Structural basis for collagen recognition by the Streptococcus pyogenes M3 protein and its involvement in biofilm
- School of Biology, Biomedical Sciences Research Complex, University of St Andrews, North Haugh, United Kingdom
- Center for Infectious Medicine, Karolinska Institutet, Karolinska University Hospital Huddinge, Sweden
- CRUK Beatson Institute, United Kingdom
- Department of Biochemistry, University of Cambridge, Downing Site, United Kingdom
- Department of Medicine, Haukeland University Hospital, Norway
- Department of Clinical Science, University of Bergen, Norway
- Department of Anesthesiology and Intensive Care Medicine, Sahlgrenska University Hospital, Sweden
- Department of Anesthesiology, Hyperbaric Medicine Center, Head and Orthopedic Center, Copenhagen University Hospital, Rigshospitalet, Denmark
- Department of Clinical Medicine, University of Copenhagen, Denmark
Figures
Figure 1
Multiple sequence alignment of the hypervariable regions of streptococcal M proteins.
The top panel shows a MARCOIL coiled coil prediction (Delorenzi and Speed, 2002) for full-length M3 protein. Positions of signal and wall anchor cleavage sites are indicated by S and W, respectively. The PARF motif (position indicated by pink bar), previously suggested to be required for collagen binding, resides in a region of M3 that is predicted to not adopt coiled coil topology. In the alignment, sequence similarity is indicated by gray shading for residues conserved or similar in at least 75% of sequences. 100% conserved residues are highlighted by black shading. UniProt identifiers are shown to the left of the alignment. Sequences are ordered by alignment score. The proteins are from the following species: Streptococcus pyogenes: A0A0H2UWN1 (M3), A0A0E1EQ89 (M3.2), M4HZY1 (M133), M4I010 (M31), P19401 (M12), M4I038 (M228), Q840T7 (M229), Q54840 (M55), M4HZT2 (M222); Streptococcus dysgalactiae subsp. equisimilis: Q1KQ01, Q9L4N1, Q00720, Q1KQ03, Q5YB85, Q4ZGP4, D0EZI1, W0T3Y6, W0T3A4; Streptococcus equi subsp. zooepidemicus: I7AXP7.
Figure 2 with 1 supplement
Binding of full-length M3 protein fused to GST to immobilized collagen ligand collections (CLC) II and III peptides.
ELISA signal based on GST antibody is plotted against peptides spanning the tropocollagen (triple-helical) regions of collagens II and III, as well as positive (collagen II) and negative (GPP10, BSA) controls. Signals for three peptides chosen for further binding experiments are highlighted in red. Mean absorbances and standard errors of the means calculated for three replicate wells are shown.
Figure 2—figure supplement 1
The figure shows the number of specific residues or residue classes per collagen ligand collections (CLC) peptide (y-axis) plotted versus rank group (x-axis).
Groups are defined as low affinity (A450=0–0.25), medium affinity (A450=0.25–0.5), and high affinity (A450=0.5–0.5) in the solid phase binding assays. Statistical difference between numbers in each group was determined by non-parametric testing as defined in Methods.
Figure 3
1H,15N HSQC spectra for (A) disulfide-bond stabilized dimeric M3-NTD and (B) the reduced, monomeric form.
Figure 4
Isothermal titration calorimetry (ITC) binding curves for M3-NTD interactions with collagen ligand collections (CLC) peptides.
Top panels show heat responses to repeated injections of M3-NTD into collagen peptide solutions, with baselines shown in red. Bottom panels show integrated signals (enthalpy changes) plotted against the molar ratio of binding partners. Where nonlinear fitting gave meaningful results, the fits are shown as blue lines, and dissociation constants (KD) are specified. (A) ITC data for interaction of M3-NTD with triple-helical peptide II-16. (B) ITC data for interaction of M3-NTD with triple-helical peptide II-27. (C) ITC data for interaction of M3-NTD with triple-helical peptide II-44. (D) ITC data for interaction of M3-NTD with monomeric peptide II-44. (E) ITC data for interaction of monomeric M3-NTD with triple-helical peptide II-44.
Figure 5
Crystal structure of M3-NTD (PDB 8p6k).
(A) Ribbon diagram of the covalently stabilized M3-NTD dimer. Monomers are shown in blue and gray. The regions previously associated with collagen binding (PARF motif) are highlighted in red. N-termini (Asp42) and C-termini (Cys151) are labeled N and C, respectively. The three helices of the blue monomer are labeled H1-3. The C-terminal disulfide bond is shown as sticks. (B) Ribbon diagram model for the full extracellular region of M3, predicted by AlphaFold3 (Abramson et al., 2024) and colored by per-residue confidence (pLDDT). (C) Conserved leucine, isoleucine (Ile60), and glycine (Gly103) residues define the T-junction structure of M3-NTD. (D) Role of conserved residues around the PARF motif in stabilizing the T-bar region of M3-NTD. Polar contacts are shown as dashed lines.
Figure 6 with 1 supplement
AlphaFold3 predictions for M proteins of group A streptococcus (GAS), Streptococcus dysgalactiae subsp. equisimilis (SDSE), and Streptococcus equi subsp. zooepidemicus (SESZ).
(A) Overlay of the experimental M3-NTD structure (magenta) with a predicted structure for the N-terminal 230 residues of mature M3 (colored by pLDDT). (B) Predicted structures for the N-terminal 230 residues of other M proteins included in the sequence alignment (Figure 1). (C) Predicted structures for the N-terminal 230 residues of M1 and M28 proteins, which are not known to interact with collagens. Values in parentheses are AlphaFold3 prediction quality parameters ipTM and pTM, respectively.
Figure 6—figure supplement 1
Additional AlphaFold3 predicted structures of proteins included in the sequence alignment (Figure 1).
The N-terminal 230 residues of mature proteins were included in predictions (colored by pLDDT). For M133, only the first 196 residues have been modeled to highlight the effect of the deletion of residues that are integral to the T-shape structure of M3. Values in parentheses are AlphaFold3 prediction quality parameters ipTM and pTM, respectively.
Figure 7 with 1 supplement
Structural basis of collagen binding by M3 (PDB 8p6j).
(A) Crystal structure of the complex of M3-NTD (subunits shown in light and dark gray cartoon representation) with collagen-derived peptide JDM238. Two binding registers are observed bound to equivalent sites of the M3-NTD dimer, indicated by shades of magenta and cyan. (B) Space-filling models of views from the top of the T-bar of M3-NTD (top) and looking down the stem toward the bottom of the T-bar (bottom). The PARF motif is shown in tones of red, otherwise, coloring is as in (A).
Figure 7—figure supplement 1
Crystal packing.
(A) Each triple-helical peptide (shades of magenta and cyan) is bound to two copies of M3-NTD (gray ribbons) at two distinct sites. (B) This results in the compact assembly observed in the crystal.
Figure 8 with 3 supplements
Collagen triple helix/M3-NTD interface.
(A) Residues of M3-NTD (gray cartoon representation) that form the collagen binding site are shown as sticks and are labeled. The collagen peptide triple helix is shown in stick and surface representation in shades of magenta. The sequence is shown indicating the staggered arrangement of the chains in the triple helix. (B) Superposition of the two peptide binding sites to highlight conservation of collagen binding mode despite sequence deviation between the two binding registers. Tyr96 and Trp103 are shown as sticks. The two monomers of M3-NTD are shown in light and dark shades of gray. Collagen peptides of the two binding modes are shown in magenta and cyan, with five equivalent side chains shown as sticks. The equivalent sequences of the binding sites are shown. Water molecules in the binding interface are shown as blue spheres. In the zoomed-in image on the bottom right, only one of the collagen peptide chains is shown per complex for clarity. Hydrogen bonds are shown as gray dashed lines.
Figure 8—figure supplement 1
AlphaFold3 predicted structures of M proteins in complex with 24-residue collagen peptides.
(A) Predicted complexes with the model collagen peptide (GPO8), representing the generic tropocollagen triple-helical structure. Two chains of the N-terminal 230 residues of mature proteins and, for clarity, only three collagen peptide chains were included in predictions. M proteins are shown in cartoon, GPO8 peptide in surface representations, respectively (colored by pLDDT). Values in parentheses are AlphaFold3 prediction quality parameters ipTM and pTM, respectively. (B) Predicted structure of an equivalent complex between M3 and a type I collagen peptide. (C) Closeup view of the predicted binding site of the type I collagen peptide (shades of orange) and M3 (shades of gray). Key residues, equivalent to the ones shown in Figure 8B, are shown in stick representation. The sequences of the hetero-triple-helical peptide (two α1 chains and one α2 chain), derived from PDB 5CTD, are also shown.
Figure 8—figure supplement 2
ITC binding curves for M3-NTD variants with peptide II-44.
Top panels show heat responses to repeated injections of M3-NTD into II-44 solutions, with baselines shown in red. Bottom panels show integrated signals (enthalpy changes) plotted against the molar ratio of binding partners. For M3-NTD Y96F, the fit is shown as a blue line, and the dissociation constant (KD) is specified. (A) ITC data for interaction of M3-NTD Y96A with triple-helical peptide II-44. (B) ITC data for interaction of M3-NTD Y96F with triple-helical peptide II-44. (C) ITC data for interaction of M3-NTD W103A with triple-helical peptide II-44. (D) ITC data for interaction of M3-NTD W103I with monomeric peptide II-44.
Figure 8—figure supplement 3
1H NMR spectra of M3-NTD and variants with key collagen-binding residues mutated.
Asterisks denote Trp103 indole NH signals.
Figure 9
Effect of collagen type I on biofilm formation by necrotizing soft tissue infection strains.
(A) Quantitative analysis of biofilm formation on polystyrene surface with or without human type I collagen. The inoculum of each bacterial strain was 105 CFU per well. Significance was determined by one-way ANOVA with Tukey’s post hoc test. ****p<0.0001; ***p<0.001; **p<0.01; *p<0.05 (B) Varying effect of collagen concentration. The inoculum of each bacterial strain was 105 CFU per well. (C) Inoculum effects on biofilm of strain 2028. (D) Effect of concentration of coating collagen on strain 2028 biofilm (100 CFU per well). (A–D) Results are shown as mean + SE. All assays were repeated at least three times in triplicate. (E) Confocal microscopic analysis of biofilm formation 48 h after incubation. Fluorescence staining (WGA-Alexa 488, DAPI, and Nile red) of biofilm on uncoated and collagen-coated glass slides. Scale bars indicate 50 μm.
Figure 10 with 1 supplement
Competition analysis of biofilm formation of group A streptococcus (GAS) isolate 2028 (100 CFU per well) in the presence of M3-NTD.
Results are shown as mean + SE. All assays were repeated three times in triplicate. Significance was determined by one-way ANOVA, followed by Tukey’s post hoc test ****p<0.0001; ***p<0.001.
Figure 10—figure supplement 1
Biofilm formation of emm3 group A streptococcus (GAS).
(A) Quantitative analysis of biofilm formation on polystyrene surface with or without human type I collagen. The inoculum of each bacterial strain was 105 CFU per well. This assay was repeated four times in triplicate, and results are shown as mean + SE. Significance was determined by one-way ANOVA with Tukey’s post hoc test. ****p<0.0001; ***p<0.001; **p<0.01; *, P<0.05. (B) Confocal image of emm3 GAS stained with DAPI and M3-specific antibodies. BCW, B- and C-repeat and wall-spanning regions of M3. Scale bars indicate 5 μm.
Figure 11
Colocalization of collagen with emm3 group A streptococcus (GAS) in patients’ biopsies.
Frozen biopsy sections were stained with anti-GAS (green), anti-collagen IV (red), and DAPI (blue). Scale bars indicate 50 μm. The Mander’s overlap coefficient (MOC) was used to quantify the colocalization of bacteria with collagen.
Figure 12
Colocalization of collagen with emm3 group A streptococcus (GAS) in 3D skin tissue model.
Skin tissue models were infected with GAS strains 2006 and 2028. At 8, 24, and 48 h after infection, frozen sections were stained with anti-GAS (green), anti-collagen IV (red), and DAPI (blue). The Mander’s overlap coefficient (MOC) was used to quantify the colocalization of bacteria with collagen. The merged images are shown.
Tables
Table 1
Effect of amino acid classes on binding of M3 to collagen ligand collections.
| Amino acid class | Effect on binding rank | Significance |
|---|---|---|
| Hydrophobic (F, L, V, M, I) | Positive | p=0.0002 |
| Hydroxyproline (O) | Positive | p=0.0003 |
| Polar (S, T) | None | |
| Polar (Q, N) | None | |
| Basic (R, K) | None | |
| GPO triplets | None | |
| Acidic (D, E) | Negative | p=0.001 |
| Proline (P) | Negative | p=0.0007 |
Table 2
Data collection and refinement statistics.
Values in brackets refer to the highest resolution shell.
| M3-NTD | SeMet M3-NTD | M3-NTD+JDM238 | |
|---|---|---|---|
| Data collection | 8P6K | 8P6J | |
| Spacegroup | C2 | C2 | P1 |
| Cell dimensions | |||
| a, b, c (Å) | 150.5, 24.1, 78.0 | 150.4, 25.1, 77.0 | 31.8, 51.5, 80.2 |
| a, b, c (o) | 90, 105.3, 90 | 90, 104.4, 90 | 87.3, 84.8, 89.4 |
| Resolution (Å) | 37.62–1.92 (1.94–1.92) | 37.3–2.67 (2.71–2.67) | 79.77–2.32 (2.45–2.32) |
| Rmeas | 0.058 | 0.198 | 0.107 |
| I/σ | 14.8 | 10.2 | 2.1 |
| CC1/2 | 0.9 (0.5) | 1 (0.9) | 1 (0.3) |
| Completeness (%) | 97.80 (94.07) | 98.8 | 89.58 (89.66) |
| Multiplicity | 6.2 | 18.6 | 1.7 |
| Refinement statistics | |||
| Resolution (Å) | 37.6–1.92 | 79.77–2.32 | |
| No. reflections | 21411 (1054) | 19530 (947) | |
| Rwork/Rfree | 0.230/0.268 | 0.241/0.285 | |
| Ramachandran favored (%) | 97.7 | 97.7 | |
| Ramachandran outliers (%) | 0 | 0.5 | |
| RMS deviations | |||
| Bond lengths (Å) | 0.039 | 0.013 | |
| Bond angles (o) | 2.06 | 1.89 | |
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain (Streptococcus pyogenes) | 2006, 2028, 5004 | Siemens et al., 2016 | Clinical isolates | |
| Strain (S. pyogenes) | 5262 and 8003 | Dr. Donald E. Low, Kaul et al., 1997; Johansson et al., 2008 | Clinical isolates | |
| Strain, strain background (Escherichia coli) | BL21(DE3) | Sigma-Aldrich | CMC0016 | Chemically competent cells |
| Cell line (Homo sapiens) | Dermal fibroblast (normal, adult) | Siemens et al., 2016; Bergsten et al., 2021; Siemens et al., 2015 | NHDF | Isolated from skin biopsies of healthy donors |
| Cell line (H. sapiens) | Keratinocytes | Dr. J. Rheinwald, Cell Culture Core of the Harvard Skin Disease Research Centre, Boston, MA, USA, Siemens et al., 2016; Bergsten et al., 2021; Siemens et al., 2015 | N/TERT-1 | |
| Antibody | Anti-M3-HVR, rabbit polyclonal | Prof. Gunnar Lindahl, Lund University | Recognizes HVR of M3 (1:200) | |
| Antibody | Anti-M3-BCW, rabbit polyclonal | Prof. Gunnar Lindahl, Lund University | Recognizes BCW region of M3 (1:2000) | |
| Antibody | Anti-rabbit IgG Alexa Fluor 488 conjugate, donkey polyclonal | Abcam | RRID:AB_2768318 | Secondary for M3 staining (1:500) |
| Antibody | Anti-Streptococcus group A antibody, goat polyclonal | Abcam | RRID:AB_778136 | Primary for GAS staining (2 µg/mL) |
| Antibody | Anti-collagen IV antibody (COL-94), mouse monoclonal | Abcam | RRID:AB_869201 | Primary for collagen staining (1:400) |
| Antibody | Anti-goat IgG Alexa Fluor 488 conjugate, donkey polyclonal | Abcam | RRID:AB_2687506 | Secondary for GAS staining (1:500) |
| Antibody | Anti-mouse IgG Alexa Fluor 546 conjugate, donkey polyclonal | Invitrogen | RRID:AB_11180613 | Secondary for collagen staining (1:500) |
| Recombinant DNA reagent | pGEX6P-1- M3 (plasmid) | Dr. Susanne Talay, Dinkla et al., 2003 | N-terminally GST-fused M3 | |
| Recombinant DNA reagent | pEHISTEV-M3NTD (plasmid) | This paper, Liu and Naismith, 2009 | N-terminally His6-tagged, TEV cleavable M3-NTD | |
| Sequence-based reagent | M3_F | This paper | PCR primer | GCTAGCCATGGATGCTAGGAGTGTTAATGG |
| Sequence-based reagent | M3_R | This paper | PCR primer | CTAGGGATCCCTAGCAGTCCTGATATTCCTTTTC |
| Sequence-based reagent | M3_Y96A_F | This paper | PCR primer | GACAAAAGGCTGAAGCGCTAAAAGGCC |
| Sequence-based reagent | M3_Y96A_R | This paper | PCR primer | GGCCTTTTAGCGCTTCAGCCTTTTGTC |
| Sequence-based reagent | M3_Y96F_F | This paper | PCR primer | GACAAAAGGCTGAATTTCTAAAAGGCC |
| Sequence-based reagent | M3_Y96F_R | This paper | PCR primer | GGCCTTTTAGAAATTCAGCCTTTTGTC |
| Sequence-based reagent | M3_W103A_F | This paper | PCR primer | CCTTAATGATGCGGCTGAGAGGC |
| Sequence-based reagent | M3_W103A_R | This paper | PCR primer | CCTTTTAGATATTCAGCCTTTTG |
| Sequence-based reagent | M3_W103D_F | This paper | PCR primer | CCTTAATGATGATGCTGAGAGGCTG |
| Sequence-based reagent | M3_W103D_R | This paper | PCR primer | CCTTTTAGATATTCAGCCTTTTG |
| Sequence-based reagent | M3_W103I_F | This paper | PCR primer | CCTTAATGATATTGCTGAGAGGCTG |
| Sequence-based reagent | M3_W103I_R | This paper | PCR primer | CCTTTTAGATATTCAGCCTTTTG |
| Sequence-based reagent | M3_I60M_F | This paper | PCR primer | GTTAAATTAAAAAATGAAATGGAGAACTTGTTAGATC |
| Sequence-based reagent | M3_I60M_R | This paper | PCR primer | GATCTAACAAGTTCTCCATTTCATTTTTTAATTTAAC |
| Sequence-based reagent | M3_I141M_F | This paper | PCR primer | GAACTTAAGGAAAAAATGGACAAAAAGGAAAAGG |
| Sequence-based reagent | M3_I141M_R | This paper | PCR primer | CCTTTTCCTTTTTGTCCATTTTTTCCTTAAGTTC |
| Commercial assay or kit | CLCII and CLCIII | Triple Helical Peptides Ltd. Konitsiotis et al., 2008; Howes et al., 2014 | Collagen triple helical peptide libraries | |
| Software, algorithm | Topspin | Bruker | RRID:SCR_014227 | |
| Software, algorithm | AlphaFold server | Google DeepMind | RRID:SCR_025885 | |
| Software, algorithm | autoPROC | Global Phasing | RRID:SCR_015748 | |
| Software, algorithm | Coot | Emsley et al., 2010 | RRID:SCR_014222 | |
| Software, algorithm | RefMac5 | CCP4, Murshudov et al., 2011 | RRID:SCR_014225 | |
| Software, algorithm | PyMOL | Schrödinger, LLC | RRID:SCR_000305 | |
| Software, algorithm | PHASER | Phenix, McCoy et al., 2007 | RRID:SCR_014219 | |
| Software, algorithm | MolProbity | Phenix, McCoy et al., 2007 | RRID:SCR_014226 | |
| Other | PDBe | European Bioinformatics Institute | RRID:SCR_004312 | Data deposition service for structural coordinates |
Additional files
Download links
A two-part list of links to download the article, or parts of the article, in various formats.
Downloads (link to download the article as PDF)
Open citations (links to open the citations from this article in various online reference manager services)
Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)
Structural basis for collagen recognition by the Streptococcus pyogenes M3 protein and its involvement in biofilm
eLife 14:RP105539.
https://doi.org/10.7554/eLife.105539.3
