) | BDBioscience | 553108RRID:AB_394629 |
| Hybridoma mouse IgG1 Pax7 | DSHB | Pax7RRID:AB_528428 |
| Polyclonal rabbit IgG Lmod1 | Proteintech | 15117–1-AP |
| Polyclonal human IgG Lmod2 | Atlas Antibodies | HPA051039 |
| Polyclonal chicken IgG Laminin | LSBio | LS-C96142 |
| Hybridoma mouse IgG1 myogenin | DSHB | F5D |
| Hybridoma mouse IgG1 devMHC | DSHB | MF20 |
| Polyclonal rabbit IgG Ki-67 | Abcam | ab15580 |
| Monoclonal mouse IgG2b Sirt1 | Proteintech | 60303–1-Ig |
| bisBenzimideH 33258 (Hoechst) | Sigma-Aldrich | B2261 |
| Monoclonal mouse M2 Flag | Sigma-Aldrich | F1804 |
| Monoclonal mouse IgG GFP | Santa Cruz | Sc-9996 |
| Monoclonal mouse IgG BirA | Novus Biologicals | 5B11c3-3 |
| Monoclonal mouse IgG1 Gapdh | Santa Cruz | sc-365062 |
| Monoclonal mouse IgG H4 (L64C1) | Cell Signaling | #2935 |
| Monoclonal mouse IgG Aldoa | Proteintech | 67453–1-Ig |
| Anti-mouse IgG Alexa Fluor 488 | Thermo Fisher | A-21121 |
| Anti-mouse IgG Alexa Fluor 546 | Thermo Fisher | A-21123 |
| Anti-mouse IgG2b Alexa Fluor 488 | Thermo Fisher | A-21141 |
| Anti-mouse IgG2b Alexa Fluor 488 | Thermo Fisher | A-21242 |
| Anti-rabbit IgG Alexa Fluor 488 | Thermo Fisher | A-21206 |
| Anti-rabbit IgG Alexa Fluor 546 | Thermo Fisher | A10040 |
| Anti-rabbit IgG Alexa Fluor 647 | Thermo Fisher | A-31573 |
| Anti-chicken IgG Alexa Fluor 488 | Thermo Fisher | A-11039 |
| Anti-streptavidin Alexa Fluor 568 | Thermo Fisher | S11226 |
| Anti-mouse immunoglobulins/HRP | Agilent Dako | P0448 |
| Anti-rabbit immunoglobulins/HRP | Agilent Dako | P0447 |
Appendix 1—key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Biological sample (Mus musculus) | whole muscle | Janvier Labs; FLI animal facility | C57BL/6 J | Young: 2–6 mo; Old: 18–20 mo; Geriatric: 24–33 mo; SPF facility; approvals Reg.-Nr. FLI-17–014, FLI-22–011 |
| Biological sample (Mus musculus) | Primary MuSCs (hindlimb) | Janvier Labs; FLI animal facility | C57BL/6 J | FACS-isolated: α7-integrin+/CD11b−/CD31−/CD45−/Sca1− |
| Biological sample (Mus musculus) | Primary myoblasts | Janvier Labs; FLI animal facility | C57BL/6 J | Derived from FACS MuSCs for proliferation/differentiation assays |
| Cell line (Homo sapiens) | HEK293T Flp-In T-REx | Thermo Fisher Scientific | Cat#: R78007 | Used for BioID and IF; selected with Zeocin, Blasticidin, Hygromycin |
| Cell line (Homo sapiens) | Plat-E (retroviral packaging) | Cell Biolabs, Inc. | Cat#: RV-101 | Cultured in DMEM high glucose with 10% FBS, 1% Pen/Strep |
| Recombinant DNA reagent | pENTR233.1-Lmod1 (entry clone) | Dharmacon | Cat#: 100016603 | Spectinomycin-resistant |
| Recombinant DNA reagent | cloneJET (donor vector) | Thermo Fisher Scientific | Cat#: K1232 | Ampicillin-resistant; blunt-end cloning |
| Recombinant DNA reagent | pMSCV.puro backbone | Takara Bio | Cat#: 634401 | Retroviral expression system; ampicillin-resistant |
| Transfected construct (Homo sapiens) | BirA*-LMOD1 | Mackmull et al., 2017 | Addgene ID: #221509 | Stable expression in HEK293T Flp-In T-REx; induced with tetracycline |
| Transfected construct (Homo sapiens) | BirA*-LMOD2 | Mackmull et al., 2017 | Addgene ID: #221510 | Stable expression in HEK293T Flp-In T-REx; induced with tetracycline |
| Transfected construct (Mus musculus) | pMSCV.puro-Lmod1 (retroviral) | This paper | Addgene ID: #221506 | Overexpression in primary myoblasts; puromycin selection |
| Transfected construct (Mus musculus) | pMSCV.puro-GFP (retroviral) | This paper | Addgene ID: #86537 | Control overexpression |
| Sequence-based reagent | Accell siRNA ON-TARGETplus Non-targeting Pool | Dharmacon | Cat#: D-001910-10-50 | Self-delivering; in vivo TA injection |
| Sequence-based reagent | Accell siRNA ON-TARGETplus targeting Lmod1 | Dharmacon | Cat#: E-051082-00-0050 | Self-delivering; in vivo TA injection |
| Sequence-based reagent | ON-TARGETplus Non-targeting Pool (cell culture) | Dharmacon | Cat#: D-001810-10-05 | Used with Lipofectamine RNAiMAX |
| Sequence-based reagent | SMARTpool ON-TARGETplus Lmod1 siRNA | Dharmacon | Cat#: L-051082-01-0005 | Aliases: 9530015K06Rik; SM-Lmod |
| Sequence-based reagent | SMARTpool ON-TARGETplus Lmod2 siRNA | Dharmacon | Cat#: L-055604-01-0005 | Alias: C-Lmod |
| Sequence-based reagent | SMARTpool ON-TARGETplus Sirt1 siRNA | Dharmacon | Cat#: L-049440-00-0005 | Aliases: AA673258; SIR2L1; Sir2; Sir2a; Sir2alpha |
| Sequence-based Reagent | GAPDH qPCR primer (forward) | Metabion | Sequence: 5′−ATGCCAGTGAGCTTCCCGTC−3′5′−ATGCCAGTGAGCTTCCCGTC−3′ | Target: Gapdh (mouse) |
| Sequence-based reagent | GAPDH qPCR primer (reverse) | Metabion | Sequence: 5′−CATCACCATCTTCCAGGAGC−3′5′−CATCACCATCTTCCAGGAGC−3′ | Target: Gapdh (mouse) |
| Sequence-based reagent | Lmod1 qPCR primer (forward) | Metabion | Sequence: 5′−AAAAGACAGGAGTGTCAAGAAC−3′5′−AAAAGACAGGAGTGTCAAGAAC−3′ | Target: Lmod1 (mouse) |
| Sequence-based reagent | Lmod1 qPCR primer (reverse) | Metabion | Sequence: 5′−CCCCAGAACCTATGCCCTC−3′5′−CCCCAGAACCTATGCCCTC−3′ | Target: Lmod1 (mouse) |
| Sequence-based reagent | Lmod2 qPCR primer (forward) | Metabion | Sequence: 5′−ACCTTATCCCGATTTGCTGAAG−3′5′−ACCTTATCCCGATTTGCTGAAG−3′ | Target: Lmod2 (mouse) |
| Sequence-based reagent | Lmod2 qPCR primer (reverse) | Metabion | Sequence: 5′−ACCTTGAGCATGTCTGCAATG−3′5′−ACCTTGAGCATGTCTGCAATG−3′ | Target: Lmod2 (mouse) |
| Sequence-based reagent | MyoD qPCR primer (forward) | Metabion | Sequence: 5′−CTACAGTGGCGACTCAGAT−3′5′−CTACAGTGGCGACTCAGAT−3′ | Target: Myod1 (mouse) |
| Sequence-based reagent | MyoD qPCR primer (reverse) | Metabion | Sequence: 5′−CACTGTAGTAGGCGGTGTC−3′5′−CACTGTAGTAGGCGGTGTC−3′ | Target: Myod1 (mouse) |
| Sequence-based reagent | Myogenin qPCR primer (forward) | Metabion | Sequence: 5′−CAGTACATTGAGCGCCTAC−3′5′−CAGTACATTGAGCGCCTAC−3′ | Target: Myog (mouse) |
| Sequence-based reagent | Myogenin qPCR primer (reverse) | Metabion | Sequence: 5′−AAGGCAACAGACATATCCTC−3′5′−AAGGCAACAGACATATCCTC−3′ | Target: Myog (mouse) |
| Sequence-based reagent | Pax7 qPCR primer (forward) | Metabion | Sequence: 5′−TCTTACTGCCCACCCACCTA−3′5′−TCTTACTGCCCACCCACCTA−3′ | Target: Pax7 (mouse) |
| Sequence-based reagent | Pax7 qPCR primer (reverse) | Metabion | Sequence: 5′−CACGTTTTTGGCCAGGTAAT−3′5′−CACGTTTTTGGCCAGGTAAT−3′ | Target: Pax7 (mouse) |
| Sequence-based reagent | Sirt1 qPCR primer (forward) | Metabion | Sequence: 5′−TGATTGGCACCGATCCTCG−3′5′−TGATTGGCACCGATCCTCG−3′ | Target: Sirt1 (mouse) |
| Sequence-based reagent | Sirt1 qPCR primer (reverse) | Metabion | Sequence: 5′−CCACAGCGTCATATCATCCAG−3′5′−CCACAGCGTCATATCATCCAG−3′ | Target: Sirt1 (mouse) |
| Sequence-based reagent | 18 S rRNA qPCR primer (forward) | Metabion | Sequence: 5′−CCATCCAATCGGTAGTAGCG−3′5′−CCATCCAATCGGTAGTAGCG−3′ | Reference gene |
| Sequence-based reagent | 18 S rRNA qPCR primer (reverse) | Metabion | Sequence: 5′−GTAACCCGTTGAACCCCATT−3′5′−GTAACCCGTTGAACCCCATT−3′ | Reference gene |
| Sequence-based reagent | Lmod1 cloning primer (forward; PCR) | Metabion | Sequence: 5′−CACCATGTCCAAAGTAGCTAAGTACCG−3′5′−CACCATGTCCAAAGTAGCTAAGTACCG−3′ | Cloning Lmod1 |
| Sequence-based reagent | Lmod1 cloning primer (reverse; w/ STOP) | Metabion | Sequence: 5′−TTATTGAAGTAGCTTGGGCACC−3′5′−TTATTGAAGTAGCTTGGGCACC−3′ | Cloning Lmod1 |
| Sequence-based reagent | Lmod1 cloning primer (reverse; w/o STOP) | Metabion | Sequence: 5′−TTGAAGTAGCTTGGGCACC−3′5′−TTGAAGTAGCTTGGGCACC−3′ | Cloning Lmod1 |
| Sequence-based reagent | Lmod2 cloning primer (forward; PCR) | Metabion | Sequence: 5′−CACCATGTCTACGTTTGGCTACAGAAG−3′5′−CACCATGTCTACGTTTGGCTACAGAAG−3′ | Cloning Lmod2 |
| Sequence-based reagent | Lmod2 cloning primer (reverse; w/o STOP) | Metabion | Sequence: 5′−TCTCAGAGCTTCGGGAACTTC−3′5′−TCTCAGAGCTTCGGGAACTTC−3′ | Cloning Lmod2 |
| Sequence-based reagent | Lmod2 cloning primer (reverse; w/ STOP) | Metabion | Sequence: 5′−TTATCTCAGAGCTTCGGGAACTTC−3′5′−TTATCTCAGAGCTTCGGGAACTTC−3′ | Cloning Lmod2 |
| Sequence-based reagent | Lmod1 sequencing primer (forward) | Metabion | Sequence: 5′−CTTGTGGCCGTTTACGTC−3′5′−CTTGTGGCCGTTTACGTC−3′ | Sequencing |
| Sequence-based reagent | Lmod1 sequencing primer (reverse) | Metabion | Sequence: 5′−CCCACTTGCTTGCTTTCATC−3′5′−CCCACTTGCTTGCTTTCATC−3′ | Sequencing |
| Sequence-based reagent | GFP sequencing primer (forward 1) | Metabion | Sequence: 5′−TAATACGACTCACTATAGGG−3′5′−TAATACGACTCACTATAGGG−3′ | Sequencing |
| Sequence-based reagent | GFP sequencing primer (forward 2) | Metabion | Sequence: 5′−CGACTCACTATAGGGAGAGCGGC−3′5′−CGACTCACTATAGGGAGAGCGGC−3′ | Sequencing |
| Sequence-based reagent | pMSCV.puro sequencing primer (forward) | Metabion | Sequence: 5′−CGAGACCTCATCACCCAGG−3′5′−CGAGACCTCATCACCCAGG−3′ | Sequencing |
| Sequence-based reagent | T7 primer (forward) | Metabion | Sequence: 5′−TAATACGACTCACTATAGGG−3′5′−TAATACGACTCACTATAGGG−3′ | Sequencing |
| Sequence-based reagent | pJET1.2 sequencing primer (forward) | Metabion | Sequence: 5′−CGACTCACTATAGGGAGAGCGGC−3′5′−CGACTCACTATAGGGAGAGCGGC−3′ | Sequencing |
| Antibody | anti-α7 Integrin 647 (mouse monoclonal, clone R2F2) | The University of British Columbia AbLab | Cat#: 67-0010-05 | FACS (1:500) |
| Antibody | CD11b-PE (rat monoclonal) | BD Biosciences | Cat#: 553311 | FACS (1:500) |
| Antibody | CD31-PE (rat monoclonal) | BD Biosciences | Cat#: 553373 | FACS (1:500) |
| Antibody | CD45-PE (rat monoclonal) | BD Biosciences | Cat#: 553081 | FACS (1:500) |
| Antibody | Sca1-PE (Ly-6A/E-PE; rat monoclonal) | BD Biosciences | Cat#: 553108 | FACS (1:500) |
| Antibody | Pax7 (mouse monoclonal, Hybridoma IgG1) | DSHB | Clone: Pax7 | IF (undiluted hybridoma supernatant) |
| Antibody | Myogenin (mouse monoclonal, F5D, Hybridoma) | DSHB | Clone: F5D | IF (undiluted hybridoma supernatant) |
| Antibody | Laminin (chicken polyclonal) | LSBio | Cat#: LS-C96142 | IF (1:500) |
| Antibody | Lmod1 (rabbit polyclonal) | Proteintech | Cat#: 15117–1-AP | IF/WB (1:500) |
| Antibody | Lmod2 (polyclonal human IgG) | Atlas Antibodies | Cat#: HPA051039 | WB (1:500) |
| Antibody | Ki-67 (rabbit polyclonal) | Abcam | Cat#: ab15580 | IF (1:500) |
| Antibody | Sirt1 (mouse monoclonal, IgG2b) | Proteintech | Cat#: 60303–1-Ig | IF (1:400); WB (1:1000) |
| Antibody | anti-BirA (mouse monoclonal) | Novus Biologicals | Cat#: 5B11c3-3 | WB (1:500) |
| Antibody | anti-GFP (mouse monoclonal) | Santa Cruz | Cat#: sc-9996 | WB (1:1000) |
| Antibody | anti-H4 (mouse monoclonal, L64C1) | Cell Signaling Technology | Cat#: 2935 | WB (1:1000) |
| Antibody | anti-GAPDH (mouse monoclonal) | Santa Cruz | Cat#: sc-365062 | WB (1:200) |
| Antibody | anti-Aldoa (mouse monoclonal) | Proteintech | Cat#: 67453–1-Ig | WB (1:20000) |
| Antibody | anti-FLAG M2 (mouse monoclonal) | Sigma-Aldrich | Cat#: F1804 | IF (1:500) |
| Antibody | anti-mouse IgG Alexa Fluor 488 (goat polyclonal) | Thermo Fisher Scientific | Cat#: A-21121 | IF (1:1000) |
| Antibody | anti-mouse IgG Alexa Fluor 546 (goat polyclonal) | Thermo Fisher Scientific | Cat#: A-21123 | IF (1:1000) |
| Antibody | anti-mouse IgG2b Alexa Fluor 488 (goat polyclonal) | Thermo Fisher Scientific | Cat#: A-21141 | IF (1:1000) |
| Antibody | anti-mouse IgG2b Alexa Fluor 594 (goat polyclonal) | Thermo Fisher Scientific | Cat#: A-21242 | IF (1:1000) |
| Antibody | anti-rabbit IgG Alexa Fluor 488 (goat polyclonal) | Thermo Fisher Scientific | Cat#: A-21206 | IF (1:1000) |
| Antibody | anti-rabbit IgG Alexa Fluor 546 (goat polyclonal) | Thermo Fisher Scientific | Cat#: A10040 | IF (1:1000) |
| Antibody | anti-rabbit IgG Alexa Fluor 647 (goat polyclonal) | Thermo Fisher Scientific | Cat#: A-31573 | IF (1:1000) |
| Antibody | anti-chicken IgG Alexa Fluor 488 (goat polyclonal) | Thermo Fisher Scientific | Cat#: A-11039 | IF (1:1000) |
| Antibody | Anti-Streptavidin Alexa Fluor 568 | Thermo Fisher Scientific | Cat#: S11226 | IF (1:2000) |
| Antibody | Anti-Mouse Immunoglobulins/HRP (goat polyclonal) | Agilent Dako | Cat#: P0448 | WB (1:1500) |
| Antibody | Anti-Rabbit Immunoglobulins/HRP (goat polyclonal) | Agilent Dako | Cat#: P0447 | WB (1:2000) |
| Antibody | Hoechst (bisBenzimide H 33258; nuclear stain) | Sigma-Aldrich | Cat#: B2261 | IF (1:5000; 0.02 μg/μL) |
| Chemical compound, drug | Cardiotoxin | Latoxan | Cat#: L8102 | TA injury, 10 μM in 0.9% NaCl |
| Chemical compound, drug | Isoflurane (Tec 7 Isoflurane Anesthesia Vaporizer) | Covetrus; Datex Ohmeda (device) | Cat#: 798932 | Anesthesia |
| Chemical compound, drug | Metacam (meloxicam) | Covetrus | Cat#: 798932 | Analgesia, 1 mg/kg |
| Chemical compound, drug | 0.9% NaCl sterile saline | Medpex | Cat#: 12391112 | Vehicle for CTX |
| Chemical compound, drug | SYTOX Blue Dead Cell Stain | Thermo Fisher Scientific | Cat#: S34857 | Live/dead discrimination for FACS |
| Chemical compound, drug | Collagen I (coating) | Corning | Cat#: 354236 | 0.167 mg/mL, 1 h RT |
| Chemical compound, drug | Ham’s F-10 Nutrient Mix | Thermo Fisher Scientific | Cat#: 31550031 | Culture medium |
| Chemical compound, drug | FBS | Thermo Fisher Scientific (Gibco) | Cat#: 10270106 | 10–20% as indicated |
| Chemical compound, drug | Penicillin–Streptomycin | Thermo Fisher Scientific | Cat#: 15140–122 | 0.01 |
| Chemical compound, drug | bFGF | Thermo Fisher Scientific | Cat#: 13256029 | 2.5 ng/mL |
| Chemical compound, drug | DMEM high glucose | Sigma-Aldrich | Cat#: D6429 | 5 g/L glucose |
| Chemical compound, drug | Zeocin | Thermo Fisher Scientific | Cat#: R250-01 | 100 μg/mL |
| Chemical compound, drug | Blasticidin | Thermo Fisher Scientific (Gibco) | Cat#: R210-01 | 15 μg/mL |
| Chemical compound, drug | Hygromycin B | Thermo Fisher Scientific | Cat#: 10687–010 | 100 μg/mL |
| Chemical compound, drug | Poly-D-Lysine solution | Gibco | Cat#: A3890401 | 50 μg/mL for coverslips |
| Chemical compound, drug | Protamine sulfate | Thermo Fisher Scientific | Cat#: J62926.06 | 5 μL of 8 μg/mL added during infection |
| Chemical compound, drug | Puromycin | InvivoGen | Cat#: ant-pr-1 | Selection 1.25 μg/mL |
| Chemical compound, drug | Tetracycline | Sigma-Aldrich | Cat#: 87128 | 1 μg/mL induction for BioID |
| Chemical compound, drug | DTT | Roth | Cat#: 6908.3 | 10 mM for reduction |
| Chemical compound, drug | Iodoacetamide (IAA) | Sigma-Aldrich | Cat#: I1149 | 15 mM for alkylation |
| Chemical compound, drug | Sulfo-NHS-Acetate | Thermo Fisher Scientific | Cat#: 26777 | Bead acetylation for BioID |
| Peptide, recombinant Protein | Trypsin (sequencing grade) | Promega | V5280 | Digestion (1:100, w/w) |
| Peptide, recombinant protein | Lys-C | FUJIFILM Wako | Cat#: 121–05063 | Digestion (1:100, w/w) |
| Peptide, recombinant protein | Streptavidin Alexa Fluor 568 | Thermo Fisher Scientific | Cat#: S11226 | Also listed under antibodies; used at 1:2000 |
| Peptide, recombinant protein | Biotin | Sigma-Aldrich | Cat#: B4501 | BioID labeling (50 μM) |
| Other | MOM blocking reagent | Vector Laboratories | MKB-2213–1 | Used 1:40 for muscle sections |
| Other | Permafluor mounting medium | Thermo Fisher Scientific | Cat#: TA-006-FM | Mounting medium |
| Other | Ibidi 4-well culture slide | Ibidi | Cat#: 80426 | Collagen-coated for IF |
| Other | 12-well chamber (removable) | Ibidi | Cat#: 81201 | For PLA and IF |
| Other | 24-well plates | VWR | Cat#: 734–2325 | Cell seeding |
| Other | Coverslips | VWR; Carl Roth | VWR Cat#: 631–1574; Roth Cat#: YX03.1 | Autoclaved for IF |
| Commercial assay or kit | Lipofectamine RNAiMAX | Thermo Fisher Scientific | Cat#: 13778075 | siRNA transfections |
| Commercial assay or kit | MSCV Retroviral Expression System | Takara Bio | Cat#: 634401 | For overexpression in MuSCs |
| Commercial assay or kit | Duolink In Situ Red kit (PLA) | Sigma-Aldrich | Cat#: DUO92008 | Proximity ligation assay |
| Commercial assay or kit | In Situ Cell Death Detection Kit (TUNEL) | Roche | Cat#: 12156792910 | Apoptosis detection |
| Commercial assay or kit | GoScript Reverse Transcriptase kit | Promega | Cat#: A5001 | cDNA synthesis |
| Commercial assay or kit | iQ SYBR Green Supermix | Bio-Rad | Cat#: 1708882 | qRT-PCR |
| Commercial assay or kit | TruSeq RNA Library Prep Kit v2 | Illumina | Cat#: RS-122–2001 | Poly-A RNA-seq library prep |
| Commercial assay or kit | Agencourt AMPure XP Beads | Beckman Coulter | Cat#: A63881 | DNA cleanup |
| Commercial assay or kit | EZQ Protein Quantitation Kit | Thermo Fisher Scientific | Cat#: R33200 | Protein quantification |
| Commercial assay or kit | Qubit 3 Fluorometer | Invitrogen | Cat#: 15387293 | Nucleic acid/protein quantification |
| Commercial assay or kit | Qubit assay tubes | Invitrogen | Cat#: Q32856 | Consumables for Qubit |
| Commercial assay or kit | GFP-Trap Agarose | ChromoTek (Proteintech) | Cat#: gta | Immunoprecipitation of GFP fusions |
| Commercial assay or kit | Waters Oasis HLB μElution Plate, 30 μm | Waters | Cat #: 186001828BA | Peptide desalting |
| Commercial assay or kit | HRM kit spike-in | Biognosys | Cat#: Ki-3002–1 | Added to reconstituted peptides before LC-MS |
| Software, algorithm | Spectronaut Professional (v10, v13, v14, v15) | Biognosys | Version 10, 13, 14, 15, 16 | DIA/DDA processing; settings in Methods |
| Software, algorithm | CFX Maestro 1.1 | Bio-Rad | Version 1.1 | qPCR analysis |
| Software, algorithm | GraphPad Prism | GraphPad | GraphPad 8 | Statistical analysis |
| Software, algorithm | Zen 2 Blue Edition | Carl Zeiss Microscopy GmbH | Blue Edition | Imaging acquisition/analysis |
| Software, algorithm | RStudio | Posit (RStudio) | Version | Downstream proteomics analysis |
Additional files
-
Supplementary file 1
Proteome dynamics during myogenic differentiation: Reactome pathway enrichment analysis for each protein cluster (clusters 1–5) and differential protein abundance across all differentiation time points compared to day 0.
- https://cdn.elifesciences.org/articles/104331/elife-104331-supp1-v1.xlsx
-
Supplementary file 2
LMOD1 overexpression proteomics: Differential protein abundance between LMOD1-overexpressing and GFP-control primary myoblasts, and gene set enrichment analysis (GSEA) ranked gene list.
- https://cdn.elifesciences.org/articles/104331/elife-104331-supp2-v1.xlsx
-
Supplementary file 3
BioID proximity labeling: Differential protein abundance for LMOD1-BirA* vs BirA* control, LMOD2-BirA* vs BirA* control, and LMOD1-BirA* vs LMOD2-BirA* in HEK293T cells.
- https://cdn.elifesciences.org/articles/104331/elife-104331-supp3-v1.xlsx
-
Supplementary file 4
RNA-seq analysis of SIRT1 target gene regulation: Differential gene expression for siLmod1 vs siCtrl and siSirt1 vs siCtrl in primary myoblasts, with SIRT1 target gene annotation and normalized count matrices.
- https://cdn.elifesciences.org/articles/104331/elife-104331-supp4-v1.xlsx
-
MDAR checklist
- https://cdn.elifesciences.org/articles/104331/elife-104331-mdarchecklist1-v1.pdf
Download links
A two-part list of links to download the article, or parts of the article, in various formats.
Downloads (link to download the article as PDF)
Open citations (links to open the citations from this article in various online reference manager services)
Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)
Proteome dynamics reveal Leiomodin 1 as a key regulator of myogenic differentiation
eLife 14:RP104331.
https://doi.org/10.7554/eLife.104331.3
