Glycogen engineering improves the starvation resistance of mesenchymal stem cells and their therapeutic efficacy in pulmonary fibrosis
- MOE Key Laboratory of Bioinformatics, Center for Synthetic and Systems Biology, Tsinghua University, China
- School of Life Sciences, Tsinghua University, China
- Xinjiang Stem Cells Special Plateau Disease Engineering Technology Research Center, China
- School of Materials Science and Engineering, Tsinghua University, China
- Department of Medical Genetics and Developmental Biology, School of Basic Medical Sciences, Capital Medical University, China
- State Key Laboratory of Green Biomanufacturing, China
Figures
Figure 1
Schematic illustration of the strategy used to enhance the therapeutic efficacy of mesenchymal stem cells (MSCs) through glycogen engineering.
(A) Engineering glycogen metabolism of MSCs by overexpressing essential enzymes of glycogen synthesis. (B) Engineered MSCs use glycogen as an energy supply after implantation, improving cell viability and therapeutic efficacy.
Figure 2 with 1 supplement
Construction of glycogen engineering strategies.
(A) Essential enzymes of glycogen synthesis. (B) Tests of essential enzyme combination strategies in HEK293T cells by transient transfection. The glycogen content of each group was measured (N=3, mean ± SD). (C) Periodic acid-Schiff (PAS) staining of cells expressing GYSmut and glycogen synthase (GYS)-UDP-glucose pyrophosphorylase (UGP) revealed significant accumulation of glycogen granules.Scale bar, 50 μm.
Figure 2—figure supplement 1
Further optimization of glycogen engineering strategies.
(A) GYSdelc promoted glycogen accumulation (N=3, mean ± SD). (B) Co-expressing GYSmut and UDP-glucose pyrophosphorylase (UGP) further promoted glycogen accumulation (N=3, mean ± SD).
Figure 3 with 1 supplement
Construction of glycogen-engineered mesenchymal stem cells (MSCs).
(A) Glycogen content of GYSmut MSCs (N=3, mean ± SD). (B) Periodic acid-Schiff (PAS) staining of GYSmut MSCs, showing glycogen granules (red). Scale bar, 50 μm. (C) Survival of engineered MSCs under Dulbecco’s phosphate-buffered saline (DPBS) (starvation) treatment in vitro (N=3, mean ± SD). (D) Residual glycogen content of GYSmut MSCs after DPBS (starvation) treatment for 48 hr (N=3, mean ± SD). (E) Viability of GYSmut MSCs according to the CCK8 assay (N=8, mean ± SD). (F, G) Adipogenic differentiation potential of GYSmut MSCs, assessed by Oil Red O staining and qPCR detection of Lpl expression (N=3, mean ± SD, unpaired t-test p-value<0.0001). Scale bar, 100 μm. (H) Gene ontology (GO) enrichment analysis of differentially expressed genes (DEGs) between GYSmut MSCs and the GFP control. (I) KEGG analysis of DEGs. (J) Gene set enrichment analysis (GSEA) of the DEGs.
Figure 3—figure supplement 1
Impacts of glycogen engineering on mesenchymal stem cells (MSCs).
(A) Cell volume change of engineered MSCs, assessed through flow cytometry. (B) Periodic acid-Schiff (PAS) and hematoxylin staining of GYSmut MSCs. Glycogen (red) is distributed in cell nucleus (blue) and cytoplasm. (C) Glycogen distribution of GYSmut and glycogen synthase (GYS)-glycogenin (GYG) MSCs. Scale bar, 50 μm. (D) Starvation resistance test under hypoxia.(N=5, mean ± SD). (E) Impacts of glycogen engineering on transcriptome of MSCs.
Figure 4 with 2 supplements
Survival of implanted glycogen-engineered mesenchymal stem cells (MSCs).
(A) Schematic illustration of the strategy used to assess the survival of MSCs by detecting Gaussia luciferase activity in the homogenate of lungs. (B) Changes of Gaussia luciferase activity in the two groups on day 7 post-implantation (three mice each group, unpaired t-test p-value = 0.044) (N=3, mean ± SD). (C) Live imaging of Akaluc luciferase activity in the two groups implanted with GYSmut-Akaluc MSCs and control cells (five mice each group). One mouse from the control group died on day 7, and one mouse from the GYSmut-Akaluc group died on day 11.
Figure 4—figure supplement 1
KEGG and gene set enrichment analysis (GSEA) of implanted mesenchymal stem cells (MSCs) in our previous research.
GFP MSCs were intratracheally administered to pulmonary fibrosis (PF) mice and collected through flow cytometry. Single-cell sequencing showed downregulation of glucose metabolism.
Figure 4—figure supplement 2
Quantification of Akaluc activity of in vivo imaging post-implantation.
Figure 5
Therapeutic efficacy of glycogen-engineered mesenchymal stem cells (MSCs).
(A) Survival and body weight changes of pulmonary fibrosis (PF) mice treated with GYSmut MSCs and control cells (10 mice each group, mean ± SEM, two-way ANOVA p-value = 0.0001). (B) Representative lung tissue sections stained with hematoxylin and eosin (H&E) and Masson’s trichrome. NC group is healthy mice.Scale bar, 200 μm (C) Collagen deposition and preserved alveolar size (quantified by mean linear intercept [MLI]) of lung tissue sections (six mice each group).
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Gene (Mus musculus) | Gys1 | GenBank | NM_030678 | |
| Gene (M. musculus) | Gbe1 | GenBank | NM_028803.4 | |
| Gene (M. musculus) | Gyg1 | GenBank | NM_001355261 | |
| Gene (M. musculus) | Ugp2 | GenBank | NM_001290634.1 | |
| Strain, strain background (Escherichia coli) | DH5a | Vazyme | Cat#C502-02 | Competent cell |
| Cell line (M. musculus) | MSC | This paper | Primary MSCs isolated from adipose tissue of C57/B6J mice (male) | |
| Cell line (Homo sapiens) | HEK293T | ATCC | RRID:CVCL_0063 | |
| Transfected construct (M. musculus) | pCDH | Addgene | RRID:Addgene_72266 | Lentiviral construct to transfect and express GYS/GYG/GBE/UGP, etc. |
| Sequence-based reagent | Lpl-F | Synthesized by Tsingke, Beijing | PCR primers | TTGCCCTAAGGACCCCTGAA |
| Sequence-based reagent | Lpl-R | Synthesized by Tsingke, Beijing | PCR primers | TTGAAGTGGCAGTTAGACACAG |
| Sequence-based reagent | Actb-F | Synthesized by Tsingke, Beijing | PCR primers | CCACTGTCGAGTCGCGTCC |
| Sequence-based reagent | Actb-R | Synthesized by Tsingke, Beijing | PCR primers | TCCGGAGTCCATCACAATGC |
| Commercial assay or kit | Lipo8000 | Beyotime | Cat#C0533 | |
| Commercial assay or kit | Glucogen Content Assay Kit | SOLARBIO | BC0345-100T | |
| Commercial assay or kit | PAS staining kit | Beyotime | Cat#C0142S | |
| Commercial assay or kit | Lentivirus Concentration Solution | Servicebio | Cat#G1801-100ML | |
| Commercial assay or kit | CCK-8 assay kit | BIORIGIN | Cat#BN15201 | |
| Commercial assay or kit | Oil Red O staining kit | Beyotime | Cat#C0157S | |
| Commercial assay or kit | Secrete-Pair Dual Luminescence Assay Kit | GeneCopoeia | Cat#LF061 | |
| Commercial assay or kit | RNA isolator Total RNA Extraction Reagent | Vazyme | Cat#R401-01 | |
| Chemical compound, drug | Akalumine-HCL | InvivoChem | Cat#V41343 | |
| Chemical compound, drug | bleomycin | Sigma Aldrich | Cat#B5507-15un |
Additional files
-
Supplementary file 1
Protein sequences used in this study.
- https://cdn.elifesciences.org/articles/106023/elife-106023-supp1-v1.xlsx
-
MDAR checklist
- https://cdn.elifesciences.org/articles/106023/elife-106023-mdarchecklist1-v1.docx
Download links
A two-part list of links to download the article, or parts of the article, in various formats.
Downloads (link to download the article as PDF)
Open citations (links to open the citations from this article in various online reference manager services)
Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)
Glycogen engineering improves the starvation resistance of mesenchymal stem cells and their therapeutic efficacy in pulmonary fibrosis
eLife 14:RP106023.
https://doi.org/10.7554/eLife.106023.3
