Cross-species evaluation of TANGO2 homologs, including HRG-9 and HRG-10 in Caenorhabditis elegans, challenges a proposed role in heme trafficking
- Department of Pathology, University of Rochester Medical Center, United States
- Department of Neurology, University of Rochester Medical Center, United States
- Emory University, United States
- Morgan State University, United States
- Department of Biology, Concordia University, Canada
- Department of Medicine, Brigham and Women's Hospital Harvard Medical School, United States
- Department of Pharmacology, Vanderbilt University, United States
- Department of Anesthesiology and Perioperative Medicine, University of Rochester Medical Center, United States
- Department of Anatomy and Cell Biology, McGill University, Canada
Figures
Figure 1
Reduced ingestion of toxic and fluorescent heme analogs may explain differences observed between wildtype C. elegans and worms lacking HRG-9 and HRG-10 (double knockout [DKO]).
(A) Survival of N2, DKO, or eat-2 knockout worms exposed to 1, 2, 5, or 10 µM GaPP for 72 hours. Each dot represents the number of offspring laid by one adult worm on one GaPP-treated plate after 24 hours. N=3 independent experiments. *p<0.05, ****p<0.0001. (B) Quantification of fluorescent staining in N2, DKO, and eat-2 worms grown on OP50 E. coli plates under fed and starved conditions with or without 40 µM ZnMP treatment. A.U. arbitrary units, N=15 worms analyzed over three independent experiments. *p<0.05. (C) Representative images of red fluorescence in N2, DKO, and eat-2 worms grown on OP50 E. coli plates. Scale bars represent 50 µM. (D) Quantification of fluorescent staining in N2 and DKO cultured in normal heme axenic media with or without 40 µM ZnMP treatment. A.U. arbitrary units, N=7–15 worms analyzed over three independent experiments. *p<0.05. (E) Representative images of red fluorescence in N2 and DKO worms grown in liquid media. Scale bars represent 50 µM.
Figure 2
DKO nematodes demonstrate lawn avoidance and reduced pharyngeal pumping, brood sizes, motility, and survival.
(A) Proportion of N2 or DKO worms present on OP50 lawn (innermost ring), off OP50 lawn (middle ring), or missing or dead from NGM plate (outer ring). N=180 worms over three independent experiments. (B) Number of pharyngeal pumps in a 1-minute period in N2, DKO, and eat-2 knockout worms. N=15 worms over three independent experiments. (C) Number of viable offspring laid by single adult N2 or DKO worms either after 24 hours of egg lay or across total egg-laying period (5 days). N=8 broods for 24 hour counts, N=5 broods for total brood size counts. (D) Swimming behavior of N2 and DKO worms over a 20-minute interval. Worms were observed at 4-minute intervals and scored from 0 to 5 on swimming intensity. Bars represent the proportion of worms at each score. (E) Quantification of thrashes after 4 minutes in M9 buffer. (F) Longevity of N2 and DKO C. elegans observed from L4 larval stage. N=30 worms over three independent experiments (**p<0.01, ***p<0.001, ****p<0.0001).
Figure 3
RNA-seq and qPCR analysis show that hrg-9 and hrg-10 are not uniquely heme responsive but instead may be preferentially induced under conditions of oxidative stress.
(A) Analysis of top 500 genes with differential expression under low heme (2 µM) and high heme (400 µM) conditions. The outline represents 134 relevant genes identified by cluster analysis. R186.1 is the alternative sequence name for hrg-9. (B) Gene ontology analysis identified a variety of biological roles for genes within this cluster. (C) RT-qPCR of hrg-9 and hrg-10 under non-heme stress conditions: 24-hour starvation, 4-hour exposure to 34°C heat, and 25 mM paraquat (pqt). N=3 independent experiments.
Figure 4
Growth and muscle fiber integrity in yeast and zebrafish models of TANGO2 deficiency fail to replicate previously reported phenotypes.
(A) PCR confirmation of YGR127w knockout cassette integration across yeast strains. (B) Yeast growth curves. Different strains were grown in SC medium or SC medium lacking histidine at 25°C. (B) Whole-mount phalloidin staining of control and two strains of tango2-/- zebrafish (bwg210 and bwg211). Myofibers in mutants lack the parallel organization observed in controls but do not demonstrate significant myofiber breakdown or damage. Representative images; N=8–10 in each group. Scale bar = 5 mm.
-
Figure 4—source data 1
Original agarose gel in Figure 4A.
- https://cdn.elifesciences.org/articles/105418/elife-105418-fig4-data1-v1.zip
-
Figure 4—source data 2
Original files for agarose gel in Figure 4A.
- https://cdn.elifesciences.org/articles/105418/elife-105418-fig4-data2-v1.zip
Figure 5
Proposed model of TANGO2 and its homologs acting as stress-responsive mediators of mitochondrial dysfunction.
(A) Paraquat exposure and heme deficiency each induce reactive oxygen species (ROS) formation, mitochondrial stress, and enrichment of hrg-9 in C. elegans. TANGO2 and its homologs may help mitigate mitochondrial stress under these conditions, though the exact function of these proteins remains unknown. (B) Physiological triggers such as fasting or illness also precipitate oxidative stress in the absence of TANGO2. Abnormal lipid profiles have been observed in multiple models of TANGO2 deficiency in the setting of impaired lipid mobilization and reduced fatty acid oxidation. In humans, loss of TANGO2 results in a complex clinical syndrome reminiscent of multiple secondary mitochondrial disorders. In C. elegans, loss of hrg-9 and hrg-10 induces a phenotype previously observed in nematode strains exhibiting mitochondrial dysfunction. Created with BioRender.com.
Tables
Key resources table
| Reagent type(species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background (Caenorhabditis elegans) | N2 | Caenorhabditis Genetics Center (CGC) at the University of Minnesota | Bristol N2 | |
| Strain, strain background (C. elegans) | Double knockout (DKO) | Chen Lab, Zhejiang University | CCH303 (hrg-9(cck301)V; hrg-10(cck302)V) | Sun et al., 2022 |
| Strain, strain background (C. elegans) | eat-2 | Samuelson Lab, University of Rochester | eat-2(ad465) | |
| Chemical compound, reagent | Gallium protoporphyrin IX chloride (GaPP) | Santa Cruz | CAS 210409-12-4 | GaPP used in Sun et al., 2022 sourced from Frontier Scientific |
| Chemical compound, reagent | Zn(II) Mesoporphyrin IX (ZnMP) | Santa Cruz | CAS 14354-67-7 | ZnMP used in Sun et al., 2022 sourced from Frontier Scientific |
| Software, algorithm | Empirical Analysis of Gene Expression in R (edgeR) | Bioconductor.org | Sun et al., 2022 | |
| Software, algorithm | WormCat | Github.com | Holdorf et al., 2020 | |
| Chemical compound, reagent | Paraquat (methyl viologen dichloride hydrate) | Sigma-Aldrich | 856177 | |
| Chemical compound, reagent | TRIzol | Invitrogen | 15596026 | |
| Commercial assay or kit | RNeasy Mini Kit | QIAGEN | 74104 | |
| Commercial assay or kit | Maxima First Strand cDNA Synthesis Kit | Thermo Fisher | K1671 | |
| Chemical compound, reagent | iTaq Universal SYBR Green Supermix | Invitrogen | 1725121 | |
| Recombinant DNA reagent | hrg-9 F | This paper | PCR primers | GGACCCGCTGCCATACACTAATC |
| Recombinant DNA reagent | hrg-9 R | This paper | PCR primers | GACAATTCAAATCTGGCATCGTG |
| Recombinant DNA reagent | hrg-10 F | This paper | PCR primers | AGGCTTCCCGGAGCACATTTAC |
| Recombinant DNA reagent | hrg-10 R | This paper | PCR primers | CAGGCTCCATGCGTCTATCCAG |
| Recombinant DNA reagent | act F | This paper | PCR primers | CAACACTGTTCTTTCCGGAG |
| Recombinant DNA reagent | act R | This paper | PCR primers | CTTGATCTTCATGGTTGATGGG |
| Gene (Danio rerio) | tango2 | ENSMBL | ENSDARG00000056550 | Zebrafish homolog of TANGO2 |
| Strain, strain background (D. rerio) | TUAB | Zebrafish International Resource Center | TU (ZL57) AB (ZL1) | Wild-type lines. Sex is not determined in Danio rerio at the age group animals used in this study |
| Genetic reagent (D. rerio) | sgRNA to tango2 | Thermofisher Scientific; Kim et al., 2023 | Guide RNA to create mutations in tango2 gene | |
| Sequence-based reagent | tango2 F | Kim et al., 2023 | PCR primer | ATGGCTGAAAGAGCTGTGCT |
| Sequence-based reagent | tango2 R | Kim et al., 2023 | PCR Primer | ATGGCTGAAAGAGCTGTGCT |
| Chemical compound, drug | Alexa Fluor 488-Phalloidin | Thermo Fisher Scientific | A12379 | 1:40 dilution |
| Chemical compound, drug | Methylcellulose | Sigma-Aldrich | M0387-500G | 1% w/v dilution |
| Software, algorithm | Prism | GraphPad | ||
| Special instrumentation | Zebrafish automated activity monitor | Zantiks | ZantiksMWP | |
| Gene (Saccharomyces cerevisiae) | ygr127w | Saccharomyces Genome Database (SGD) | S000003359 | Yeast homolog of human Tango2 |
| Strain, strain background: (S. cerevisiae, haploid, MATa) | BY4741 (MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0) | EUROSCARF | ||
| Strain, strain background: (S. cerevisiae,haploid, MATα) | BY4742 (his3Δ1 leu2Δ0 lys2Δ0 ura3Δ0) | EUROSCARF | ||
| Strain, strain background: (S. cerevisiae, haploid, MATa) | W301 (leu2-3,112 trp1-1 can1-100 ura3-1 ade2-1 his3-11,15) | Lab stock | ||
| Genetic reagent (S. cerevisiae) | YGR127W::KanMX in BY4741, BY4742 | Lab stock, Chen Lab, Zhejiang University | YGR127W::KanMX | Sun et al., 2022 |
| Genetic reagent (S. cerevisiae) | YGR127W::KanMX in W303 | This paper | YGR127W::KanMX | Deletion strain generated by PCR replacement. verified by locus- specific PCR |
| Genetic reagent (S. cerevisiae) | sgRNA: ygr127w | Integrated DNA Technologies (IDT) | Guide RNA sequence used for CRISPR-Cas9–mediated deletion of YGR127W; replaced with KanMX resistance cassette to generate ygr127wΔ strain | |
| Recombinant DNA reagent | pRS313-YGR127W (HIS3, CEN6) | This paper | Yeast centromeric plasmid expressing YGR127W used for complementation | |
| Sequence-based reagent | ygr127wgRNA-F | This paper | sgRNA: ygr127w | GACTTTAATACGAAATCAAGATCCCG |
| Sequence-based reagent | ygr127wgRNA-R | This paper | sgRNA: ygr127w | AAACCGGGATCTTGATTTCGTATTAA |
| Sequence-based reagent | ygr127 F | This paper | PCR primer | AGTCGGATCCTCAAGGTTCTTCTCTAGAACC |
| Sequence-based reagent | ygr127 R | This paper | PCR primer | AGTCGGATCCTGCTCTATTGGAGAACTTAACC |
| Sequence-based reagent | ygr127 F | This paper | PCR primer | TTGGCATCTGCCTAGCTTTCG |
| Sequence-based reagent | ygr127 R | This paper | PCR primer | AGCGTCTACTGTGGTTACTG |
| Commercial assay or kit | Q5 High-Fidelity DNA Polymerase | New England Biolabs (NEB) | Cloning of inserts into pRS313 backbones | |
| commercial assay or kit | T4 DNA Ligase | New England Biolabs (NEB) | Cloning of inserts into pRS313 backbones | |
| Commercial assay or kit | CutSmart Buffer and Restriction Enzymes (EcoRI, XhoI, BamHI) | New England Biolabs (NEB) | Cloning of inserts into pRS313 backbones | |
| Commercial assay or kit | Golden Gate Assembly Kit (Type IIS cloning) | New England Biolabs (NEB) | Used for one-pot modular assembly of plasmid constructs | |
| Commercial assay or kit | EZ Yeast Transformation Kit | Zymo Research | Used for high-efficiency yeast transformation during plasmid integration and complementation assays |
Additional files
-
MDAR checklist
- https://cdn.elifesciences.org/articles/105418/elife-105418-mdarchecklist1-v1.docx
-
Supplementary file 1
Raw data from phenotypic assays and RT-qPCR.
- https://cdn.elifesciences.org/articles/105418/elife-105418-supp1-v1.xlsx
-
Source code 1
R code used for analysis of differential gene expression and hierarchical clustering.
- https://cdn.elifesciences.org/articles/105418/elife-105418-code1-v1.zip
Download links
A two-part list of links to download the article, or parts of the article, in various formats.
Downloads (link to download the article as PDF)
Open citations (links to open the citations from this article in various online reference manager services)
Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)
Cross-species evaluation of TANGO2 homologs, including HRG-9 and HRG-10 in Caenorhabditis elegans, challenges a proposed role in heme trafficking
eLife 14:RP105418.
https://doi.org/10.7554/eLife.105418.3
