Structural mechanisms of PIP2 activation and SEA0400 inhibition in human cardiac sodium-calcium exchanger NCX1
eLife Assessment
Cardiac Ca2+/Na+ exchange is mediated by the NCX1 antiporter, whose activity is tightly regulated. This important manuscript describes the structural basis of activation by the lipid DiC8-PIP2 and inhibition by binding of a small molecule to NCX1. These results provide convincing insights into NCX1 regulation and the structural basis of cellular Ca2+ signaling.
https://doi.org/10.7554/eLife.105396.3.sa0Important: Findings that have theoretical or practical implications beyond a single subfield
- Landmark
- Fundamental
- Important
- Valuable
- Useful
Convincing: Appropriate and validated methodology in line with current state-of-the-art
- Exceptional
- Compelling
- Convincing
- Solid
- Incomplete
- Inadequate
During the peer-review process the editor and reviewers write an eLife Assessment that summarises the significance of the findings reported in the article (on a scale ranging from landmark to useful) and the strength of the evidence (on a scale ranging from exceptional to inadequate). Learn more about eLife Assessments
Abstract
Na+/Ca2+ exchangers (NCXs) transport Ca2+ across the plasma membrane in exchange for Na+ and play a vital role in maintaining cellular Ca2+ homeostasis. Our previous structural study of human cardiac NCX1 (HsNCX1) reveals the overall architecture of the eukaryotic exchanger and the formation of the inactivation assembly by the intracellular regulatory domain that underlies the cytosolic Na+-dependent inactivation and Ca2+ activation of NCX1. Here, we present the cryo-EM structures of HsNCX1 in complex with a physiological activator phosphatidylinositol 4,5-bisphosphate (PIP2), or pharmacological inhibitor SEA0400, that enhances the inactivation of the exchanger. We demonstrate that PIP2 binding stimulates NCX1 activity by inducing a conformational change at the interface between the transmembrane (TM) and cytosolic domains that destabilizes the inactivation assembly. In contrast, SEA0400 binding in the TM domain of NCX1 stabilizes the exchanger in an inward-facing conformation that facilitates the formation of the inactivation assembly, thereby promoting the Na+-dependent inactivation of NCX1. Thus, this study reveals the structural basis of PIP2 activation and SEA0400 inhibition of NCX1 and provides some mechanistic understandings of cellular regulation and pharmacology of NCX family proteins.
Introduction
Sodium-calcium exchangers (NCXs) are transporters that control the flux of Ca2+ across the plasma membrane and play a vital role in maintaining cellular calcium homeostasis for cell signaling (Ottolia et al., 2021; Clapham, 2007; Blaustein and Lederer, 1999; Philipson and Nicoll, 2000; Berridge et al., 2003; DiPolo and Beaugé, 2006). NCXs facilitate the exchange of three Na+ for one Ca2+ in an electrogenic manner, primarily responsible for extruding Ca2+ from the cytoplasm. However, this process can be reversed to permit Ca2+ entry, depending on the chemical gradients of Na+ and Ca2+, as well as the membrane potential (Blaustein and Lederer, 1999; Hilgemann et al., 1991; Reeves and Hale, 1984; Blaustein and Russell, 1975; Rasgado-Flores and Blaustein, 1987; Kimura et al., 1986; Matsuoka and Hilgemann, 1992; Kang and Hilgemann, 2004). Three NCX isoforms (NCX1–3) are present in mammals, with each isoform bearing multiple splice variants expressed in distinct tissues, thereby modulating numerous fundamental physiological events (Philipson and Nicoll, 2000; Philipson et al., 2004; Lee et al., 1994; Kofuji et al., 1994; Linck et al., 1998; Lytton, 2007; Dyck et al., 1999). Dysfunctions of NCXs are associated with a plethora of human pathologies, including cardiac hypertrophy, arrhythmia, and postischemic brain damage (Blaustein and Lederer, 1999; Watanabe et al., 2006; Pott et al., 2011; Matsuda et al., 1997). The cardiac variant NCX1.1 has been extensively studied, with its function playing a central role in cardiac excitation and contractile activity (Shigekawa and Iwamoto, 2001; Kimura et al., 1987; Bridge et al., 1990; Ottolia et al., 2013; Scranton et al., 2024).
The eukaryotic NCX consists of a transmembrane (TM) domain with 10 TM helices and a large intracellular regulatory domain between TMs 5 and 6 (Philipson and Nicoll, 2000; Ren and Philipson, 2013; Sharma and O’Halloran, 2014; Matsuoka et al., 1993; Hilgemann, 1990; Xue et al., 2023; Dong et al., 2024). The TM domain is responsible for the ion exchange function in NCX. It consists of two homologous halves (TMs 1–5 and TMs 6–10) with TMs 2–3 and TMs 7–8 forming the core of the TM domain and hosting the residues that coordinate the transported Na+ and Ca2+(Liao et al., 2012; Liao et al., 2016). The large regulatory domain contains two calcium-binding domains (CBD1 and CBD2). Ca2+ binding at CBDs enhances NCX activity and rescues it from the Na+-dependent inactivation, a process that manifests as slow decay of the exchange current due to elevated levels of cytosolic Na+ ions (Matsuoka and Hilgemann, 1992; Matsuoka et al., 1993; Hilgemann, 1990; Matsuoka et al., 1995; Hilge et al., 2006; Ottolia et al., 2009; Hilgemann et al., 1992a; Hilgemann et al., 1992c; Matsuoka and Hilgemann, 1994). A stretch of residues known as the XIP region (eXchanger Inhibitory Peptide) at the N-terminus of the regulatory domain plays a pivotal role in the Na+ inactivation process (Matsuoka et al., 1997; Li et al., 1991).
Several other cellular cues can also modulate NCX1 activity, including phosphatidylinositol 4,5-bisphosphate (PIP2) in the membrane. PIP2 has been shown to stimulate the NCX1 activity by reducing the Na+-dependent inactivation, and the XIP region was suggested to participate in the PIP2 activation (Hilgemann et al., 1992a; He et al., 2000; Hilgemann and Ball, 1996; Yaradanakul et al., 2007). In addition, several small molecule NCX inhibitors have been developed to provide valuable tools for studying the physiological and pharmacological properties of NCXs, among which compound SEA0400 is a highly potent and selective NCX1 inhibitor that promotes the Na+-dependent inactivation of the exchanger (Watanabe et al., 2006; Tanaka et al., 2002; Matsuda et al., 2001; Watano et al., 1996; Lee et al., 2004; Bouchard et al., 2004; Iwamoto et al., 2004).
We previously determined the human cardiac NCX1 structure in an inward-facing inactivated state in which XIP and the β-hairpin between TMs 1 and 2 form a TM-associated four-stranded β-hub and mediate a tight packing between the TM and cytosolic domains, resulting in the formation of a stable inactivation assembly that blocks the TM movement required for ion exchange function (Xue et al., 2023). The study also provides mechanistic insight into how cytosolic Ca2+ binding at CBD2 destabilizes the inactivation assembly and activates the exchanger (Xue et al., 2023). To expand our understanding of NCX modulation by PIP2 lipid and small molecule inhibitors, we present the cryo-EM structures of human cardiac NCX1 in complex with PIP2 or SEA0400, revealing the structural basis underlying PIP2 activation and SEA0400 inhibition of NCX1.
Results
PIP2 activation of NCX1
PIP2 has been shown to modulate NCX1 activity by reducing the Na+-dependent inactivation of the exchanger (Hilgemann et al., 1992a; He et al., 2000; Hilgemann and Ball, 1996; Yaradanakul et al., 2007). To characterize the effect of PIP2 on HsNCX1, we expressed the exchanger in Xenopus laevis oocytes and recorded the outward exchanger currents using the giant patch technique in the inside-out configuration with or without applying porcine brain PIP2 (Figure 1 and Methods). The recording was performed with 12 µM free cytosolic [Ca2+]i (bath), and the outward NCX1 current was elicited by the rapid replacement of 100 mM Cs+ with 100 mM Na+ in the bath solution. In the patches without applying PIP2, the outward exchanger currents quickly decay and reach a steady state due to Na+-dependent inactivation (Figure 1A). Introducing 10 µM PIP2 at the steady state progressively increases the current that plateaus at about twofold of the peak current measured before PIP2 addition (Figure 1A). After PIP2 washout, the outward current remains at the pre-removal level without obvious inactivation, indicating high-affinity PIP2 binding and its positive modulation of NCX1 by both potentiating the peak current and reducing the Na+-dependent inactivation. Intriguingly, the commonly used shorter chain PIP2 substitute (PIP2 diC8) does not have the equivalent activation effect on NCX1, and the exchanger remains susceptible to Na+-dependent inactivation when recorded in the presence of 10 µM PIP2 diC8 (Figure 1B). However, PIP2 diC8 still binds and stimulates both the peak and steady currents of the exchanger. This stimulation effect is abolished after PIP2 diC8 washout, indicating a lower affinity of short-chain PIP2 than that of the long-chain native PIP2.
Phosphatidylinositol 4,5-bisphosphate (PIP2) enhances HsNCX1 activity.
(A) Representative outward currents recorded from oocytes expressing the human NCX1 before and after application of long-chain brain PIP2. Currents were activated by replacing cytosolic Cs+ with Na+. Application of 10 µM brain PIP2 enhanced HsNCX1 current and abolished the Na+-dependent inactivation irreversibly. Perfusion time of PIP2 is indicated above traces, while lines below traces indicate solution exchange. Arrows mark the peak and steady currents used to measure the fold of increase upon PIP2 application. The fold of current increase was calculated by comparing the peak or steady-state current before and after PIP2 application (fold of increase in peak current = 2.2 ± 0.2, n=14; steady-state current = 8.9 ± 1.7, n=10; data points are mean ± s.e.m.). (B) Representative outward currents recorded before and after application of short-chain PIP2 diC8 (10 µM). PIP2 diC8 was perfused from the cytosolic side before HsNCX1 activation (in the presence of Cs+ for 30 s) and during transport (in the presence of Na+). Both peak and steady-state currents of HsNCX1 are enhanced by PIP2 diC8, and the effect is reversible (fold of current increase in peak current = 1.6 ± 0.1, n=8; steady-state current = 2.6 ± 0.4, n=6; data points are mean ± s.e.m.). The Na+-dependent inactivation remains in the presence of PIP2 diC8. (C) Representative outward currents recorded with the application of brain PIP2 and PIP2 diC8. The NCX1 current was first potentiated by applying 10 µM brain PIP2 at the steady state. The PIP2 effect was not reversible over the 5 min washout with a solution containing 100 mM Na+ and 12 µM Ca2+. The same patch was then perfused with the same solution in the presence of 10 µM PIP2 diC8. Application of the short-chain PIP2 diC8 facilitates the decrease of brain PIP2-potentiated current, suggesting that both lipids compete for the same binding site.
-
Figure 1—source data 1
The fold of current increase in the peak or steady-state current before and after PIP2 application.
- https://cdn.elifesciences.org/articles/105396/elife-105396-fig1-data1-v1.xlsx
To verify that the short-chain PIP2 diC8 and the long-chain brain PIP2 share the same binding site, we performed a competition assay. As shown in Figure 1C, introducing high-affinity brain PIP2 at the steady state yields a long-lasting potentiation of NCX1 current that is irreversible even after a 5 min washout. Applying PIP2 diC8 can steadily decrease the brain PIP2-potentiated NCX1 current, suggesting that both lipids compete for the same binding site.
Structural insight into PIP2 binding in NCX1
To reveal the structural mechanism of PIP2 activation, we tried to obtain the EM structure of HsNCX1 in the presence of the long-chain porcine brain PIP2. However, the exchanger becomes highly dynamic, yielding a low-resolution EM map with an overall shape similar to a cytosolic Ca2+-activated NCX1 whose β-hub-mediated inactivation assembly is destabilized and cytosolic domain (CBD1 and CBD2) is detached from the TM domain (Xue et al., 2023: Figure 2—figure supplement 1). We suspect the long-chain PIP2 exerts the same activation effect on NCX1 as high cytosolic Ca2+ by destabilizing the inactivation assembly. As NCX1 retains its Na+-dependent inactivation property in the presence of the short-chain PIP2, we reasoned that the PIP2 diC8-bound NCX1 likely remains in an inward-facing inactivated state in high Na+ low Ca2+ condition, and its structure would still reveal how PIP2 binds in NCX1. We therefore determined the EM structure of NCX1 in complex with PIP2 diC8 at 3.5 Å (Figure 2, Figure 2—figure supplement 2, Table 1, and Methods), which indeed adopts an inward-facing conformation with intact inactivation assembly. Due to the relative dynamic movement between the TM and cytosolic domains, we also performed local refinement to improve the map quality for each domain (Figure 2—figure supplement 2). The density of the IP3 head group from the bound PIP2 diC8 is well defined in the local-refined EM map focused on the TM domain (Figure 2A, Figure 2—figure supplement 2B). This density is not present in the apo NCX1 structure (Figure 2—figure supplement 3). The acyl chains, however, are flexible and could not be resolved in the structure (Figure 2—figure supplement 2). The lipid is attached to the cytosolic sides of TMs 4 and 5 with its head group positioned at the C-terminal end of TM5 (Figure 2A). Four positively charged residues, including K164 and R167 from the N-terminus of TM4 and R220 and K225 from the C-terminus of TM5, are positioned in the vicinity of the PIP2 head group and likely participate in the electrostatic interactions with the head group (Figure 2A).
Phosphatidylinositol 4,5-bisphosphate (PIP2) binding in NCX1.
(A) Structure of the transmembrane (TM) and β-hub regions of PIP2 diC8-bound NCX1 with a zoomed-in view of the lipid-binding site. The density of PIP2 diC8 is shown as a gray mesh contoured at 5.5σ. (B) Structural comparison between apo (gray) and PIP2 diC8-bound (color) NCX1. Upon PIP2 diC8 binding, there is a rigid-body downward swing movement (marked by an arrow) at CBDs caused by the partial detachment of the CBD2 domain from XIP. The conformational change at the TM domain is subtle and mainly occurs at the C-terminus of TM5 as illustrated in (C) and (D). (C) Zoomed-in view of the structural comparison (boxed area in (B)). The two major conformational changes occur in the boxed regions. (D) Zoomed-in views of the two conformational changes between apo (left in gray) and PIP2 diC8-bound (right in color) state. Top: conformational change 1 at the C-terminus of TM5. Bottom: conformational change 2 at the interface between XIP and CBD2.
Cryo-EM data collection and model statistics.
| Sample preparation conditions | 25 mM HEPES pH 7.4,200 mM NaCl0.9 mM SEA0400 | 25 mM HEPES pH 7.4,200 mM NaCl,0.47 mM PI(4,5)P2diC8 |
|---|---|---|
| SEA0400-bound state (EMD-40456, PDB 8SGI) | PI(4,5)P2diC8-bound state (EMD-60921, PDB 9IV8) | |
| Data collection and processing | ||
| Magnification | 105k | 105k |
| Voltage (kV) | 300 | 300 |
| Electron exposure (e–/Å2) | 60 | 60 |
| Defocus range (μm) | –0.9 to –2.2 | –0.9 to –2.2 |
| Pixel size (Å) | 0.83 | 0.84 |
| Symmetry imposed | C1 | C1 |
| Initial particle images (no.) | 1,249,151 | 2,233,044 |
| Final particle images (no.) | 368,227 | 117,748 |
| Map resolution (Å) FSC threshold | 2.93 0.143 | 3.47 0.143 |
| Refinement | ||
| Initial model used (PDB code) | 8SGJ | 8SGJ |
| Model resolution (Å) FSC threshold | 3.36 0.5 | 3.81 0.5 |
| Model composition Non-hydrogen atoms Protein residues Ligands | 7667 982 3: Na 6: Ca 1: H2O 1: SEA0400 | 5947 750 5: Ca 1: PI(4,5)P2diC8 |
| B factors (Å2) Protein Ligands | 66.21 58.55 | 50.47 106.20 |
| R.m.s. deviations Bond lengths (Å) Bond angles (°) | 0.005 0.696 | 0.004 0.679 |
| Validation MolProbity score Clashscore Poor rotamers (%) | 1.36 5.24 0 | 1.28 5.22 0 |
| Ramachandran plot Favored (%) Allowed (%) Disallowed (%) | 97.62 2.38 0 | 98.24 1.76 0 |
PIP2 diC8-induced conformational changes in NCX1
Two major conformational changes occur in NCX1 upon PIP2 diC8 binding (Figure 2B–D). The first change occurs at the C-terminus of TM5, which ends at R220 and is connected to the two-stranded XIP β-sheet (β3 and β4) via a six-residue loop in the apo structure. When PIP2 binds, the TM5 helix extends by one helical turn. This loop-to-helix transition significantly changes the locations of these connecting loop residues and their side-chain orientations to accommodate PIP2, enabling K225 to reorient and interact with the IP3 head group (Figure 2D, top panel). The second conformational change is the partial detachment of the CBD2 domain from XIP upon PIP2 binding, resulting in a downward swing of cytosolic CBD domains (CBD1 and CBD2) as a rigid body (Figure 2B and C). This CBD2 detachment is a result of the first PIP2-induced conformational change at TM5 that disrupts part of the interactions between CBD2 and XIP as follows: In the apo-inactivated state, Y226 and R247, the two termini residues of the two-stranded XIP β-sheet, form H-bonds with several CBD2 residues, including E554 side chain and backbone carbonyls of I518 and I520 (Figure 2D, bottom panel). The loop-to-helix transition of TM5 upon PIP2 binding leads to a dramatic rotation of Y226 that allows it to move closer to and directly interact with R247, resulting in the loss of H-bonding interactions between XIP and CBD2 (Figure 2D, bottom panel). In addition, the rotation of Y226 also causes a direct collision with CBD2 if it remains closely attached to XIP. Thus, the PIP2-induced TM5 movement, particularly the reorientation of Y226, abolishes some local interactions between CBD2 and XIP and also pushes CBD2 away from XIP, causing the partial detachment of CBD2. However, the short-chain PIP2 only partially destabilizes rather than completely disassembles the inactivation assembly, as the CH2 helix of CBD2 still engages in extensive interactions with the C-shaped β-hub.
To test if the PIP2-interacting residues play a critical role in the native long-chain PIP2 activation, we performed mutagenesis to those positively charged residues, including K164A, R167A, R220A, and K225A single mutants. We also generated an R220A/K225A double mutant as these two residues undergo PIP2-induced conformational change at TM5. While all mutants remain susceptible to current potentiation upon brain PIP2 application, as seen in the wild-type NCX1, the PIP2 potentiation effects on peak and steady-state currents are weakened in some mutants, most notably in R220A and R220A/K225A (Figure 3A–C). Interestingly, these two mutants also have reduced Na+-dependent inactivation as demonstrated by their higher fractional activity (ratio between steady-state and peak currents) before applying PIP2 (Figure 3D). The retained PIP2 activation on these mutants implies that the longer acyl chain from native PIP2 plays an important role in its interaction and activation of NCX1. Furthermore, as the interactions between PIP2 and NCX1 are both electrostatic involving multiple charged residues and hydrophobic involving the long lipid acyl chain, those single or double amino acid substitutions may only decrease the affinity of PIP2 rather than abolish its binding. To test that, we also mutated all four positively charged residues to alanine. The K164A/R167A/R220A/K225A mutant is no longer sensitive to PIP2 activation. The currents from this quadruple mutant are small in most recordings and show no Na+-dependent inactivation. The unresponsiveness to PIP2 and lack of Na+-dependent inactivation in this mutant is consistent with previous studies, demonstrating that PIP2 activates NCX by tuning the amount of Na+-dependent inactivation, and any mutation that decreases NCX sensitivity to PIP2 will also affect the extent of Na+-dependent inactivation (He et al., 2000). This quadruple NCX1 mutant likely abolishes the potentiation effect from both endogenous and externally applied PIP2 and thereby functions in a Na+-inactivated steady state.
Mutagenesis at the phosphatidylinositol 4,5-bisphosphate (PIP2) binding.
(A) Representative NCX1 currents of PIP2 site mutants before and after perfusion of 10 µM brain PIP2 to the cytosolic side of the patch. (B, C) Summary graphs demonstrating the effects of PIP2 on the enhancement of peak (B) and steady-state currents (C). Potentiation (fold of increase) was measured by comparing the current magnitude before and after PIP2 application. Mutants R167A, R220A, and K225A showed some decreased response to PIP2, whereas the R220A/K225A mutant shows a more profound decrease in PIP2 response. Compared to WT, the PIP2 potentiation of R220A/K225A at the steady state is decreased by ~70–90% (fold of increase WT = 8.9 ± 1.6, n=10 vs R220A/K225A=1.9 ± 0.1, n=6). PIP2 has no potentiation effect on the quadruple K164A/R167A/R220A/K225A mutant. Data points are mean ± s.e.m. (*p<0.1). (D) The extent of Na+-dependent inactivation was measured as the ratio between steady-state and peak currents (fractional activity), and values for WT and the indicated mutants are shown. Mutants R220A and R220A/K225A displayed significantly higher fractional activity values when compared to WT, indicating that the Na+-dependent inactivation was less pronounced in these mutant exchangers. K164A/R167A/R220A/K225A shows no Na+-dependent inactivation.
-
Figure 3—source data 1
Fold of increase in peak and steady-state current, and fractional activity values for WT and indicated mutants.
- https://cdn.elifesciences.org/articles/105396/elife-105396-fig3-data1-v1.xlsx
Structure of NCX1 in complex with SEA0400 inhibitor
SEA0400 is known to potently inhibit cardiac NCX1 by facilitating the inactivation of the exchanger (Lee et al., 2004; Bouchard et al., 2004; Iwamoto et al., 2004). To reveal the structural mechanism of its inhibition, we determined the structure of HsNCX1 in complex with SEA0400 at 2.9 Å (Figure 4, Figure 4—figure supplement 1, Table 1, and Methods). The SEA0400-bound NCX1 structure adopts an inward-facing, inactivated state identical to the apo NCX1 structure obtained at high Na+, nominal Ca2+-free condition (Xue et al., 2023: Figure 4A, Figure 4—figure supplement 2). SEA0400 binds at the TM domain in a pocket enclosed by the internal halves of TMs 8 (8a segment), 2 (2ab segments), 4, and 5 (Figure 4B). The pocket has a lateral fenestration in the middle of the membrane (Figure 4B), which provides a portal for the SEA0400 entrance. The pocket is sealed off at the cytosolic side by E244 from the XIP β-sheet. As demonstrated in our previous study (Xue et al., 2023), XIP and the linker β-hairpin (β1 and β2) between TMs 1 and 2ab form a β-hub that stabilizes the exchanger in an inactivated state. This β-hub has to be disassembled in an activated NCX1, and XIP is expected to be detached from the TM domain, which would lead to the opening of the SEA400-binding pocket to the cytosol and provide a cytosolic portal for the release of the inhibitor, as further discussed below. Figure 4C summarizes the interactions between SEA0400 and NCX1 and demonstrates that SEA0400 fits perfectly in the pocket, making extensive contact with surrounding residues. Mutations of some key interacting residues, such as F213 and G833, have been shown to compromise the inhibitor binding (Iwamoto et al., 2004). The same SEA0400 binding was also demonstrated in the recent study of human NCX1.3, and mutations at some pocket-forming residues mitigate the SEA0400 inhibition of the exchanger (Dong et al., 2024).
SEA0400 binding in NCX1.
(A) Overall structure of human NCX1 in complex with SEA0400 obtained in high Na+ and low Ca2+ conditions. Yellow spheres represent the bound Ca2+ in CBD1 and XIP. (B) Cartoon representation of the transmembrane (TM) domain and β-hub of the complex with surface-rendered view of the fenestration in the middle of the membrane. The β-hub is assembled by β-hairpin (β1 and β2) and XIP (β3 and β4). (C) Zoomed-in view of the SEA0400-binding site, and the schematic diagram detailing the interactions between NCX1 residues and SEA0400.
Inhibition mechanism of SEA0400
The TM domain of NCX1 shares a similar overall architecture to the archaea exchanger NCX_Mj (Liao et al., 2012). The structural comparison between the TM domains of the inward-facing NCX1 and the outward-facing NCX_Mj reveals the conformational changes that occur during ion exchange, providing structural insight into the SEA0400 inhibition mechanism (Figure 5A). The inward-outward transition mainly involves the sliding motion of TMs 1 and 6 and the bending movement of TMs 2ab and 7ab (Xue et al., 2023; Liao et al., 2012; Liao et al., 2016; Marinelli and Faraldo-Gomez, 2023). As TM2ab directly interacts with SEA0400 in the inward-facing state, its bending movement toward the outward conformation would cause a direct collision with the inhibitor (Figure 5A). Thus, the binding of SEA0400 stabilizes the exchanger in the inward-facing state and blocks the conformational change from the inward to the outward state. The Na+-dependent NCX1 inactivation occurs when the exchanger is in a Na+-loaded, inward-facing state with low cytosolic [Ca2+] (Hilgemann et al., 1992c; Matsuoka and Hilgemann, 1994; Hilgemann, 2020). As demonstrated in our previous study, only in this state can the β-hub form and readily interact with the cytosolic CBD domains, generating the inactivation assembly that locks TMs 1 and 6 and prevents the TM module from transporting ions (Xue et al., 2023). Thus, SEA0400 promotes NCX1 inactivation by stabilizing NCX1 in the inward-facing conformation, which facilitates the formation of the inactivation assembly. The formation of the inactivation assembly also reciprocally stabilizes SEA0400 binding as the XIP of the assembly interacts with the TM domain and seals off the inhibitor binding pocket from the cytosolic side (Figure 5B). Under conditions in which the inactivation assembly cannot form in NCX1, such as chymotrypsin treatment or forward exchange mode (Na+ influx/Ca2+ efflux), the removal or detachment of XIP from the TM domain would generate a cytosolic open portal for SEA0400 release and effectively reduce its binding affinity (Figure 5C; Lee et al., 2004; Bouchard et al., 2004). Indeed, cysteine scanning mutagenesis studies have shown that the pocket-forming G833 residue is accessible to intracellular sulfhydryl reagents in the chymotrypsin-treated inward-facing NCX1, confirming the cytosolic exposure of the SEA400-binding pocket upon XIP removal (John et al., 2013). This cytosolic opening of the SEA0400 pocket explains the low efficacy of SEA0400 inhibition in NCX1 when the Na+-dependent inactivation is absent.
Structural mechanism of SEA0400 inhibition.
(A) Structural comparison at the core part of the transmembrane (TM) domain between the SEA0400-bound, inward-facing HsNCX1 and the outward-facing NCX_Mj (PDB 3V5U). Red arrows mark the sliding movement of TMs 1 and 6 and the bending of TM2ab from inward to outward conformation. (B) Surface-rendered views of the SEA0400-binding pocket sealed off from the cytosolic side by E244 from XIP in the inactivated state. (C) Removal of XIP would generate a cytosolic portal that facilitates the release of SEA0400.
Discussion
In this study, we provide mechanistic underpinnings of cellular regulation and pharmacology of NCX family proteins by revealing the structural basis of PIP2 activation and SEA0400 inhibition in HsNCX1. Both compounds modulate NCX1 activity by reducing or enhancing the physiologically relevant Na+-dependent inactivation process that occurs when the exchanger is in an inward-facing, Na+-loaded state with high [Na+] and low [Ca2+] on the cytosolic side (Scranton et al., 2024; Hilgemann et al., 1992c). In this inactivation state, XIP and β-hairpin can assemble into a TM-associated four-stranded β-hub that mediates a tight packing between the TM and cytosolic domains, resulting in the formation of an inactivation assembly that blocks the TM conformational changes required for ion exchange function (Xue et al., 2023; Dong et al., 2024). PIP2 or SEA0400 binding changes the stability of the inactivation assembly in NCX1, resulting in a reduction or potentiation of inactivation.
Although short-chain PIP2 cannot fully recapitulate the NCX1 activation effect from long-chain native PIP2, the structure of PIP2 diC8 NCX1 allows us to define the lipid-binding site and the lipid-induced conformational changes at the interface between CBD2 and XIP that destabilize the inactivation assembly. The SEA0400-bound NCX1 structure presented here, along with the recent study by Dong et al., 2024, suggests that the drug can directly inhibit NCX1 by blocking the inward-outward conformational change at TM2ab. Our structural analysis also explains the strong connection between SEA0400 binding and Na+-dependent inactivation - SEA0400 is ineffective in an exchanger lacking Na+-dependent inactivation, whereas enhancing the extent of Na+-dependent inactivation increases the affinity for SEA0400. As SEA0400 binding traps NCX1 in an inward-facing state that facilitates the formation of the inactivation assembly, the interaction between XIP and the TM domain in the assembly can in turn stabilize SEA0400 binding by sealing the drug-binding pocket from the cytosol. When XIP is removed, as in the chymotrypsin-treated NCX1, or when the inactivation assembly cannot form, as in the NCX1 at forward exchange mode, the SEA0400-binding pocket becomes exposed to the cytosol, mitigating the inhibition efficacy of SEA0400 (Lee et al., 2004; Bouchard et al., 2004).
While we expect the long-chain PIP2 to bind in the same location as PIP2 diC8, it is unclear how it exacerbates the destabilization effect on the inactivation assembly. The long acyl chain of native PIP2 may engage in some interactions with the TM module of NCX1 that are not present in the short-chain lipid, rendering a higher affinity binding and more profound destabilization effect on the inactivation assembly than PIP2 diC8. The acyl-chain length-dependent PIP2 activation is consistent with some previous studies. Before PIP2 was demonstrated to regulate NCX, some earlier studies showed that negatively charged long-chain lipids such as phosphatidylserine or phosphatidic acid could have the same potentiation effects on NCX1 as PIP2 (Hilgemann and Collins, 1992b; Vemuri and Philipson, 1988). Furthermore, long-chain acyl-CoAs could also have the same potentiation effects on NCX as PIP2 (Riedel et al., 2006). All these studies demonstrated that activation of NCX by the anionic lipids depends on their chain length, with the short chain being ineffective or less effective. These findings have two implications. First, it is the negative surface charge rather than the specific IP3 head group of the lipid that is important for stimulating NCX1 activity, suggesting nonspecific electrostatic interactions between the negatively charged lipids and those positively charged residues at the binding site. Second, a longer acyl chain is required for the high-affinity binding of PIP2 or negatively charged lipids. In the PIP2 diC8-bound structure, the tail of the acyl chain is positioned right at the fenestration of NCX1 that serves as the portal for the SEA0400 binding. Two pieces of evidence lead us to suggest that the tail of the long acyl chain from a native lipid can enter the same binding pocket for SEA0400 and thereby render its higher affinity binding than a shorter chain lipid. First, a docking analysis (Eberhardt et al., 2021; Bugnon et al., 2024) of both long-chain and short-chain PIP2 at the binding site showed that the tail portion of the acyl chain from the native brain PIP2 inserts into the SEA0400-binding pocket through the fenestration of NCX1 in all docking models with the highest calculated affinity (Figure 2—figure supplement 4A). This pocket is not reachable for PIP2 diC8 due to its shorter chain length (Figure 2—figure supplement 4B). Second, a stretch of density likely from a native lipid acyl chain is observed in the apo NCX1 structure inside the SEA0400-binding pocket (Figure 2—figure supplement 4C), indicating its accessibility to a long-chain lipid. Thus, the accommodation of the long acyl chain in the open pocket of NCX1 through the fenestration in the middle of the membrane likely contributes to the high-affinity binding of native lipids.
Methods
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Gene (Homo sapiens) | NCX1 (sodium/calcium exchanger 1) | Uniprot | P32418 | |
| Strain, strain background (Escherichia coli) | TOP10 | Thermo Fisher Scientific | Cat# 18258012 | |
| Strain, strain background (E. coli) | DH10Bac | Thermo Fisher Scientific | Cat# 10361012 | |
| Cell line (Spodoptera frugiperda) | Sf9 cells | Thermo Fisher Scientific | Cat# 11496015; RRID:CVCL_0549 | |
| Cell line (H. sapiens) | Expi293 GnTI- Cells | Thermo Fisher Scientific | Cat# A39240; RRID:CVCL_B0J7 | |
| Transfected construct (H. sapiens) | pEZT-BM-NCX1-Cstrep | This paper | N/A | |
| Recombinant DNA reagent | pEZT-BM | Morales-Perez et al., 2016 | RRID:Addgene_74099 | |
| Sequence-based reagent | NCX1_F_primer | This paper | PCR primers | gtacttaatacgactcactataggctagcgccaccatgtacaacatgcggcgattaagtc |
| Sequence-based reagent | NCX1_R_primer | This paper | PCR primers | gatggctccatgagccaccAgcggccgcgaagccttttatgtggcagtaggc |
| Chemical compound, drug | Sodium Butyrate | Sigma-Aldrich | Cat# 303410 | |
| Chemical compound, drug | Lauryl Maltose Neopentyl Glycol | Anatrace | Cat# NG310 | |
| Chemical compound, drug | Digitonin | Acros Organics | Cat# 11024-24-1 | |
| Chemical compound, drug | Biotin | Sigma-Aldrich | Cat# B4501 | |
| Software, algorithm | MotionCor2 | Zheng et al., 2017 | RRID:SCR_016499 | |
| Software, algorithm | GCTF | Zhang, 2016 | RRID:SCR_016500 | |
| Software, algorithm | RELION | Scheres, 2012 | RRID:SCR_016274 | http://www2.mrc-lmb.cam.ac.uk/relion |
| Software, algorithm | cryoSPARC | Punjani et al., 2017 | RRID:SCR_016501 | https://cryosparc.com/ |
| Software, algorithm | Chimera | Pettersen et al., 2004 | RRID:SCR_004097 | https://www.cgl.ucsf.edu/chimera |
| Software, algorithm | PyMol | Schrödinger | RRID:SCR_000305 | https://pymol.org/2 |
| Software, algorithm | Coot | Emsley et al., 2010 | RRID:SCR_014222 | https://www2.mrc-lmb.cam.ac.uk/personal/pemsley/coot/ |
| Software, algorithm | MolProbity | Chen et al., 2010 | RRID:SCR_014226 | http://molprobity.biochem.duke.edu/ |
| Software, algorithm | PHENIX | Adams et al., 2010 | RRID:SCR_014224 | https://www.phenix-online.org |
| Other | Superdex 200 Increase 10/300 GL | Cytiva | Cat# 28990944 | |
| Other | Strep-Tactin resin | IBA | Cat# 2-5010 | |
| Other | Amicon Ultra-15 Centrifugal Filter Units | MilliporeSigma | Cat# UFC9100 | |
| Other | Quantifoil R 1.2/1.3 grid Au300 | Quantifoil | Cat# Q37572 | |
| Other | Cellfectin | Thermo Fisher Scientific | Cat# 10362100 | |
| Other | Sf-900 II SFM medium | Thermo Fisher Scientific | Cat# 10902088 | |
| Other | FreeStyle 293 Expression Medium | Thermo Fisher Scientific | Cat# 12338018 | |
| Other | Antibiotic Antimycotic Solution | Sigma-Aldrich | Cat# A5955 |
Protein expression and purification
The expression and purification of the HsNCX1 (cardiac isoform NCX1.1, indicated as HsNCX1 or NCX1 throughout the manuscript) were carried out as described previously (Xue et al., 2023). Truncated HsNCX1 (Δ341–365aa) containing a C-terminal Strep-tag was cloned into a pEZT-BM vector, and baculoviruses were produced in Sf9 cells (Morales-Perez et al., 2016). For protein expression, cultured Expi293F GnTI- cells were infected with the baculoviruses at a ratio of 1:20 (virus: GnTI-, vol/vol) for 10 hr. 10 mM sodium butyrate was then introduced to boost protein expression level, and cells were cultured in suspension at 30°C for another 60 hr and harvested by centrifugation at 4000×g for 15 min. All purification procedures were carried out at 4°C. The cell pellet was resuspended in lysis buffer (25 mM HEPES pH 7.4, 300 mM NaCl, 2 μg/ml DNase I, 0.5 μg/ml pepstatin, 2 μg/ml leupeptin, 1 μg/ml aprotinin, and 0.1 mM PMSF) and homogenized by sonication. NCX1 was extracted with 2% (wt/vol) N-dodecyl-β-D-maltopyranoside (DDM, Anatrace) supplemented with 0.2% (wt/vol) cholesteryl hemisuccinate (CHS, Sigma-Aldrich) by gentle agitation for 2 hr, and supernatant collected by centrifugation at 40,000×g for 30 min was incubated with Strep-Tactin affinity resin (IBA) for 1 hr. The resin was then collected on a disposable gravity column (Bio-Rad) and washed with 30 column volumes of buffer A (25 mM HEPES pH 7.4, 200 mM NaCl, 0.06% digitonin). NCX1 was eluted in buffer A supplemented with 50 mM biotin and further purified by size-exclusion chromatography on a Superdex 200 10/300 GL column (GE Healthcare). For the generation of NCX1-Fab 2E4 complex, NCX1 was incubated with purified Fab in a molar ratio of 1:1.2 (NCX1: Fab 2E4) for 2 hr and further purified by size-exclusion chromatography in buffer A. The peak fractions were collected and concentrated to ~5–6 mg/ml for cryo-EM analysis. To prepare the protein samples in complex with various compounds, 0.9 mM SEA0400, 0.47 mM PI(4,5)P2 diC8, or 0.42 mM brain PI(4,5)P2 were added to the protein samples 2 hr before grid preparation.
Expi293F GnTI- cells were purchased from and authenticated by Thermo Fisher Scientific. The cell lines were tested negative for mycoplasma contamination.
Cryo-EM sample preparation and data acquisition
HsNCX1-Fab 2E4 samples (~5–6 mg/ml) in various conditions were applied to a glow-discharged Quantifoil R1.2/1.3 300-mesh gold holey carbon grid (Quantifoil, Micro Tools GmbH, Germany), blotted for 4.0 s under 100% humidity at 4°C and plunged into liquid ethane using a Mark IV Vitrobot (FEI). For the SEA0400-bound NCX1-Fab 2E4, raw movies were acquired on a Titan Krios microscope (FEI) operated at 300 kV with a K3 camera (Gatan) at 0.83 Å per pixel and a nominal defocus range of –0.9 to –2.2 μm. Each movie was recorded for about 5 s in 60 subframes with a total dose of 60 e-/Å2. For other samples, raw movies were acquired on a Titan Krios microscope operated at 300 kV with a Falcon 4i (Thermo Fisher Scientific) at 0.738 Å per pixel and a nominal defocus range of –0.8 to –1.8 μm. Each movie was recorded for 4 s with a total dose of 60 e-/Å2.
Image processing
Cryo-EM data were processed following the general scheme described below with some modifications to different datasets (Figure 2—figure supplements 1 and 2, Figure 4—figure supplement 1). First, movie frames were motion-corrected and dose-weighted using MotionCor2 (Zheng et al., 2017). The CTF parameters of the micrographs were estimated using the GCTF program (Zhang, 2016). After CTF estimation, micrographs were manually inspected to remove images with bad defocus values and ice contamination. Particles were picked using program Gautomatch (Kai Zhang, https://sbgrid.org/software/titles/gctf) or crYOLO (Wagner et al., 2019) and extracted with a binning factor of 3 in RELION (Zivanov et al., 2018; Scheres, 2012). Extracted particles were subjected to 2D classification, ab initio modeling, and 3D classification. The particles from the best-resolving 3D class were then re-extracted with the original pixel size and subjected to heterogeneous 3D refinement, nonuniform refinement, CTF refinement, and local refinement in cryoSPARC (Punjani et al., 2017). The quality of the EM density maps for the TM and cytosolic domains was further improved through focused refinement, allowing for accurate model building for a major part of the protein. For the dataset of NCX1 in complex with brain PI(4,5)P2, the maps of apo inactive NCX1 (PDB 8SGJ) and Ca²+-bound active NCX1 (PDB 8SGT) are used as references for heterogeneous refinement. Due to the highly dynamic nature of the protein samples, the particles sorted into the active state produce a map with very low resolution. All resolution was reported according to the gold-standard Fourier shell correlation (FSC) using the 0.143 criterion (Henderson et al., 2012). Local resolution was estimated using cryoSPARC.
Model building, refinement, and validation
The EM maps of HsNCX1 in the SEA0400-bound and PI(4,5)P2 diC8-bound states show high-quality density, and model building is facilitated by previous apo NCX1 structure (PDB 8SGJ) (Xue et al., 2023). Models were manually adjusted in Coot (Emsley et al., 2010) and refined against maps using the phenix.real_space_refine with secondary structure restraints applied (Adams et al., 2010). The final NCX1 structural model contains residues 17–248, 370–467, 482–644, 652–698, 707–718, and 738–935. The EM map of HsNCX1 in complex with brain PI(4,5)P2 is relatively poor. The Ca2+-bound activated NCX1 structure (PDB 8SGT) is directly docked into the EM map without adjustment.
The statistics of the geometries of the models were generated using MolProbity (Chen et al., 2010). All the figures were prepared in PyMol (Schrödinger, LLC), Chimera (Pettersen et al., 2004), and ChimeraX (Goddard et al., 2018).
Electrophysiological experiments
The wild-type HsNCX1 and its mutants were cloned into a pGEMHE vector and expressed in oocytes for electrophysiological recordings. RNA was synthesized using mMessage mMachine (Ambion) and injected into X. laevis oocytes as described in John et al., 2018. Oocytes were isolated from at least three different frogs and kept at 18°C for 4–7 days. Outward HsNCX1 currents were recorded using the giant patch technique in the inside-out configuration. Each data point shown in this study represents a recording obtained from a single oocyte. The external solution (pipette solution) contained the following (mM): 100 CsOH (cesium hydroxide), 10 HEPES (4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid), 20 TEAOH (tetraethyl-ammonium hydroxide), 0.2 niflumic acid, 0.2 ouabain, 8 Ca(OH)2 (calcium hydroxide), pH = 7 (using MES, (2-(N-morpholino) ethanesulfonic acid)); bath solution (mM): 100 CsOH or 100 NaOH (sodium hydroxide), 20 TEAOH, 10 HEPES, 10 EGTA (ethylene glycol-bis(β-aminoethyl ether)-N,N,N’,N’-tetra acetic acid) or HEDTA (N-(2-Hydroxyethyl) ethylenediamine-N,N’,N’-triacetic acid) and different Ca(OH)2 concentrations to obtain the desired final free Ca2+ concentrations, pH = 7 (using MES). Free Ca2+ concentrations were calculated according to the WEBMAXc program and confirmed with a Ca2+ electrode.
HsNCX1 currents were evoked by the rapid replacement of 100 mM Cs+ with 100 mM Na+, using a computer-controlled 20-channel solution switcher. As HsNCX1 does not transport Cs+, there is no current, and only upon application of Na+ does the exchange cycle initiate. Data were acquired at 4 ms/point and filtered at 50 Hz using an 8-pole Bessel filter. Experiments were performed at 35°C and at a holding potential of 0 mV. The effects of the Na+-dependent inactivation were analyzed by measuring fractional currents calculated as the ratio of the steady-state current to the peak current (fractional activity). All p-values were calculated using an unpaired, two-sided Welch’s t-test.
PI(4,5)P2 diC8 (phosphatidylinositol 4,5-bisphosphate diC8, Echelon Bioscience) and brain PI(4,5)P2 (L-α-phosphatidylinositol-4,5-bisphosphate, Brain, Porcine, Avanti Polar Lipids) were dissolved in water and kept as stock at –20°C. Immediately prior to recordings, PI(4,5)P2 was diluted in the bath solution to 10 µM final concentration and perfused cytosolically for the indicated time.
Data availability
The cryo-EM density maps of the human NCX1 have been deposited in the Electron Microscopy Data Bank under accession numbers EMD-40456 for the SEA0400-bound state and EMD-60921 for the PI(4,5)P2 diC8-bound state, respectively. Atomic coordinates have been deposited in the Protein Data Bank under accession numbers 8SGI for SEA0400-bound structure and 9IV8 for the PI(4,5)P2 diC8-bound structure. All materials, including plasmids generated in this study, are available from the authors upon request.
-
RCSB Protein Data BankID 8SGI. Cryo-EM structure of human NCX1 in complex with SEA0400.
-
RCSB Protein Data BankID 9IV8. Cryo-EM structure of human NCX1 in PIP2 diC8 bound state.
-
Electron Microscopy Data BankID EMD-40456. Cryo-EM structure of human NCX1 in complex with SEA0400.
-
Electron Microscopy Data BankID EMD-60921. Cryo-EM structure of human NCX1 in PIP2 diC8 bound state.
References
-
PHENIX: a comprehensive python-based system for macromolecular structure solutionActa Crystallographica. Section D, Biological Crystallography 66:213–221.https://doi.org/10.1107/S0907444909052925
-
Calcium signalling: dynamics, homeostasis and remodellingNature Reviews. Molecular Cell Biology 4:517–529.https://doi.org/10.1038/nrm1155
-
Sodium-calcium exchange and calcium-calcium exchange in internally dialyzed squid giant axonsThe Journal of Membrane Biology 22:285–312.https://doi.org/10.1007/BF01868176
-
Sodium/calcium exchange: its physiological implicationsPhysiological Reviews 79:763–854.https://doi.org/10.1152/physrev.1999.79.3.763
-
Effects of SEA0400 on mutant NCX1.1 Na+-Ca2+ exchangers with altered ionic regulationMolecular Pharmacology 65:802–810.https://doi.org/10.1124/mol.65.3.802
-
SwissDock 2024: major enhancements for small-molecule docking with attracting cavities and autodock vinaNucleic Acids Research 52:W324–W332.https://doi.org/10.1093/nar/gkae300
-
MolProbity: all-atom structure validation for macromolecular crystallographyActa Crystallographica. Section D, Biological Crystallography 66:12–21.https://doi.org/10.1107/S0907444909042073
-
Ionic regulatory properties of brain and kidney splice variants of the NCX1 Na(+)-Ca(2+) exchangerThe Journal of General Physiology 114:701–711.https://doi.org/10.1085/jgp.114.5.701
-
AutoDock Vina 1.2.0: new docking methods, expanded force field, and python bindingsJournal of Chemical Information and Modeling 61:3891–3898.https://doi.org/10.1021/acs.jcim.1c00203
-
Features and development of cootActa Crystallographica. Section D, Biological Crystallography 66:486–501.https://doi.org/10.1107/S0907444910007493
-
Interaction of PIP(2) with the XIP region of the cardiac Na/Ca exchangerAmerican Journal of Physiology. Cell Physiology 278:C661–C666.https://doi.org/10.1152/ajpcell.2000.278.4.C661
-
Steady-state and dynamic properties of cardiac sodium-calcium exchange: secondary modulation by cytoplasmic calcium and ATPThe Journal of General Physiology 100:933–961.https://doi.org/10.1085/jgp.100.6.933
-
Steady-state and dynamic properties of cardiac sodium-calcium exchange: sodium-dependent inactivationThe Journal of General Physiology 100:905–932.https://doi.org/10.1085/jgp.100.6.905
-
Regulation of ion transport from within ion transit pathwaysThe Journal of General Physiology 152:e201912455.https://doi.org/10.1085/jgp.201912455
-
Molecular determinants of Na+/Ca2+ exchange (NCX1) inhibition by SEA0400The Journal of Biological Chemistry 279:7544–7553.https://doi.org/10.1074/jbc.M310491200
-
Molecular determinants of pH regulation in the cardiac Na+–Ca2+ exchangerJournal of General Physiology 150:245–257.https://doi.org/10.1085/jgp.201611693
-
Identification of sodium-calcium exchange current in single ventricular cells of guinea-pigThe Journal of Physiology 384:199–222.https://doi.org/10.1113/jphysiol.1987.sp016450
-
Mutually exclusive and cassette exons underlie alternatively spliced isoforms of the Na/Ca exchangerThe Journal of Biological Chemistry 269:5145–5149.
-
Tissue-specific expression of Na(+)-Ca2+ exchanger isoformsThe Journal of Biological Chemistry 269:14849–14852.
-
Identification of a peptide inhibitor of the cardiac sarcolemmal Na(+)-Ca2+ exchangerThe Journal of Biological Chemistry 266:1014–1020.
-
Mechanism of extracellular ion exchange and binding-site occlusion in a sodium/calcium exchangerNature Structural & Molecular Biology 23:590–599.https://doi.org/10.1038/nsmb.3230
-
Functional comparison of the three isoforms of the Na+/Ca2+ exchanger (NCX1, NCX2, NCX3)The American Journal of Physiology 274:C415–C423.https://doi.org/10.1152/ajpcell.1998.274.2.C415
-
Na+/Ca2+ exchangers: three mammalian gene families control Ca2+ transportThe Biochemical Journal 406:365–382.https://doi.org/10.1042/BJ20070619
-
Na(+)-Ca2+ exchanger: physiology and pharmacologyJapanese Journal of Pharmacology 74:1–20.https://doi.org/10.1254/jjp.74.1
-
SEA0400, a novel and selective inhibitor of the Na+-Ca2+ exchanger, attenuates reperfusion injury in the in vitro and in vivo cerebral ischemic modelsThe Journal of Pharmacology and Experimental Therapeutics 298:249–256.
-
Steady-state and dynamic properties of cardiac sodium-calcium exchange: Ion and voltage dependencies of the transport cycleThe Journal of General Physiology 100:963–1001.https://doi.org/10.1085/jgp.100.6.963
-
Inactivation of outward Na(+)-Ca2+ exchange current in guinea-pig ventricular myocytesThe Journal of Physiology 476:443–458.https://doi.org/10.1113/jphysiol.1994.sp020146
-
Regulation of the cardiac Na(+)-Ca2+ exchanger by Ca2+. Mutational analysis of the Ca(2+)-binding domainThe Journal of General Physiology 105:403–420.https://doi.org/10.1085/jgp.105.3.403
-
Regulation of cardiac Na(+)-Ca2+ exchanger by the endogenous XIP regionThe Journal of General Physiology 109:273–286.https://doi.org/10.1085/jgp.109.2.273
-
Roles of two Ca2+-binding domains in regulation of the cardiac Na+-Ca2+ exchangerThe Journal of Biological Chemistry 284:32735–32741.https://doi.org/10.1074/jbc.M109.055434
-
Na/Ca exchange and contraction of the heartJournal of Molecular and Cellular Cardiology 61:28–33.https://doi.org/10.1016/j.yjmcc.2013.06.001
-
The Cardiac Na(+) -Ca(2+) exchanger: from structure to functionComprehensive Physiology 12:2681–2717.https://doi.org/10.1002/cphy.c200031
-
UCSF Chimera--a visualization system for exploratory research and analysisJournal of Computational Chemistry 25:1605–1612.https://doi.org/10.1002/jcc.20084
-
Sodium-calcium exchange: a molecular perspectiveAnnual Review of Physiology 62:111–133.https://doi.org/10.1146/annurev.physiol.62.1.111
-
The sodium/calcium exchanger family?SLC8Pflugers Archiv European Journal of Physiology 447:543–548.https://doi.org/10.1007/s00424-003-1065-4
-
Na/Ca exchange in barnacle muscle cells has a stoichiometry of 3 Na+/1 Ca2+The American Journal of Physiology 252:C499–C504.https://doi.org/10.1152/ajpcell.1987.252.5.C499
-
The stoichiometry of the cardiac sodium-calcium exchange systemThe Journal of Biological Chemistry 259:7733–7739.
-
The topology of the cardiac Na+2Journal of Molecular and Cellular Cardiology 57:68–71.https://doi.org/10.1016/j.yjmcc.2013.01.010
-
Metabolic regulation of sodium-calcium exchange by intracellular acyl CoAsThe EMBO Journal 25:4605–4614.https://doi.org/10.1038/sj.emboj.7601321
-
RELION: implementation of a Bayesian approach to cryo-EM structure determinationJournal of Structural Biology 180:519–530.https://doi.org/10.1016/j.jsb.2012.09.006
-
Cardiac Na(+)-Ca(2+) exchange: molecular and pharmacological aspectsCirculation Research 88:864–876.https://doi.org/10.1161/hh0901.090298
-
Effect of SEA0400, a novel inhibitor of sodium-calcium exchanger, on myocardial ionic currentsBritish Journal of Pharmacology 135:1096–1100.https://doi.org/10.1038/sj.bjp.0704574
-
Phospholipid composition modulates the Na+-Ca2+ exchange activity of cardiac sarcolemma in reconstituted vesiclesBiochimica et Biophysica Acta 937:258–268.https://doi.org/10.1016/0005-2736(88)90248-9
-
Topics on the Na+/Ca2+ exchanger: pharmacological characterization of Na+/Ca2+ exchanger inhibitorsJournal of Pharmacological Sciences 102:7–16.https://doi.org/10.1254/jphs.fmj06002x2
-
A novel antagonist, No. 7943, of the Na+/Ca2+ exchange current in guinea-pig cardiac ventricular cellsBritish Journal of Pharmacology 119:555–563.https://doi.org/10.1111/j.1476-5381.1996.tb15708.x
-
Structural mechanisms of the human cardiac sodium-calcium exchanger NCX1Nature Communications 14:6181.https://doi.org/10.1038/s41467-023-41885-4
-
Gctf: Real-time CTF determination and correctionJournal of Structural Biology 193:1–12.https://doi.org/10.1016/j.jsb.2015.11.003
Article and author information
Author details
Funding
Howard Hughes Medical Institute
- Youxing Jiang
National Institute of General Medical Sciences (R35GM140892)
- Youxing Jiang
National Institutes of Health (R01HL152296)
- Michela Ottolia
Welch Foundation (I-1578)
- Youxing Jiang
The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.
Acknowledgements
Single particle cryo-EM data were collected at the University of Texas Southwestern Medical Center Cryo-EM Facility, which is funded by the CPRIT Core Facility Support Award RP170644. Cryo-EM sample grids were prepared at the Structural Biology Laboratory at UT Southwestern Medical Center, which is partially supported by grant RP170644 from CPRIT. This work was supported in part by the Howard Hughes Medical Institute (to YJ) and by grants from the National Institute of Health (R35GM140892 to YJ and R01HL152296 to MO) and the Welch Foundation (Grant I-1578 to YJ).
Version history
- Sent for peer review:
- Preprint posted:
- Reviewed Preprint version 1:
- Reviewed Preprint version 2:
- Version of Record published:
Cite all versions
You can cite all versions using the DOI https://doi.org/10.7554/eLife.105396. This DOI represents all versions, and will always resolve to the latest one.
Copyright
© 2025, Xue et al.
This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.
Metrics
-
- 979
- views
-
- 64
- downloads
-
- 3
- citations
Views, downloads and citations are aggregated across all versions of this paper published by eLife.
Citations by DOI
-
- 1
- citation for umbrella DOI https://doi.org/10.7554/eLife.105396
-
- 2
- citations for Version of Record https://doi.org/10.7554/eLife.105396.3