The oocyte zinc transporter Slc39a10/Zip10 is a regulator of zinc sparks during fertilization in mice
- Laboratory of Animal Reproduction, School of Veterinary Medicine, Azabu University, Japan
- Bioresource Engineering Division, Bioresource Research Center, RIKEN, Japan
- Department of Animal Science, Graduate School of Environmental and Life Science, Okayama University, Japan
- Laboratory of Reproductive Systems Biology, Center for Experimental Medicine and Systems Biology, The Institute of Medical Science, The University of Tokyo, Japan
- Department of Molecular Pathology, Graduate School of Medicine, The University of Tokyo, Japan
- Laboratory of Molecular and Cellular Physiology, Faculty of Pharmaceutical Sciences, Tokushima Bunri University, Japan
- Department of Veterinary and Animal Sciences, University of Massachusetts Amherst, United States
- Graduate School of Veterinary Science, Azabu University, Japan
- Center for Human and Animal Symbiosis Science, Azabu University, Japan
Figures
Figure 1
Expression of ZIP6 and ZIP10 in mouse ovary.
(A) In situ hybridization in the mouse ovary showed ZIP10 expression in oocyte and granulosa cell from primordial, primary, secondary, and antral follicle. Arrow indicates primordial follicular oocyte. (B) Immunofluorescent staining for ZIP10 (green) in the mouse ovary showed ZIP10 expression in oocyte membrane. Arrow indicates primordial follicular oocyte. (C) Immunofluorescent staining for ZIP6 (green) in the mouse ovary showed ZIP6 expression in oocyte nucleus and granulosa cells. Arrow indicates primordial follicular oocyte. (D) Immunofluorescent staining showed ZP2 (green; zona pellucida) and FOXL2 (red; granulosa cells) in the mouse ovary. It was observed that ZP2 was not present in the primordial follicle; however, it was present in the primary, secondary, and antral follicles. Furthermore, FOXL2 was observed at granulosa cells of all stage follicles. Scale bar: 20 µm (primordial, primary, and secondary follicle); 150 µm (antral follicle) (A–D).
Figure 2 with 2 supplements
Number of collected oocytes and dynamics of labile zinc ion in Slc39a10 cKO mice.
(A) The results of average number of oocytes in each group. Data represents the average ± SEM. These experiments were repeated at least thrice. Statistical differences were calculated according to Student’s t-test (p>0.05; no significant difference). (B) The percentage of extrusion of first polar body at 10, 12, and 14 hr after in vitro maturation (IVM). These experiments were repeated at least thrice. Statistical differences were calculated according to Student’s t-test (p>0.05; no significant difference). (C) The morphology of spindle and chromosome organization in Slc39a10f/f and Slc39a10 cKO metaphase II (MII) oocytes at 14 hr after IVM. Anti-α-tubulin antibody (green) was used to stain the spindles. Chromosomes were stained with DAPI (blue). The scale bar represents 10 μm. (D) Comparison with the fluorescence intensity of intracellular labile zinc ion in germinal vesicle (GV), MII, and two pronuclei (2PN). The upper images showed the fluorescence of intracellular labile zinc ion of oocyte or embryo treated with 2 µM FluoZin-3AM for 1 hr. Representative images are shown. The white dotted circles indicate the positions of oocytes and embryos. Scale bars denote 10 μm. The lower part showed the fluorescence intensity of labile zinc ions in oocytes or embryos. Data represent the average ± SE of the experiments. For each experiment, 10–20 oocytes/embryo were stained and used for the measurement in each stage of the experiment, and these experiments were repeated three times. Statistical differences were calculated according to the Welch’s t-test. Different letters represent significant differences (p<0.05).
Figure 2—figure supplement 1
Generation of oocyte-specific Slc39a6 and Slc39a10 conditional knockout mouse.
(A) Schematic of mating pattern of Slc39a6 and Slc39a10 conditional knockout mice. (B) Strategy used to develop floxed Slc39a6 and Slc39a10 allele. The mouse ZIP6 locus is shown at top. A loxP site (black triangle) sequence insert into a region before and after exon 3 of Slc39a6 to produce the Slc39a6 floxed allele with loxP sites flanking exon 3. In the presence of Cre recombinase, there is further recombination resulting in the inactivated Slc39a6 allele lacking exon 3 (Slc39a6 △flox). The mouse ZIP10 locus is shown at top. A loxP site (black triangle) sequence insert into a region between exons 5 and 6, and a loxP site sequence between exons 8 and 9 of Slc39a10 to produce the Slc39a10 floxed allele with loxP sites flanking exons 6–8. In the presence of Cre recombinase, there is further recombination resulting in the inactivated Slc39a10 allele lacking exons 6–8 (Slc39a10 △flox). (C) Genotyping of flox, △flox, and iCre was performed by genomic polymerase chain reaction (PCR). To elucidate the roles of ZIP10 in the mouse oocytes, we crossed Slc39a10flox/flox (Slc39a10f/f) mice with growth differentiation factor 9 (Gdf9)-Cre transgenic mice to generate Slc39a10flox/flox Gdf9-Cre (Slc39a10 cKO) mice. Slc39a10f/f mice were used as control. Similarly, we crossed Slc39a6flox/flox (Zip6f/f) mice with Gdf9-Cre transgenic mice to generate Slc39a6flox/flox Gdf9-Cre (Slc39a6 cKO) mice. Slc39a6f/f mice were used as a control. The tail tips of 2-week-old mice were cut. The samples were lysed in 100 µl of DirectPCR Lysis Reagent (Viagen Biotech) with proteinase K (0.1 mg/ml) at 50°C overnight. To inactivate proteinase K, the samples were incubated at over 80°C for 1 hr. The genotypes confirmed by PCR, as suggested by Miyai et al., 2014, and RIKEN BRC using CAAGGCCAGCCAAAATTCTA (A-F) and GCTTTCCTCCCATCCTGATT (A-R) to detect wild-type (292 bp) and Slc39a10 flox (420 bp), A-F and GTGGCATGCGTGGAAGTTAG (B-R) to detect Slc39a10 flox null (550 bp) alleles. The genotyping of Slc39a6 flox was confirmed using CCAGCATTGCCCTCTGTAAGAGTC (Slc39a6_F) and GCCTAAAGAAGATACACTGACACGACG (Slc39a6_R) to detect wild-type (353 bp) and Slc39a6 flox (387 bp), GGACCGGTTGCATAGAGGAG (Slc39a6_Null_F) and GAGGCAGGCGGATTTCTGAG (Slc39a6_Null_R) to detect Slc39a6 flox null (500 bp) alleles. Similarly, we detected Gdf9 iCre/+ alleles (200 bp) using CAGGTTTTGGTGCACAGTCA (21218) and GGCATGCTTGAGGTCTGATTAC (25494) to suggest by Jackson Laboratory. Metaphase II (MII) oocytes were used in order to detect oocyte expression. (D) The expected molecular weight for ZIP6 is about 70 kDa and ZIP10 is about 63 kDa. Expression level of β-actin (42 kDa) served as a protein loading control. Molecular mass is indicated at the left.
-
Figure 2—figure supplement 1—source data 1
PDF file containing original gels and western blots for Figure 2—figure supplement 1C and D, indicating the relevant bands and treatments.
- https://cdn.elifesciences.org/articles/106616/elife-106616-fig2-figsupp1-data1-v1.zip
-
Figure 2—figure supplement 1—source data 2
Original files for original gel and western blot analysis displayed in Figure 2—figure supplement 1C and D.
- https://cdn.elifesciences.org/articles/106616/elife-106616-fig2-figsupp1-data2-v1.zip
Figure 2—figure supplement 2
Number of collected oocytes, dynamics of labile zinc ion, and percentage of fertilization in Slc39a6 cKO mice.
(A) The results of average number of oocytes in each group. Data represents the average ± SEM. These experiments were repeated at least thrice. Statistical differences were calculated according to Student’s t-test (p>0.05; no significant difference). (B) Comparison with the fluorescence intensity of intracellular labile zinc ion in metaphase II (MII) and two pronuclei (2PN) treated with 2 µM FluoZin-3AM for 1 hr. Data represent the average ± SE of the experiments. For each experiment, 10–20 oocytes/embryo were stained and used for the measurement in each stage of the experiment, and these experiments were repeated three times. Statistical differences were calculated according to Student’s t-test (p>0.05; no significant difference).
Figure 3 with 5 supplements
Measurement of calcium spike and zinc spark in Slc39a10 cKO mice.
(A) The representative images of calcium spike and zinc spark after in vitro fertilization (IVF) in mouse oocytes. Left side images showed calcium spikes. Right side images showed zinc sparks. The oocytes increased calcium ion and released zinc ion shortly after fertilization. The white dotted circles indicate the positions of oocytes. Successful fertilization was confirmed by simultaneously monitoring intracellular calcium oscillations with Calbryte 590 AM and extracellular zinc ions with FluoZin-3 every 4 s. Capacitated frozen-thawed sperm was added to metaphase II (MII) at 2 min after imaging start. Orange line showed calcium ion, and dark blue line showed zinc ion. Intracellular calcium increases immediately before a zinc spark. Scale bars denote 20 μm. (B) The representative images of an MII egg activated with 5 μM ionomycin followed by monitoring of intracellular calcium oscillations with Calbryte 590 AM and extracellular zinc using 20 μM FluoZin-3. The ionomycin was added to MII at 2 min after imaging start. Orange line showed calcium ion, and dark blue line showed zinc ion. Intracellular calcium increases immediately before a zinc spark. Scale bars denote 20 μm.
Figure 3—figure supplement 1
Measurement of calcium spike and zinc spark in Slc39a6 cKO mice.
The representative images of calcium spike and zinc spark after in vitro fertilization (IVF) in mouse oocytes. Left side images showed calcium spikes. Right side images showed zinc sparks. The oocytes increased calcium ion and released zinc ion shortly after fertilization. The white dotted circles indicate the positions of oocytes. Successful fertilization was confirmed by simultaneously monitoring intracellular calcium oscillations with Calbryte 590 AM and extracellular zinc ions with FluoZin-3 every 4 s. Capacitated frozen-thawed sperm was added to metaphase II (MII) at 2 min after imaging start. Orange line showed calcium ion, and dark blue line showed zinc ion. Intracellular calcium increases immediately before a zinc spark. Scale bars denote 20 μm.
Figure 3—video 1
Monitoring of intracellular calcium ions during fertilization of Slc39a6f/f oocytes.
The changes in Ca2+ were detected by Calbryte 590 AM every 4 s. Slc39a6f/f oocytes displayed the calcium oscillations following fertilization. The changes in zinc ions were also monitored simultaneously (Figure 3—video 2). The video was excerpted from a maximum of 50 min. The scale bar represents 20 μm.
Figure 3—video 2
Monitoring of extracellular zinc ions during fertilization of Slc39a6f/f oocytes.
The changes in Zn2+ were detected by FluoZin-3 every 4 s. Slc39a6f/f oocytes released zinc ions into the extracellular environment through a zinc spark following the first calcium rise following fertilization. The changes in calcium ions were also monitored simultaneously (Figure 3—video 1). The video was excerpted from a maximum of 50 min. The scale bar represents 20 μm.
Figure 3—video 3
Monitoring of intracellular calcium ions during fertilization of Slc39a6 cKO oocytes.
The changes in Ca2+ were detected by Calbryte 590 AM every 4 s. Slc39a6 cKO oocytes displayed the calcium oscillations following fertilization. The changes in zinc ions were also monitored simultaneously (Figure 3—video 4). The video was excerpted from a maximum of 50 min. The scale bar represents 20 μm.
Figure 3—video 4
Monitoring of extracellular zinc ions during fertilization of Slc39a6 cKO oocytes.
The changes in Zn2+ were detected by FluoZin-3 every 4 s. Slc39a6 cKO oocytes released zinc ions into the extracellular environment through a zinc spark following the first calcium rise following fertilization. The changes in calcium ions were also monitored simultaneously (Figure 3—video 3). The video was excerpted from a maximum of 50 min. The scale bar represents 20 μm.
Figure 4 with 2 supplements
Presence of a mechanism to prevent multisperm fertilization in Slc39a10 cKO mice.
(A) The percentages of oocytes with each number of PN at 6 hr after insemination. Yellow region showed others, including degeneration, degression, and fragmentation. Gray region showed unfertilization, namely metaphase II (MII) oocytes. Orange showed 2PN2PB, namely embryo possessed one female and male pronucleous (2PN) and second polar body (2PB). Blue region showed multisperm fertilization (3PN2PB). (B) The percentage of fertilized oocytes and developmental embryos. Data represent the average ± SE of the experiments. The embryo development was observed at 6 (2PN), 24 (2-cell), 48 (4- to 8-cell), 72 (morula), and 96 (blastocyst) hours after IVF. The oocytes used for IVF were calculated as the parameter for the fertilization rate and the rate of embryo development. These experiments were repeated at least thrice. Statistical differences were calculated according to the chi-square test. Different letters represent significant differences (p<0.05). (C) The cell number of blastocyst derived from IVF. Blastocysts were fixed, immunostained, and physically flattened between a slide and coverslip. Photographs represent a single plane of focus. Nuclei are indicated by DAPI staining. The count used an inverted fluorescence microscope. These experiments were repeated three times, and each group counted a total of 46 embryos. Statistical differences were calculated according to the Student’s t-test (p<0.05; significant difference). (D) Western blot of oocytes from Slc39a10f/f and Slc39a10 cKO mice at 0 or 6 hr after insemination using rat anti-ZP2 antibody. Intact ZP2 and the cleaved C-terminal fragment of ZP2 measured 120–130 kD and undetected, respectively. Expression level of β-actin serves as a protein loading control and quantified the expression level of ZP2. Molecular mass is indicated at the left. Statistical differences were calculated according to the one-way ANOVA. Different letters represent significant differences (p<0.05). (E) MII oocytes and 2PN embryos from Slc39a10f/f and Slc39a10 cKO mice were imaged by confocal microscopy after staining with rabbit anti-ovastacin (green). Chromosomes were stained with DAPI (blue). The scale bar represents 10 μm. (F) MII oocytes and 2PN embryos from Slc39a10f/f and Slc39a10 cKO mice were imaged by BZ-X700 microscopy after staining with rat anti-mouse FR4 (JUNO; green). Chromosomes were stained with DAPI (blue). The scale bar represents 10 μm.
-
Figure 4—source data 1
PDF file containing original western blots for Figure 4D, indicating the relevant bands and treatments.
- https://cdn.elifesciences.org/articles/106616/elife-106616-fig4-data1-v1.zip
-
Figure 4—source data 2
Original files for western blot analysis displayed in Figure 4D.
- https://cdn.elifesciences.org/articles/106616/elife-106616-fig4-data2-v1.zip
Figure 4—figure supplement 1
Comparison of JUNO expression in Slc39a10f/f and Slc39a10 cKO mouse metaphase II (MII) oocytes.
To measure JUNO-immunofluorescence intensity, oocyte images were selected as regions of interest (ROIs) and measured using ImageJ. Statistical differences were calculated according to Student’s t-test (p>0.05; no significant difference).
Figure 4—figure supplement 2
Percentage distribution of pronucleous in Slc39a6 cKO mice and the number of fertilized oocytes and developmental embryos.
(A) The percentages of oocytes with each number of PN at 6 hr after insemination. Yellow region showed others, including degeneration, degression, and fragmentation. Gray region showed as unfertilized, namely metaphase II (MII) oocytes. Orange showed 2PN2PB, namely embryo possessed one female and male pronucleous (2PN) and second polar body (2PB). Blue region showed multisperm fertilization (3PN2PB). (B) The percentage of fertilized oocytes and developmental embryos. Data represent the average ± SE of the experiments. These experiments were repeated at least thrice. Statistical differences were calculated according to the chi-square test (p>0.05).
Videos
Video 1
Monitoring of intracellular calcium ions during fertilization of Slc39a10f/f oocytes.
The changes in Ca2+ were detected by Calbryte 590 AM every 4 s. Slc39a10f/f oocytes displayed the calcium oscillations following fertilization. The changes in zinc ions were also monitored simultaneously (Video 2). The video was excerpted from a maximum of 50 min. The scale bar represents 20 μm.
Video 2
Monitoring of extracellular zinc ions during fertilization of Slc39a10f/f oocytes.
The changes in Zn2+ were detected by FluoZin-3 every 4 s. Slc39a10f/f oocytes released zinc ions into the extracellular environment through a zinc spark following the first calcium rise following fertilization. The changes in calcium ions were also monitored simultaneously (Video 1). The video was excerpted from a maximum of 50 min. The scale bar represents 20 μm.
Video 3
Monitoring of intracellular calcium ions during fertilization of Slc39a10 cKO oocytes.
The changes in Ca2+ were detected by Calbryte 590 AM every 4 s. Slc39a10 cKO oocytes displayed the calcium oscillations following fertilization. The changes in zinc ions were also monitored simultaneously (Video 4). The video was excerpted from a maximum of 50 min. The scale bar represents 20 μm.
Video 4
Monitoring of extracellular zinc ions during fertilization of Slc39a10 cKO oocytes.
The changes in Zn2+ were detected by FluoZin-3 every 4 s. Slc39a10 cKO oocytes did not release zinc ions into the extracellular environment following the first calcium rise following fertilization. The changes in calcium ions were also monitored simultaneously (Video 3). The video was excerpted from a maximum of 50 min. The scale bar represents 20 μm.
Video 5
Monitoring of intracellular calcium ions during parthenogenesis of Slc39a10f/f oocytes.
The changes in Ca2+ were detected by Calbryte 590 AM every 4 s. Slc39a10f/f oocytes displayed a transient rise of calcium ions following artificial oocyte activation with ionomycin. The changes in zinc ions were also monitored simultaneously (Video 6). The video was excerpted from a maximum of 50 min. The scale bar represents 20 μm.
Video 6
Monitoring of extracellular zinc ions during parthenogenesis of Slc39a10f/f oocytes.
The changes in Zn2+ were detected by FluoZin-3 every 4 s. Slc39a10f/f oocytes released zinc ions into the extracellular environment through a zinc spark following a transient calcium rise following artificial oocyte activation with ionomycin. The changes in calcium ions were also monitored simultaneously (Video 5). The video was excerpted from a maximum of 50 min. The scale bar represents 20 μm.
Video 7
Monitoring of intracellular calcium ions during parthenogenesis of Slc39a10 cKO oocytes.
The changes in Ca2+ were detected by Calbryte 590 AM every 4 s. Slc39a10 cKO oocytes displayed a transient rise of calcium ions following artificial oocyte activation with ionomycin. The changes in zinc ions were also monitored simultaneously (Video 8). The video was excerpted from a maximum of 50 min. The scale bar represents 20 μm.
Video 8
Monitoring of extracellular zinc ions during parthenogenesis of Slc39a10 cKO oocytes.
The changes in Zn2+ were detected by FluoZin-3 every 4 s. Slc39a10 cKO oocytes did not release zinc ions into the extracellular environment following a transient calcium rise following artificial oocyte activation with ionomycin. The changes in calcium ions were also monitored simultaneously (Video 5). The video was excerpted from a maximum of 50 min. The scale bar represents 20 μm.
Additional files
Download links
A two-part list of links to download the article, or parts of the article, in various formats.
Downloads (link to download the article as PDF)
Open citations (links to open the citations from this article in various online reference manager services)
Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)
The oocyte zinc transporter Slc39a10/Zip10 is a regulator of zinc sparks during fertilization in mice
eLife 14:RP106616.
https://doi.org/10.7554/eLife.106616.4
