Polyphosphate discriminates protein conformational ensembles more efficiently than DNA promoting diverse assembly and maturation behaviors

  1. Saloni Goyal
  2. Divya Rajendran
  3. Anup Kumar Mani
  4. Athi N Naganathan  Is a corresponding author
  1. Department of Biotechnology, Bhupat and Jyoti Mehta School of Biosciences, Indian Institute of Technology Madras, India
7 figures, 1 table and 3 additional files

Figures

Conformational features of CytR WT and mutants.

(A) Molecular structure of polyP. (B) Amino acid sequence of CytR. Blue and red boxes indicate the positions of alanine and proline mutations in DM and P33A variants, respectively. (C) Disordered propensity of CytR predicted using IUPred3 (Erdős et al., 2021) with gray and black curves showing long and short disorder predictions, respectively. (D) Far-UV circular dichroism (CD) spectra of WT (green), DM (blue), and P33A (red) at 298 K in mean residue ellipticity (MRE) units of deg. cm2 dmol−1. (E) Thermal denaturation curves of CytR variants from far-UV CD experiments monitored at 222 nm and reported in MRE units. (F) Stokes radius following the color code in panel E. (G) Electrostatic potential map (Jurrus et al., 2018) of CytR in its folded conformation displaying a large positive electrostatic potential. (H) The hypothesis tested in the current work. WT (left), DM (middle), and P33A (right) ensembles could potentially form condensates or aggregates in the presence of polyP or DNA, and which could also display differential time-dependent properties. U, PF, and F represent unfolded, partially folded, and folded conformations, respectively.

Figure 2 with 3 supplements
CytR undergoes phase separation with polyP in vitro.

(A) Phase diagram illustrating the phase separation of WT at different protein and polyP concentrations. Empty circles represent no phase separation, and filled circles represent the extent of phase separation following the color bar which indicates the OD (turbidity) at 350 nm. Representative DIC (B) and fluorescence (C) microscopy images of WT showing condensate formation in the presence of polyP. (D) Fluorescence microscopy images of NHS-rhodamine labeled WT at different protein concentrations in the presence of 22 µM PolyP. The scale bar is 10 µm. (E) Ionic strength dependence of turbidity at fixed WT (90 µM) and polyP (22 µM) concentrations. The error bar indicates the spread from experimental replicates (N = 2). DIC (left) and fluorescence (right) microscopy images of NHS-rhodamine labeled DM (F) and P33A (G) in the presence of polyP. The scale bar is 10 µm. (H) Representative fluorescence microscopy images of condensates during fluorescence recovery after photobleaching (FRAP) on WT (left) and DM (right) immediately after polyP addition. (I) FRAP recovery curves at 0 hr for DM (blue) and WT (green). The data represents an average of five experiments (N = 5), and the errors (shaded areas) are smaller than the size of the circles. (J) Time-lapse fluorescence images showing a dripping event for the WT (left column) and fission–fusion events for DM (right column).

Figure 2—figure supplement 1
Fluorescence microscopy images of 90 µM WT with 22 µM polyP at 160 mM ionic strength (pH 7) immediately after adding polyP (left panel) and after 30 min (right panel).

The scale bar is 10 µm.

Figure 2—video 1
Movie depicting droplet coalescence in condensates formed with CytR WT and polyphosphate, indicative of liquid-like properties.
Figure 2—video 2
Movie depicting droplet coalescence in condensates formed with CytR DM and polyphosphate, indicative of liquid-like properties.
Figure 3 with 1 supplement
Time dependence of polyP-induced assemblies.

(A) Turbidity (blue circles and left y-axis) and thioflavin T fluorescence intensity (green circles and right y-axis) time dependence for 90 µM WT (left panel), DM (middle panel), and P33A (right panel) in the presence of 22 µM polyP. The average from N = 2 experiments (circles) and the spread in the respective data (shaded region) are shown. (B) Representative fluorescence images of NHS-rhodamine labeled WT (top panel), DM (middle panel), and P33A (bottom panel) in the presence of polyP at different time points. The scale bar is 10 µm. Fluorescence recovery after photobleaching (FRAP) experiments for WT (panels CE) and DM (panels FH) in the presence of polyP at different time points – 0 min (pink), 30 min (blue), and 60 min (yellow) – and from five droplets (N = 5) and plotted as mean ± s.d. (C, F) The FRAP recovery curves of NHS-rhodamine labeled WT (panel C) and DM (panel F). The experimental errors (shaded areas) are also shown. (D, G) Recovery amplitudes or extents from FRAP experiments on the WT (panel D) and DM (panel G) at different time points. WT shows less recovery with time, indicating a liquid-to-solid transition, while the DM recovers fully. (E, H) FRAP recovery half-times for the WT (panel E) and DM (panel H) at the indicated time points. (I, J) Droplet size distribution of WT (panel I) and DM (panel J) at different time points following the same color code in panels CH. The numbers within the plot represent the mean droplet dimensions at the corresponding time points.

Figure 3—figure supplement 1
Turbidity (blue circles and left y-axis) and thioflavin T (ThT) fluorescence intensity (green circles and right y-axis) curve for 90 µM WT (left panel), DM (middle panel), and P33A (right panel) in the presence of 5 µM ThT.
Structural changes in polyP-induced assemblies.

(A-C) Far-UV circular dichroism (CD) spectra of 55 µM WT (A), DM (B), and P33A (C) at different time points – 0 hr (pink), 1 hr (blue), and 4 hr (yellow) – after the addition of 22 µM polyP at 298 K and displayed in mean residue ellipticity (MRE) units of deg. cm2 dmol−1. (D) Time dependence of the signal at 222 nm for the variants studied. Note the clear secondary-structure acquisition in the DM with time. (E) Basis spectra from a global singular value decomposition (SVD) of time-wavelength far-UV CD data. The first and second components are shown in black and gray, respectively. Amplitudes of first (F) and second (G) spectra as a function of time for CytR variants following the color code in panel D. Fourier-transform infrared (FTIR) spectra for WT (H), DM (I), and P33A (J) showing normalized absorbance recorded at the wavenumber range of 1700–1600 cm–1. Black curves represent the FTIR spectra of protein in the absence of polyP. The blue and green curves are the FTIR spectra of protein after the addition of polyP at 0 and 60 min, respectively. Red arrows indicate the change in peak intensity after the addition of polyP, showing beta-sheet-like conformation in WT and P33A between 1610 and 1630 cm–1. The vertical black line is at 1652 cm–1, the amide I frequency indicative of helical structure.

Figure 5 with 4 supplements
DNA induces metastable condensates that dissolve with time.

(A) Changes in turbidity in solutions containing increasing concentrations of the WT and a fixed 1 µM concentration 45 bp specific DNA. The data is the mean from N = 2 experiments, and the error bar represents the spread. (B) Fluorescence microscopy images of NHS-rhodamine labeled WT at different concentrations with 1 µM DNA. The scale bar is 10 µm. (C) Representative time-lapse images of WT showing a fusion event. (D) Fluorescence recovery after photobleaching (FRAP) recovery curves of NHS-rhodamine-labeled CytR WT (green), DM (blue), and P33A (red). The data represents the average from N = 4 experiments. The experimental errors are shown as shaded areas. (E) Recovery half-times for the CytR variants at the earliest time points (0 min). P33A shows the fastest recovery, followed by WT and DM. Fluorescence microscopy images of 25 µM DM (F) and P33A (G) in the presence of 1 µM 45 bp DNA. The scale bar is 10 µm. (H) Turbidity of 25 µM WT with 1 µM DNA as a function of time. Data (circles) are from N = 2 experiments, and the error bar indicates the spread. (I) Fluorescence microscopy images of NHS-rhodamine labeled WT with DNA at different time points. The scale bar is 10 µm. (J) Droplet size distribution curve for WT in the presence of DNA at different time points – 0 min (pink), 30 min (blue), and 60 min (yellow). Numbers within the plot represent the mean droplet dimensions at the corresponding time points. (K) Recovery half-times from FRAP experiment on WT with DNA at different time points for N = 4 experiments following the color code for panel J. (LN) Far-UV CD spectra of 25 µM WT (left), DM (middle), and P33A (right) at different time points – 0 hr (pink), 1 hr (blue), and 4 hr (yellow) – following the addition of 1 µM 45 bp DNA at 298 K. Black curve is the protein spectra in the absence of DNA. The data is reported in mean residue ellipticity (MRE) units of deg. cm2 dmol−1. (O) Time-dependent changes in far-UV CD signal at 222 nm for the CytR WT (green), DM (blue), and P33A (red). Dashed lines show MRE signal at 222 nm for the corresponding proteins in the absence of DNA.

Figure 5—figure supplement 1
Changes in OD and droplet dimensions as a function of time for DM and P33A variants, together with the fluorescence microscopy images of the three proteins in the presence of DNA at selected time points.

(A) Turbidity of 25 µM DM (blue) and P33A (orange) with 1 µM DNA as a function of time. The mean and the spread from N = 2 experiments are shown as circles and error bars, respectively. (B, C) Droplet size distributions for DM (B) and P33A (C) in the presence of DNA at different time points: 0 min (pink), 30 min (blue), and 60 min (yellow). Values given in the plot represent the mean dimensions of droplets at the corresponding time points. (D) Fluorescence microscopy images of NHS-rhodamine labeled WT (top), DM (middle) and P33A (bottom) in the presence of 45 bp DNA at different time points. The scale bar is 5 µm.

Figure 5—figure supplement 2
Fluorescence recovery after photobleaching (FRAP) experiments for CytR variants in the presence of DNA at different time points: 0 min (pink), 30 min (blue), and 60 min (yellow).

Data are reported as mean ± s.d. for N = 4 experiments. FRAP recovery curves of NHS-rhodamine labeled WT (A), DM (B), and P33A (C). The experimental errors are smaller than the size of data points. FRAP recovery half-times for WT (D), DM (F), and P33A (H) at the indicated time points. Recovery amplitude plots for WT (E), DM (G), and P33A (I) at different time points.

Figure 5—figure supplement 3
Fluorescence microscopy images of 90 µM NHS-rhodamine labeled WT (top), DM (middle), and P33A (bottom) in the presence of 11.24 µM of 45 bp DNA at the time points indicated.

The scale bar is 10 µm.

Figure 5—figure supplement 4
Fourier-transform infrared (FTIR) spectra of WT (left), DM (middle), and P33A (right) showing normalized absorbance recorded at a wavenumber range of 1700–1600 cm–1.

Black curves represent FTIR spectra of protein in the absence of DNA, and blue and green curves show FTIR spectra of protein after the addition of DNA at 0 and 60 min, respectively.

Figure 6 with 1 supplement
PolyP is able to discriminate between folded and molten-globular variants of FruR DNA-binding domain (DBD) while DNA does not.

(A) 3D structure of the DBD of FruR highlighting an aromatic stacking interaction between Y19 and Y28. (B,C) Turbidity (blue circles and left y-axis) and thioflavin T (ThT) fluorescence intensity (green circles and right y-axis) curve for 90 µM FruR WT (B) and Y19A (C) in the presence of 22 µM polyP. The mean data from N = 2 experiments and the corresponding spread are shown as circles and shaded area, respectively. (D) Representative fluorescence microscopy images of NHS-rhodamine labeled FruR WT (top panel) and Y19A (bottom panel) in the presence of polyP at different time points (0, 0.5, 1, and 3 hr). The scale bar is 10 µm. (E) Far-UV circular dichroism (CD) spectra of FruR WT (green) and Y19A (red) at 298 K in mean residue ellipticity (MRE) units of deg. cm2 dmol−1 in the absence of polyP. Far-UV CD spectra of 55 µM FruR WT (F) and Y19A (G) at different time points – 0 hr (pink), 1 hr (blue), and 4 hr (yellow) – after the addition of 22 µM polyP at 298 K and displayed in mean residue ellipticity (MRE). Note that the y-axis scales of this panel are different from panel E. (H) Time dependence of the signal at 222 nm for WT (green) and Y19A (red). Turbidity of 25 µM WT (I) and Y19A (J) with 1 µM DNA as a function of time from N = 2 experiments. No changes in turbidity are observed with time. Representative fluorescence microscopy images of NHS-rhodamine labeled FruR WT (K) and Y19A (L) in the presence of DNA. The scale bar is 10 µm.

Figure 6—figure supplement 1
Fluorescence recovery after photobleaching (FRAP) experiments on the Y19A variant of FruR in the presence of polyP at different time points: 0–10 min (pink), 10–20 min (blue), and 20–30 min (yellow).

(A) FRAP recovery curves of NHS-rhodamine labeled FruR. Arrow indicates the movement of the recovery profiles at longer incubation times. (B) Recovery half-time at the indicated time points. (C) Recovery amplitude at different time points. FRAP data for 0–10 min represents data from a single experiment as the condensates of Y19A are highly metastable (also see Figure 6C). The data acquired between 10–20 and 20–30 min are shown as mean ± s.d. from N = 4 and 3 experiments, respectively. The experimental errors are smaller than the size of data points.

Author response image 1

Tables

Key resources table
Reagent type (species) or resourceDesignationSource or referenceIdentifiersAdditional information
Sequence-based reagent45 bp long ds DNA – CytR specificThis paperOligonucleotide5′ TGGTGGGTAAATTTATGCAACGCATTTGCGTCATGGTGATGAGTA 3′
Sequence-based reagent45 bp long ds DNA – FruR specificThis paperOligonucleotide5′ TAAAGACAAGATCGCGCTGAAACGTTTCAAGAAAGCATAATACTT 3′
Recombinant proteinGlucose oxidaseSigma-AldrichG2133-10KU, 10000unitsFrom Aspergillus niger
Recombinant proteinCatalaseSigma-AldrichE3289-100mgFrom bovine liver
Chemical compoundSodium phosphate glass – type 45 (polyphosphate)Sigma-AldrichS4379-500MG
Chemical compoundNHS-rhodamineThermo Fisher Scientific46406
Chemical compoundD-(+)-GlucoseSigma-AldrichSLBR5156V
Chemical compoundDL-DithiothreitolHiMediaMB070-25G
Chemical compoundThioflavin TSigma-AldrichT3516-5G

Additional files

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Open citations (links to open the citations from this article in various online reference manager services)

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

  1. Saloni Goyal
  2. Divya Rajendran
  3. Anup Kumar Mani
  4. Athi N Naganathan
(2025)
Polyphosphate discriminates protein conformational ensembles more efficiently than DNA promoting diverse assembly and maturation behaviors
eLife 14:RP105461.
https://doi.org/10.7554/eLife.105461.3