map3k1 is required for spatial restriction of progenitor differentiation in planarians
- Whitehead Institute for Biomedical Research, United States
- Department of Biology, Massachusetts Institute of Technology, United States
- Department of Brain and Cognitive Sciences, Massachusetts Institute of Technology, United States
- Howard Hughes Medical Institute, Massachusetts Institute of Technology, United States
Figures
Figure 1 with 1 supplement
map3k1 RNAi results in ectopic eyes and ectopic isolated eye cells.
(A) Top row: live image of a control RNAi animal followed by three examples of map3k1 RNAi animals with disorganized eyes (white arrows) (n = 156/200>1 ectopic eye, after 4 weeks of RNAi). Bottom row: control RNAi fluorescent in situ hybridization (FISH) images followed by three map3k1 RNAi examples visualizing OC cells (RNA probe pool to catalase/tyrosinase/glut3); photoreceptor neurons (PRNs) are visualized with either an RNA probe to opsin (PRN cell bodies) or an anti-Arrestin antibody (PRN cell bodies and projections). The left and middle map3k1 RNAi FISH examples show single ectopic PRNs (opsin, left; anti-Arrestin, middle) and OC cells (catalase/tyrosinase/glut3) scattered below and around the eyes after 3 weeks of RNAi. The far FISH example shows ectopic OC cells and PRNs (anti-Arrestin) after 6 weeks of RNAi. Dorsal up. Scale bars, 100 μm. (B) FISH showing ectopic PRNs (anti-Arrestin) and OC cells (catalase/tyrosinase/glut3) in the trunk and tail region of a map3k1 RNAi animal after 5 weeks of RNAi (n = 10/10 with at least one cell in the trunk) (see panel A for control RNAi). Scale bar, 100 μm. Magnified panels 1 and 2, scale bars, 50 μm. White arrows point to all ectopic cells. (C) FISH showing the tail regions of control and map3k1 RNAi animals; single OC (catalase/tyrosinase/glut3) cells are observed in the tail after 1 week of map3k1 RNAi (n = 12/18 with at least one cell in the tail). Scale bar, 200 μm. (D) Top graph depicts the number of ectopic PRNs (1 week: n = 15; 2 weeks: n = 9; 3–4 weeks: n = 22). Control shown at 3–4 weeks (n = 11). Bottom graph depicts the number of ectopic OC cells (1 week: n = 16; 2 weeks: n = 7; 3–4 weeks: n = 17) per map3k1 RNAi animal along the AP axis over time. Control shown at 3–4 weeks (n = 18). map3k1 RNAi resulted in higher ectopic cell numbers along the AP axis (p < 0.0001; Poisson generalized linear mixed model) compared to the control condition for both PRNs and OC cells at 3–4 weeks. (E) Schematic comparing previously identified eye-patterning RNAi phenotypes (after ndk, wnt5, slit, and notum RNAi) with the map3k1 RNAi phenotype. (F) FISH examples of eye-specialized neoblasts (ovo+; smedwi-1+ cells) in tails of control and map3k1 RNAi animals at 3 weeks of RNAi. Scale bar, 20 μm. The right graph shows no significant difference (p = 0.181; permutation test, 10,000 permutations; two-tailed) in the frequency of eye-specialized neoblasts in the tails of control (n = 10) and map3k1 RNAi (n = 10) animals. All images, dorsal up. Bottom left numbers indicate the number of animals exhibiting the shown phenotype out of the total number of animals observed.
Figure 1—figure supplement 1
map3k1 RNAi results in differentiated eye cells throughout the AP axis, and no overt change in eye-progenitor distribution.
(A) Domain structure of MAP3K1 in human, Schmidtea mediterranea, Dugesia japonica, Echinococcus multilocularis, and Xenopus tropicalis. % identity/similarity is displayed above each domain for Schmidtea mediterranea Map3k1 compared to human MAP3K1. (B) Fluorescent in situ hybridization (FISH) images of map3k1 RNAi animals at 1 and 2 weeks of map3k1 RNAi showing ectopic OC cells (RNA probe pool to catalase1, tyrosinase, and glut3) in the head, trunk, and tail. The 1-week map3k1 RNAi animal example included is from Figure 1C. Far right FISH shows ectopic OC and photoreceptor neurons (PRNs, anti-Arrestin) (white arrows) along the AP axis in a 6-week map3k1 RNAi animal. Dorsal up. Scale bar, 200 μm. (C) FISH (using an RNA probe to map3k1) showing broad map3k1 expression in a wild-type animal, with some visible expression in the brain and ventral nerve cords. Ventral, up. Scale bar, 200 μm. (D) FISH examples of ovo+; smedwi-1+ cells lateral to the posterior half of the pharynx in both map3k1 RNAi and control animals after 3 weeks of RNAi. Dorsal up. Scale bar, 25 μm. (E) Quantification showing that map3k1 RNAi animals have a similar albeit slightly higher total number of ovo + cells (smedwi-1+ and smedwi-1−) in the tail compared to control RNAi animals (p = 0.043; permutation test, 10,000 permutations; two-tailed); for comparison, ovo+; smedwi-1+ cells from Figure 1F are shown, which were not significantly different in the tail (p = 0.181; permutation test, 10,000 permutations; two-tailed – see Figure 1F). Three-week RNAi animals were used for counts.
Figure 2 with 1 supplement
map3k1 RNAi results in ectopic posterior differentiation of some neurons and gland cells.
(A) map3k1 RNAi animals exhibit posterior, ectopic brain branches that project dorsolaterally from ventral nerve cords (5 weeks of RNAi). These branches contain chat+ and pc2+ neurons. Photoreceptor axons (visualized with an anti-Arrestin antibody) extend along the ventral nerve cords and into ectopic brain branches. See also Figure 2—figure supplement 1A. Ventral up. Scale bar, 100 μm. (B) Fluorescent in situ hybridization (FISH) showing gluR+ (dd_16476+) neurons in ectopic brain branches after 3 weeks of map3k1 RNAi. Scale bars, 200 μm; higher magnification scale bar, 100 μm. (A, B) Ventral up. (C) FISH images showing no change in cintillo+ neuron distribution in the head, but expansion of dd_17258+ neurons along the entire AP axis after 3 weeks of map3k1 RNAi. See also Figure 2—figure supplement 1B, (C) Ventral up. Scale bars, 200 μm. (D) Graph showing no significant difference in the number of dd_17258+ neurons in the heads (AP_1) of map3k1 and control RNAi animals (p = 0.410; Mann–Whitney test) but a significant difference in the number of ectopic cells observed along the entire AP axis (AP_2 → AP_6: ***p < 0.0006; multiple Mann–Whitney tests). Counted animals underwent 3–4 weeks of RNAi; two replicates were used. No ectopic cintillo+ neurons were observed for both control and map3k1 RNAi animals. (E) FISH images of unaffected (dd_9223) and affected (dd_7131 and dd_8476) parenchymal cell types in map3k1 RNAi animals (3 weeks of RNAi). Ventral up. Scale bar, 200 μm. Right graph shows more dd_7131+ (p < 0.0001; negative binomial regression) and dd_8476+ (p < 0.0001; negative binomial regression) cells in the tails of map3k1 RNAi animals compared to control RNAi animals. Counted animals underwent 3–4 weeks of RNAi; three replicates each. Bottom left numbers indicate the number of animals with the result displayed in the image out of the total number of animals observed.
Figure 2—figure supplement 1
map3k1 RNAi results in posterior differentiation of some neural cell types.
(A) Left panels: fluorescent in situ hybridization (FISH) images of the trunk regions of RNAi animals showing, in the case of map3k1 RNAi, photoreceptor neuron (PRN, anti-Arrestin) projections along ventral nerve cord (VNC) and into ectopic brain branches (white arrows) labeled by DAPI and an RNA probe to the pan-neural marker, pc2. Five weeks of RNAi. Scale bar, 100 μm. Ventral up. Right panels: top row shows dorsolateral projections composed of chat+ cells in the tail region of a map3k1 RNAi (4 weeks RNAi) animal (n = 10/12). Bottom row shows PRN projections (anti-Arrestin) within the VNC in the tail of a map3k1 RNAi (5 weeks) animal (n = 5/12). (B) Top row FISH shows an example of brain branches (chat+, white and pink arrows) in the tail of a map3k1 RNAi animal (4 weeks RNAi). Bottom row FISH shows an example of PRN projections running along the VNC in the tail of a map3k1 RNAi animal (5 weeks RNAi). Ventral up. Scale bars, 100 μm. (C) FISH showing map3k1 RNAi animals (3 weeks RNAi) do not exhibit expansion of ventral gad+ brain neurons, a stark contrast to ectopic dd_17258+ cell differentiation along the entire AP axis (n = 12/12). Images of dd_17258+ neurons are full body perspectives of Figure 2C animals. Dorsal up. Scale bars, 200 μm. (D) FISH example of an animal with ectopic (arrows) optic cup (OC) cells (RNA probe pool to catalase1, tyrosinase, and glut3), photoreceptors (labeled with an anti-Arrestin antibody), and dd_17258+ neurons extending down the AP axis. Five weeks of RNAi. Dorsal up. Full body image scale bar, 200 μm; all other panels scale bars, 100 μm.
Figure 3 with 1 supplement
map3k1 RNAi results in pharynx cell types in ectopic anterior locations.
(A) Fluorescent in situ hybridization (FISH) images of control and map3k1 RNAi animals showing anterior expansion and dispersal of vitrin+ (pharynx) single cells (white arrows) and clusters of cells (pink arrows and boxes) at variable positions along the AP and ML axes at 3 weeks (n = 20/20; two replicates) and 4 weeks (n = 12/12; one replicate) of RNAi, between the cephalic ganglia (1), near the ventral nerve cords (2), and lateral to the pharynx (lower right panel). Scale bars, 200 μm; magnified images scale bars, 20 μm. Control animals, 3 weeks of RNAi. (B) Left panels: FISH images showing anterior clusters of mhc-1+ (pharynx muscle) cells (pink arrows) in map3k1 RNAi animals. The middle panel shows ectopic mhc-1+ cells and vitrin+ cells near the brain in map3k1 RNAi animals (n=5/8; 1 replicate, white arrows). Left and middle panels, 3 weeks RNAi. Bottom right panel shows ectopic large clusters of mhc-1+ cells between the cephalic ganglia after 6 weeks of RNAi (n = 6/6; 1 replicate, white arrows). Ventral up. Scale bar, 100 μm. (C) FISH images of map3k1 RNAi animals showing NB.22.1e+ mouth cells anterior to the normal location (pink brackets; 3 weeks RNAi) and dispersed around the pharynx (white arrows; 8 weeks RNAi). Scale bar, 100 μm. (D) FISH images showing clusters of dd_554+ cells (white arrows) (intermediate pharynx progenitor population; Zhu et al., 2015) and single dd_554+ cells dispersed around and anterior to the pharynx (vitrin) in 3-week map3k1 RNAi animals. Counted animals for all panels underwent 3–4 weeks of RNAi; three replicates were used. Ventral up. Scale bar, 200 μm. (E) FISH showing examples of FoxA+; smedwi-1+ cells in the head region of both control and map3k1 RNAi animals (white boxes). Three weeks RNAi, two replicates. See also Figure 3—figure supplement 1E. Scale bars, 200 μm; magnified image scale bars, 10 μm (A–D). All panels, ventral up. Numbers in each panel indicate the number of animals displaying the result shown in the image out of total animals observed.
Figure 3—figure supplement 1
map3k1 RNAi causes ectopic differentiation of pharyngeal cell types.
(A) Example fluorescent in situ hybridization (FISH) image of vitrin+ cells (white arrows) and clusters of cells (pink arrows) anterior to the pharynx and in the ventral nerve cords in a 3-week map3k1 RNAi animal. Ventral up. Scale bar, 100 μm. (B) FISH of a map3k1 RNAi animal with clusters of vitrin+ and mhc-1+ cells in the pre-pharyngeal area, between the cephalic ganglia (chat+). Animals from 6 and 8 weeks of RNAi were used. Ventral up. Scale bar, 200 μm; magnified image scale bar, 50 μm. (C) FISH showing (n = 3/18) map3k1 RNAi animals have an ectopic focus (white arrows) of NB.22.1e+ cells in the tail after 3 weeks of RNAi. Ventral up. Scale bar, 200 μm. (D) FISH image showing anterior clusters (white arrows) of dd_554+ and mhc-1+ cells in map3k1 RNAi animals after 4 and 6 weeks of RNAi. Ventral up. Scale bars, 200 μm. (E) Top graph shows no significant differences (p = 0.356; Poisson regression) in the number of FoxA+; smedwi-1+ cells between the cephalic ganglia in map3k1 RNAi and control animals after 3 weeks of RNAi. The bottom graph shows significantly more (***p < 0.0002; negative binomial regression) FoxA+; smedwi-1− cells between the cephalic ganglia in map3k1 RNAi compared to control animals. (F) Some FoxA+; smedwi-1+ cells can be observed in the head of map3k1 RNAi animals after 8 weeks of RNAi. Ventral up. Scale bar, 50 μm. Numbers in each panel indicate number of animals displaying the result shown in the image out of total animals observed.
Figure 4 with 1 supplement
map3k1 RNAi animals display tissue-specific regeneration at target zones.
(A) Top schematic depicts eye resection experimental design. Live images of control and map3k1 RNAi animals prior to (d0; left column) and the day after (d1; middle column) eye resection. The right column shows live and fluorescent in situ hybridization (FISH) images of control and map3k1 RNAi animals 10 days following eye resection. Photoreceptor neurons (PRNs) are visualized with anti-Arrestin (PRN cell bodies and projections) and an RNA probe to opsin (PRN cell bodies). Optic cup cells are visualized using a pool of catalase1/tyrosinase/glut3 RNA probes. Three weeks of RNAi was performed prior to resections; FISH and live images are from different animals. Dorsal, up. Scale bars, 200 μm. See Figure 4—figure supplement 1A for d0 FISH. (B) Diagram of pharynx resection on the left. Live images at d1 and d10 after pharynx resection showing pharynx regeneration in the correct location for both map3k1 RNAi and control animals. Pharynx regeneration in map3k1 RNAi animals is disorganized; FISH contains RNA probes to vitrin (pharynx-specific), NB.22.1e (mouth and esophagus), and mhc-1 (pharynx muscle). See also Figure 4—figure supplement 1B for d0 FISH. Ventral up. Live images, scale bars, 200 μm; FISH images, scale bars, 100 μm. (C) Live image of d10 head, trunk, and regenerating tail fragments. map3k1 RNAi tail fragments regenerate pharynges (white arrow) in a more anterior location compared to control animals. (C, D) Three weeks of RNAi was performed prior to resection. Scale bar, 100 μm. (D) FISH images showing anterior vitrin+ pharynx cells (white arrows) and NB.22.1e+ mouth cells (white brackets) in map3k1 RNAi day 10 trunk regenerates. All map3k1 RNAi trunks and tails fully regenerate eyes (anti-Arrestin). Day 10 tails regenerate pharynges in a more anterior location compared to control animals. Ventral up. Scale bar, 200 μm. (E) Top graph shows no difference in the AP location of original pharynges in control and map3k1 RNAi d10 trunk regenerates (p = 0.1054; Welch’s t-test) but a significant difference between control original pharynges and ectopic pharyngeal cell clusters map3k1 RNAi trunks (****p < 0.0001; Mann–Whitney test). The bottom graph shows an anterior shift in pharynx regeneration in map3k1 RNAi tail fragments compared to control animals (p < 0.0001; Welch’s t-test). Numbers in each panel indicate number of animals displaying the result shown in the image out of total animals observed.
Figure 4—figure supplement 1
map3k1 RNAi animals undergo tissue-specific and whole-body regeneration, with some errors in pharynx regeneration.
(A) Fluorescent in situ hybridization (FISH) following eye resection at day 0 (d0) with the markers for optic cup (OC) (catalase1, tyrosinase, glut3 probe pool) and photoreceptor neurons (PRNs, opsin RNA probe, anti-Arrestin). Three weeks of RNAi prior to resection. Scale bars, 200 μm. Dorsal up. (B) FISH following pharynx resection at day 0 (d0) with the markers for vitrin (pharynx-specific), NB.22.1e (mouth and esophagus), and mhc-1 (pharynx muscle). Three weeks of RNAi prior to resection. Scale bars, 200 μm. (C) FISH example of map3k1 RNAi animal 10 days following pharynx resection. Dorsal (left) and ventral (right) views of a disorganized pharynx regenerating in a map3k1 RNAi animal. (D) FISH of a map3k1 RNAi head 10 days post-amputation showing a disorganized pharyngeal structure labeled with vitrin and NB.22.1e RNA probes. Three weeks of RNAi prior to amputation. Scale bars, 200 μm. Ventral up. Numbers in each panel indicate number of animals displaying the result shown in the image out of total animals observed.
Figure 5 with 2 supplements
Positional information remains largely unaffected in map3k1 RNAi animals.
(A) Fluorescent in situ hybridization (FISH) panel of position control gene (PCG) expression (sFRP-1, ndl-4, ndl-5, ndl-2, ndl-3, wntP-2, axinB, sp5, ptk7, wnt11-1, and slit) shows no obvious changes to expression domains in map3k1 RNAi animals. Animals from 3 and 4 weeks of RNAi were used. Pink arrowheads mark the end of PCG expression domains. Scale bars, 200 μm. Ventral up. (B) FISH example showing some dispersion of notum+; chat+ cells in the brain of a map3k1 RNAi animal after 3 weeks of RNAi (sample numbers from 3 and 4 weeks of RNAi). No obvious changes in wnt1+ posterior pole organization were observed after 2 and 3 weeks of RNAi (example FISH, 2 weeks RNAi). Scale bars, 200 μm. Ventral up. (C) Top row panels show example FISH images of opsin+ (photoreceptor neurons, PRNs), dd_17258+ (neuron type), and vitrin+ (pharynx) cells outside of typical PCG expression domains (ndl-5, ndl-5, and wntP-2, respectively). Bottom row panels show example FISH images of opsin+, dd_17258+, and vitrin+ cells inside PCG expression domains they normally are not found in (wntP-2, wnt11-1, and ndl-5/ndl-2, respectively). Far right panels on top and bottom, ventral up. All other panels, dorsal up. Animals from 3 and 4 weeks of RNAi were used. Scale bars, 200 μm. Numbers in each panel indicate number of animals displaying the result shown in the image out of total animals observed.
Figure 5—figure supplement 1
map3k1 RNAi tail fragments can regenerate the anterior pole but regenerate their new pharynx at a more anterior location.
(A) Quantification showing no significant difference in pole notum cells (notum+; chat−) (p = 0.988; Student’s t-test) or brain notum cells (notum+; chat+) (p = 0.027; unpaired Student’s t-test) in map3k1 RNAi animals compared to control animals. Animals fixed between 3 and 4 weeks of RNAi. (B) Fluorescent in situ hybridization (FISH) showing notum distribution in tail fragment at d4, d7, and d10 of regeneration. (C) FISH showing wnt1, wntP-2, ndl-4, and ndl-2 expression in d4 tail regenerates. Ventral up. Scale bars, 100 μm. (D) FISH showing pharynges regenerating inside of the ndl-5 expression region and outside of the wntP-2 expression region in d10 map3k1 RNAi tail regenerates. White arrows point to the top of the pharynx. Scale bar, 100 μm. Ventral up. (B–D) Three weeks of RNAi occurred prior to amputations. Sample numbers are indicated in each panel.
Figure 5—figure supplement 2
map3k1 is expressed in neoblasts and post-mitotic progenitors.
(A) map3k1 is expressed broadly across neoblast clusters. (B) map3k1 is expressed broadly across post-mitotic progenitors. (C) map3k1 is expressed in some six-1/2-1+ neoblasts, which contain eye neoblasts. (D) map3k1 is expressed in some G0 post-mitotic eye progenitors (Neural 7 G0). (E) map3k1 is expressed within the predicted progenitor cluster (Neural 1) of the affected cell types: dd_17258 and dd_16476. (F) dd_17258 mature marker expression within the predicted corresponding progenitor cluster (Neural 1 G0). (G) dd_16476 mature marker expression within the predicted corresponding progenitor cluster (Neural 1 G0). (H) map3k1 expression in neural, parenchymal, pharyngeal, and six1/2-1+ neoblast clusters. (I) map3k1 expression in neural, parenchymal, and pharyngeal post-mitotic progenitor clusters. (A–I) All plot points are ordered.
Figure 6 with 1 supplement
map3k1 RNAi eye progenitors prematurely differentiate along a normal migratory path.
(A) Schematic of head-shielded irradiation experimental design. Animals were fixed 12–14 days following the first map3k1 RNAi feeding (2 days after irradiation), depending on health by inspection. The right graph shows ectopic differentiation events were more likely to occur in the anterior half of the animal (surviving neoblast region; marked by a smedwi-1+ RNA probe) versus outside of (distal or proximal to) the neoblast region for both opsin+ and dd_17258+ neurons (p < 0.0001; binomial exact test). All observed ectopic photoreceptor neurons (PRNs, opsin) and dd_17258+ neurons outside of the neoblast region were present proximal to (within 50 μm) the neoblast region. Bottom fluorescent in situ hybridization (FISH) panels depict examples of ectopic PRN (anti-Arrestin) and dd_17258+ neuron differentiation events within the neoblast region. Scale bar, 200 μm; magnified boxes 1–4, scale bars, 50 μm. (B) Schematic of tail-shielded irradiation experimental design. Animals were fixed 10–12 days following the first map3k1 RNAi feeding (2 days after irradiation), depending on health by inspection. The right graph shows ectopic events were more likely to occur in the tail (area of surviving neoblasts) versus outside of (distal or proximal to) the neoblast region for dd_17258+ neurons (p < 0.0001; binomial exact test). All observed ectopic PRNs dd_17258+ neurons outside of the neoblast region were present proximal to (within 50 μm) the neoblast region. FISH panels depict examples (white arrows) of ectopic PRNs (opsin) and dd_17258+neurons in the tail of a tail-shielded, irradiated map3k1 RNAi animal. Scale bars, 200 μm; magnified boxes 1–5, scale bars, 50 μm. (C) Schematic of EdU-labeled graft transplant experimental design; bottom graph shows a significant number of total ectopic eye cells (****p < 0.0001; Mann–Whitney test) and ectopic EdU-positive eye cells (**p = 0.002; Mann–Whitney test) in recipient wild-type animals compared to control. Animals after 2 and 3 weeks of RNAi prior to the EdU pulse were used for transplantation. (D) FISH example of EdU-positive ectopic eye cells (white arrows) differentiated in wild-type animals (n = 13/20) with EdU-positive ectopic cells; n = 19/20 exhibited any ectopic eye cells outside of the transplant area. Scale bars, 200 μm; zoom in scale bars, 20 μm. (A–D) All panels are dorsal up. Numbers in each panel indicate the number of animals displaying the result shown in the image out of total animals observed.
Figure 6—figure supplement 1
map3k1 RNAi animals display ectopic differentiation of local neoblasts.
(A) Fluorescent in situ hybridization (FISH) examples of head- and tail-shielded irradiated animals that were fed control dsRNA showed no ectopic photoreceptors (opsin) or dd_17258+ neurons in the head or tail region in either condition. See Figure 6A, B for experiment details. Scale bars, 200 μm. Dorsal up. Yellow intestinal background signal is noted. smedwi-1 labeling in a zone between the eyes and the pharynx is weak; this region frequently shows poor probe labeling across experiments, presumably associated with mucus production. (B) An additional FISH example of a head-shielded, irradiated animal with ectopic eye cells (pool of RNA probes for opsin, catalase1, tyrosinase, and glut3) and dd_17258+ neurons (white arrows for both ectopic cell types) in the region corresponding to live neoblasts (smedwi-1). Scale bars, 200 μm; magnified images 1–3, scale bars, 50 μm. Dorsal up. (C) FISH examples of EdU-positive ectopic eye cells (white arrows) in wild-type recipient animals that received a plug from an EdU-soaked map3k1 RNAi animal. Scale bars, 20 μm. Dorsal up. Two examples of EdU-labeled ectopic photoreceptors (anti-Arrestin) outside of the eye and one example of an optic cup (OC) cell (catalase1/tyrosinase/glut3 RNA probe pool) in the wrong place within the eye of a map3k1 RNAi-plug recipient animal. (D) FISH image of EdU-negative ectopic eye cells (white arrows) in wild-type recipient animals that received a plug from an EdU-soaked map3k1 RNAi animal. Scale bar, 200 μm; panel 1, scale bar, 10 μm; upper right panel, scale bar, 50 μm. Dorsal up. (C, D) Donors were fed between 2 and 3 weeks of dsRNA prior to transplantation. Numbers in each panel indicate the number of animals displaying the result shown in the image out of total animals observed.
Figure 7 with 1 supplement
map3k1 RNAi results in progenitor differentiation in incorrect organs and teratoma formation.
(A) Fluorescent in situ hybridization (FISH) showing clusters of mhc-1+ cells within the lobes of the brain and ventral nerve cords, and NB.22.1e+ cells (epidermis, mouth) present within the eye after 8 weeks of map3k1 RNAi. Brain, ventral up; eye, dorsal up. Scale bars, 100 μm. (B) FISH examples of vitrin+ (pharynx) cells present within eyes (anti-Arrestin) at day 10 tail regeneration, following 3 weeks of map3k1 RNAi. See also Figure 7—figure supplement 1B. Dorsal up. Scale bars, 200 μm; scale bars for magnified eye images, 50 μm. (C) Left panels: live images of small growths in animals at 12 weeks of map3k1 RNAi feedings, accompanied by DAPI images of similarly positioned growths. Right panels: live images of advanced teratomas (pink arrows) in animals at 12 weeks of map3k1 RNAi, accompanied by a FISH example showing photoreceptors (opsin and anti-Arrestin) and optic cup (OC) cells (tyrosinase, catalase1, glut3) scattered in and around the teratomas. Bottom left animal, 8 weeks RNAi. (C, D) Scale bars, 200 μm. Dorsal up. (D) Left panels: FISH images showing chat+, mhc-1+, and NB.22.1e+ cells are common in teratomas, often excluding vitrin+ (pharynx) and mag-1+ (gland cells). Scale bars, 100 μm; panels 1–4, scale bars, 50 μm. Right panels show examples of other cell types commonly found in outgrowths: cintillo+ (neuron), dd_17258+ (neuron), dd_3534+ (neuron), estrella+ (glia), anti-Arrestin+ (photoreceptors), NB.22.1e+, lamin+ (mouth and epidermis), and colF-2+ (muscle). Six to eight weeks of RNAi. Scale bars, 100 μm. Dorsal up. Numbers in each panel indicate number of animals displaying the result shown in the image out of total animals observed.
Figure 7—figure supplement 1
map3k1 RNAi animals display ectopic teratoma-like growths.
(A) Fluorescent in situ hybridization (FISH) showing a zoomed-out view of the ectopic mhc-1 cells (white arrows) in the brain and ventral nerve cords of a map3k1 RNAi animal (8 weeks RNAi) from Figure 7A. Scale bars, 200 μm. Ventral up. (B) Day 10 map3k1 RNAi tail regenerate from Figure 7B with separated channels to show the ectopic vitrin+ cell in the eye is not positive for the photoreceptor marker, Arrestin. Three weeks of RNAi occurred prior to fixation. Scale bar, 200 μm. Zoom in scale bars, 50 μm. Dorsal, up. (C) Live image examples of teratomas after 8 weeks of map3k1 RNAi. Scale bar, 200 μm. Dorsal, up. (D) FISH images showing a broader region of the animal in Figure 7D, and control RNAi; the map3k1 RNAi animal shows chat+; mhc-1+ outgrowths. Animals were fed dsRNA for 6–8 weeks prior to fixation. Scale bar, 200 μm; Dorsal, up.
Figure 8
Model: Map3K1 restricts migratory progenitor differentiation until the correct target is reached.
(A) Schematic showing the inhibition of differentiation of a migratory progenitor cell, via map3k1, until reaching its target tissue at the target zone. (B) Migratory precursors can differentiate in the incorrect position control gene (PCG) expression locations following map3k1 RNAi. (C) Patterning abnormalities that can occur without suitable restriction of differentiation in migratory progenitors, demonstrating the patterning properties yielded by this mechanism.
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Gene (S. mediterranea) | map3k1 | planmine database | dd_Smed_v6_5198_0_1 | https://planmine.mpinat.mpg.de/planmine/begin.do |
| Gene (S. mediterranea) | opsin | planmine database | dd_Smed_v6_15036_0_1 | https://planmine.mpinat.mpg.de/planmine/begin.do |
| Gene (S. mediterranea) | catalase1 | planmine database | dd_Smed_v6_20433_0_1; dd_Smed_v6_32853_0_1 | https://planmine.mpinat.mpg.de/planmine/begin.do |
| Gene (S. mediterranea) | glut3 | planmine database | dd_Smed_v6_79867_0_1 | https://planmine.mpinat.mpg.de/planmine/begin.do |
| Gene (S. mediterranea) | tyrosinase | planmine database | dd_Smed_v6_34399_0_1 | https://planmine.mpinat.mpg.de/planmine/begin.do |
| Gene (S. mediterranea) | ovo | planmine database | dd_Smed_v6_48430_0_1, dd_Smed_v6_10673_0_1 | https://planmine.mpinat.mpg.de/planmine/begin.do |
| Gene (S. mediterranea) | gluR | planmine database | dd_Smed_v6_16476_0_1 | https://planmine.mpinat.mpg.de/planmine/begin.do |
| Gene (S. mediterranea) | dd_17258 | planmine database | dd_Smed_v6_17258_0_1 | https://planmine.mpinat.mpg.de/planmine/begin.do |
| Gene (S. mediterranea) | NB.22.1e | planmine database | dd_Smed_v6_680_0_1 | https://planmine.mpinat.mpg.de/planmine/begin.do |
| Gene (S. mediterranea) | vitrin | planmine database | dd_Smed_v6_1071_0_1 | https://planmine.mpinat.mpg.de/planmine/begin.do |
| Gene (S. mediterranea) | mhc-1 | planmine database | dd_Smed_v6_249_0_1 | https://planmine.mpinat.mpg.de/planmine/begin.do |
| Gene (S. mediterranea) | foxA | planmine database | dd_Smed_v6_10718_0_1; clone Smed_02872_V2 | https://planmine.mpinat.mpg.de/planmine/begin.do |
| Gene (S. mediterranea) | smedwi-1 | planmine database | dd_Smed_v6_659_0_1 | https://planmine.mpinat.mpg.de/planmine/begin.do |
| Gene (S. mediterranea) | dd_8476 | planmine database | dd_Smed_v6_8476_0_1 | https://planmine.mpinat.mpg.de/planmine/begin.do |
| Gene (S. mediterranea) | dd_7131 | planmine database | dd_Smed_v6_7131_0_1 | https://planmine.mpinat.mpg.de/planmine/begin.do |
| Gene (S. mediterranea) | dd_9223 | planmine database | dd_Smed_v6_9223_0_1 | https://planmine.mpinat.mpg.de/planmine/begin.do |
| Gene (S. mediterranea) | gad | planmine database | dd_Smed_v6_12653_0_1 | https://planmine.mpinat.mpg.de/planmine/begin.do |
| Gene (S. mediterranea) | slit | planmine database | dd_Smed_v6_12111_0_1 | https://planmine.mpinat.mpg.de/planmine/begin.do |
| Gene (S. mediterranea) | cintillo | planmine database | dd_Smes_g4_102 | https://planmine.mpinat.mpg.de/planmine/begin.do |
| Gene (S. mediterranea) | notum | planmine database | dd_Smed_v4_24180_0_1 | https://planmine.mpinat.mpg.de/planmine/begin.do |
| Gene (S. mediterranea) | chat | planmine database | dd_Smed_v6_6208_0_1 | https://planmine.mpinat.mpg.de/planmine/begin.do |
| Gene (S. mediterranea) | pc2 | planmine database | dd_Smed_v6_1566_0_1 | https://planmine.mpinat.mpg.de/planmine/begin.do |
| Gene (S. mediterranea) | ndl-2 | planmine database | dd_Smed_v4_8340_0_1 | https://planmine.mpinat.mpg.de/planmine/begin.do |
| Gene (S. mediterranea) | ndl-3 | planmine database | dd_Smed_v4_6604_0_1 | https://planmine.mpinat.mpg.de/planmine/begin.do |
| Gene (S. mediterranea) | ndl-5 | planmine database | dd_Smed_v4_5102_0_1 | https://planmine.mpinat.mpg.de/planmine/begin.do |
| Gene (S. mediterranea) | sfrp1 | planmine database | dd_Smed_v4_13985_0_1 | https://planmine.mpinat.mpg.de/planmine/begin.do |
| Gene (S. mediterranea) | wnt11-1 | planmine database | dd_Smed_v4_14391_0_1 | https://planmine.mpinat.mpg.de/planmine/begin.do |
| Gene (S. mediterranea) | wnt-1 | planmine database | dd_Smed_v4_28398_0_1 | https://planmine.mpinat.mpg.de/planmine/begin.do |
| Gene (S. mediterranea) | wntP-2 | planmine database | dd_Smed_v4_7326_0_1 | https://planmine.mpinat.mpg.de/planmine/begin.do |
| Gene (S. mediterranea) | ptk7 | planmine database | dd_Smed_v4_6999_0_1 | https://planmine.mpinat.mpg.de/planmine/begin.do |
| Gene (S. mediterranea) | sp5 | planmine database | dd_Smed_v4_7824_0_1 | https://planmine.mpinat.mpg.de/planmine/begin.do |
| Gene (S. mediterranea) | axin-B | planmine database | dd_Smed_v4_5531_0_1 | https://planmine.mpinat.mpg.de/planmine/begin.do |
| Gene (S. mediterranea) | prep | planmine database | dd_Smed_v4_8606_0_1 | https://planmine.mpinat.mpg.de/planmine/begin.do |
| Gene (S. mediterranea) | colF2 | planmine database | dd_Smed_v6_702_0_1 | https://planmine.mpinat.mpg.de/planmine/begin.do |
| Gene (S. mediterranea) | mag1 (H.1.3b) | planmine database | dd_Smed_v6_769_0_1 | https://planmine.mpinat.mpg.de/planmine/begin.do |
| Gene (S. mediterranea) | estrella | planmine database | dd_Smed_v6_1792_0_1 | https://planmine.mpinat.mpg.de/planmine/begin.do |
| Gene (C. elegans) | unc-22 | WormBase | WBGene00006759 | |
| Strain, strain background | Escherichia coli DH5α – CGSC strain | E. coli Genetic Stock Center (CGSC), Yale University | CGSC #7750; RRID:SCR_002950 | Obtained in commercial kit Cat # NEBC2987H |
| Strain, strain background | Asexual S. mediterranea strain CIW4 | Laboratory of Alejandro Sánchez Alvarado, Stowers Institute | RRID:NCBITaxon:79327 | Clonal strain propagated in this lab from single animal |
| Antibody | TSA Plus DNP (HRP) System (signal amplification/detection kit) (Sheep polyclonal) | Akoya Biosciences | Cat # NEL747A001KT | 1:100 |
| Antibody | Anti-Fluorescein-POD, Fab fragments (Sheep polyclonal) | Roche (11426346910) | RRID:AB_840257 | 1:1500 |
| Antibody | anti-DIG-POD (Sheep polyclonal) | Roche (11207733910) | RRID:AB_514500 | 1:2000 |
| Antibody | Arrestin (VC-1) (Mouse monoclonal) | From the lab of Kiyokazu Agata | 1:7500 | |
| Sequence-based reagent | PWR.AA2 | GGGCGAATTGGGTACCGGG | 5′ primer (5′–3′) | |
| Sequence-based reagent | CP.D.47 | GAAGTAATACGACTCACTATAGGGAGAAAGCTGGAGCTCCACCGCGG | 3′ primer with T7 promotor region (5′–3′) | |
| Sequence-based reagent | CP.C.21 | GAAGTAATACGACTCACT ATAGGGAGAGGGCGA ATT GGGTACCGGG | 5′ primer with T7 promotor (5′–3′) | |
| Sequence-based reagent | CP.C.22 | AAGCTGGAGCTCCACCGCGG | 3′ primer (5′–3′) | |
| Sequence-based reagent | DNP-11-UTP | PerkinElmer | Cat # NEL555001EA | |
| Sequence-based reagent | DIG RNA Labeling Mix (10X) | Roche/Sigma-Aldrich | Cat # 11277073910 | |
| Sequence-based reagent | Fluorescein RNA Labeling Mix | Roche/Sigma-Aldrich | Cat # 11685619910 | |
| Sequence-based reagent | pGEM-T Easy backbone | Promega | RRID:Addgene_122563 | |
| Commercial assay or kit | Superscript III | Invitrogen | Cat # 12574026 | Generating cDNA library |
| Commercial assay or kit | NEB 5-alpha Competent E. coli (High Efficiency) | New England Biolabs | Cat # NEBC2987H | |
| Commercial assay or kit | pGEM-T Easy Vector Systems | Promega | Cat # A1360/A1380 | |
| Commercial assay or kit | Riboprobe System Components and Buffers | Promega | Cat # P1121 | |
| Commercial assay or kit | T7 RNA polymerase | Promega | Cat # P2075 | |
| Chemical compound, drug | F-ara-EdU/ 2′-Deoxy-2′-fluoro-5-ethynyluridine | Click Chemistry Tools | Cat # SKU: CCT-1403-500 | |
| Chemical compound, drug | TAMRA-Azide-fluor 545 | Sigma-Aldrich | Cat # SKU: 760757-1MG | |
| Software, algorithm | GraphPad prism 9 | GraphPad Software, San Diego, CA, USA | RRID:SCR_002798 | |
| Software, algorithm | R studio | RStudio, PBC, Boston, MA, USA | RRID:SCR_000432 |
Additional files
Download links
A two-part list of links to download the article, or parts of the article, in various formats.
Downloads (link to download the article as PDF)
Open citations (links to open the citations from this article in various online reference manager services)
Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)
map3k1 is required for spatial restriction of progenitor differentiation in planarians
eLife 14:RP106439.
https://doi.org/10.7554/eLife.106439.3
