Dorsoventral-mediated Shh induction is required for axolotl limb regeneration
eLife Assessment
This fundamental work by Yamamoto and colleagues advances our understanding of how positional information is coordinated between axes during limb outgrowth and patterning. They provide convincing evidence that the dorsal-ventral axis feeds into anterior-posterior signaling, and identify the responsible molecules by combining transplantations with molecular manipulations. This work will be of broad interest to regeneration, tissue engineering, and evolutionary biologists.
https://doi.org/10.7554/eLife.106917.3.sa0Fundamental: Findings that substantially advance our understanding of major research questions
- Landmark
- Fundamental
- Important
- Valuable
- Useful
Convincing: Appropriate and validated methodology in line with current state-of-the-art
- Exceptional
- Compelling
- Convincing
- Solid
- Incomplete
- Inadequate
During the peer-review process the editor and reviewers write an eLife Assessment that summarises the significance of the findings reported in the article (on a scale ranging from landmark to useful) and the strength of the evidence (on a scale ranging from exceptional to inadequate). Learn more about eLife Assessments
Abstract
Axolotls (Ambystoma mexicanum) exhibit a remarkable ability to regenerate limbs. Classical experiments have suggested that contact between cells derived from distinct orientations—dorsal, ventral, anterior, and posterior—within the regenerating blastema is necessary for accurate limb pattern formation. However, the molecular basis for this requirement has remained largely unknown. Here, we demonstrate that both dorsal and ventral tissues are required for limb formation via induction of Shh expression, which plays a crucial role in limb patterning. Using the accessory limb model, we induced position-specific blastemas lacking cells derived from a single orientation (anterior, posterior, dorsal, or ventral). Limb patterning occurred only in blastemas containing both dorsal- and ventral-derived cells. We further observed that Shh expression requires dorsoventral contact within a blastema, highlighting the necessity of dorsoventral contact for inducing Shh expression. Additionally, we identified WNT10B and FGF2 as dorsal- and ventral-mediated signals, respectively, that create the inductive environment for Shh expression. Our findings clarify the role of dorsal and ventral cells in inducing Shh, a mechanism that has rarely been studied in the context of limb regeneration and pattern formation. This model provides new insights into how cells with different positional identities drive the regeneration process.
Introduction
Axolotls (Ambystoma mexicanum) possess remarkable regenerative abilities, enabling the regeneration of entire limbs after amputation. Among tetrapods (four-limbed vertebrates), only urodele amphibians retain the lifelong ability to regenerate fully developed limbs. Investigating the molecular mechanisms underlying axolotl limb regeneration could provide valuable insights for advancing regenerative medicine in humans, potentially leading to new therapies for tissue repair and organ regeneration.
The limb regeneration process can be divided into two stages: the blastema (regenerating limb primordium) induction process and the limb patterning process. The induction of a blastema, which contains highly proliferative multipotent and unipotent cells, depends on the presence of nerves at the injured region; when a denervated limb is amputated, a blastema is not induced (Todd, 1823). This blastema induction process is followed by the limb patterning process. The limb patterning process has been considered to be mainly a recapitulation of limb development. Actually, activation of many developmental genes can be found during this phase. Such sequential events accomplish axolotl limb regeneration.
To accomplish limb patterning, cells need to know their address within a limb and exert their position-specific role. Such addresses of cells have been referred to as positional identities. In limb development/regeneration, positional identities are thought to be established along three-dimensional axes—anteroposterior, dorsoventral, and proximodistal. In amniote limb development, WNT7A, secreted from dorsal ectoderm, induces Lmx1b expression in the underlying mesenchyme, thereby specifying dorsal identity (Riddle et al., 1995; Vogel et al., 1995; Cygan et al., 1997; Chen et al., 1998; Chen and Johnson, 2002). On the ventral side, the ventral identity is specified indirectly by En1, which is expressed in the ventral ectoderm, restricts Wnt7a expression to the dorsal ectoderm and thereby prevents induction of Lmx1b in the ventral mesenchyme (Loomis et al., 1996; Logan et al., 1997; Chen and Johnson, 2002). Similarly, SHH is known to regulate anteroposterior patterning (Riddle et al., 1993). In axolotl limb regeneration, the establishment of the dorsoventral positional identities is still largely unknown, except for dorsal-specific Lmx1b expression (Shimokawa et al., 2013). Regarding the anteroposterior axis, Shh expression is highly conserved and restricted to the posterior margin. Though the process of the establishment of the positional identities is still veiled in axolotl limb regeneration, it is apparent that the regeneration blastema possesses regional specificity.
For successful limb patterning in limb regeneration, interactions between anterior, posterior, dorsal, and ventral cells within a blastema have been considered essential. The importance of these interpositional interactions was investigated in creating double-half limbs. Amputating the double-half limbs can provide a blastema in a ‘one-positional-identity-missing’ state. For example, when a double-dorsal limb—a chimeric limb surgically generated by excising the ventral half and replacing it with a dorsal half from the contralateral limb while preserving anteroposterior orientation—is amputated, the resulting blastema lacks ventral positional identity. Such blastemas lacking one positional identity can form hypomorphic, spike-like structures or fail to regenerate; in other cases, they regenerate limbs with complete anteroposterior axes accompanied by symmetric dorsoventral duplications (Bryant, 1976; Bryant and Baca, 1978; Burton et al., 1986). It is noteworthy that, in the non-regenerating cases, structural patterns along the anteroposterior axis appear to be lost even though both anterior and posterior cells should, in principle, be present in a blastema induced from a double-half limb. These observations are consistent with the idea that, during axolotl limb regeneration, signals mediated by dorsal cells must act on ventral cells, and signals mediated by ventral cells must act on dorsal cells, during the limb patterning process. In contrast, in amniote limb development, Wnt7a/Lmx1b or En1 mutants show that limbs can exhibit anteroposterior patterning even when tissues are dorsalized or ventralized—that is, in the relative absence of ventral or dorsal cells, respectively (Riddle et al., 1995; Chen et al., 1998; Loomis et al., 1996). Taken together, these findings indicate that the mechanism underlying limb patterning during axolotl regeneration differs from that operating during amniote limb development. Additional experiments involving ectopic contact between opposite regions (e.g., anterior–posterior or dorsal–ventral) of a blastema further support the critical role of interpositional interactions in the limb patterning process, as such interactions can lead to ectopic limb formation (Iten and Bryant, 1975; Bryant and Iten, 1976; Maden, 1980; Stocum, 1982). These findings suggest that signals mediated by each positional identity are required for successful limb patterning, such that the absence of any one of them leads to failure. To further understand limb regeneration, the molecular basis of these positional identity-mediated signals in limb patterning process should be elucidated.
The accessory limb model (ALM), a non-amputation experimental system, provides a valuable approach for studying axolotl limb regeneration, particularly the role of interpositional interactions (Endo et al., 2015). In fact, ALM has been used as the alternative experimental model for studying limb regeneration (Nacu et al., 2016). In this model, a blastema is induced through skin wounding combined with nerve deviation (Endo et al., 2004; Satoh et al., 2007). When ALM surgery is performed on the anterior side, the induced blastema (ALM blastema) lacks posterior-derived cells and is unable to form a properly patterned limb. This limitation can be overcome by supplying posterior-derived cells via a skin graft from the posterior side, enabling the successful regeneration of a patterned limb. Similarly, an ALM surgery can be performed on the posterior, dorsal, or ventral side of a limb; in each case, the induced ALM blastema is expected to lack cells from the corresponding opposite orientation (anterior, ventral, or dorsal, respectively). This condition allows the investigation of blastema induction and limb patterning by selectively removing cells from specific orientations of the limb. Analyzing the characteristics and developmental limitations of these ALM blastemas provides valuable insights into the positional identity-mediated signals that regulate axolotl limb regeneration.
The molecular basis of the interpositional interactions within a blastema in the limb patterning process has been partially elucidated (Nacu et al., 2016). In a normal blastema, Fgf8 and Shh are expressed at the anterior and the posterior regions, respectively. A previous study demonstrated that FGF8 and SHH proteins can substitute for anterior and posterior tissues, respectively, to form a patterned limb. Moreover, these proteins function as mutually inductive signals, maintaining each other’s expression. These findings suggest that FGF8 and SHH serve as the anterior- and posterior-mediated signals, respectively. In contrast, the molecular basis of dorsal- and ventral-mediated signals remains poorly understood. Previous studies have shown that retinoic acid supplementation can convert the dorsal identity to the ventral, enabling patterned limb formation even in the absence of ventral tissues (McCusker et al., 2014; Ludolph et al., 1990; Vieira et al., 2019). However, the ventral-mediated signal remains uncertain, as retinoic acid induces ventral positional identities rather than acting as the ventral-mediated signal itself, suggesting the existence of another, downstream ventral-mediated signal. Consequently, the mechanisms underlying dorsal- and ventral-mediated signals, as well as how they relate to the anterior- and posterior-mediated signals (FGF8 and SHH, respectively), remain unclear.
In the present study, we investigate the roles of dorsal- and ventral-mediated signals in limb patterning. We confirmed the necessity of dorsoventral tissue contact for limb patterning using the ALM. We found that the induction of Shh expression was dependent on the co-existence of dorsal and ventral cells in axolotl limb regeneration. Furthermore, we identified WNT10B and FGF2 as dorsal- and ventral-mediated signals, respectively, by RNA-seq analysis and confirmed that these factors mediate Shh expression in axolotl blastemas. Our results suggest that the crucial role of the dorsal- and ventral-mediated signals in the limb patterning process is to induce Shh expression, thereby enabling anteroposterior interaction. These results contribute to understanding how the integration of four positional identities—dorsal, ventral, anterior, and posterior—drives proper limb patterning during axolotl limb regeneration.
Results
Dorsoventral tissue contact is required for limb regeneration in the ALM
We performed the ALM experiment on A. mexicanum to directly test whether dorsoventral tissue contact, as well as anteroposterior tissue contact, is required for limb patterning (Figure 1). The skin was removed from one side (anterior, posterior, dorsal, or ventral) of a limb, and the large nerve fibers running along the center of a limb (Nervus medianus and Nervus ulnaris, Figure 1A) were dissected and rerouted to the wounded region. We supplied the cells from the contralateral side of a limb as a skin graft in experimental conditions to ensure the presence of sufficient cells for patterned limb formation. We conducted eight types of ALM blastema inductions, which can be categorized into two groups: basic ALM blastemas and skin-grafted ALM blastemas. The basic ALM blastemas included the anteriorly induced ALM blastema (AntBL), the posteriorly induced ALM blastema (PostBL), the dorsally induced ALM blastema (DorBL), and the ventrally induced ALM blastema (VentBL), all of which should lack cells from the contralateral side. The skin-grafted ALM blastemas included AntBL with posterior skin grafting (AntBL + P), PostBL with anterior skin grafting (PostBL + A), DorBL with ventral skin grafting (DorBL + V), and VentBL with dorsal skin grafting (VentBL + D); these ALM blastemas should contain cells with all anteroposterior and dorsoventral orientations. For the ALM experiment, we defined the two large blood vessels running on the anterior and posterior sides at the stylopod level (Vena cephalica and Vena basilica, Figure 1A) as the anterior and posterior dorsoventral borders, respectively. At 10 days post-surgery (dps), an ALM blastema was observed in all experimental groups (Figure 1B‒I). Consistent with previous studies (Endo et al., 2004; Nacu et al., 2016), limbs with multiple digits were formed from AntBL + P and PostBL + A (Table 1, Figure 1F, G), whereas AntBL and PostBL either regressed or formed bump structures (Table 1, Figure 1B, C). Similarly, DorBL + V and VentBL + D formed limbs (Table 1, Figure 1H, I), whereas most DorBL and VentBL either regressed or formed bump structures (Table 1, Figure 1D, E). Notably, only 1 out of 12 DorBL formed a limb, which may have resulted from ventral tissue contamination, as the rerouted nerves originally ran along the ventral side of the humerus. In contrast, none of the 22 VentBL formed multi-digit limbs. These results suggest that both dorsal and ventral tissues, as well as anterior and posterior tissues, are required for successful limb formation.
The induction rate of bump/limb formation in accessory limb model (ALM).
| Experiments | N | Regress | Bump | Limb | |||
|---|---|---|---|---|---|---|---|
| AntBL | 8 | 3 | (37.5%) | 5 | (62.5%) | 0 | (0.0%) |
| AntBL + P | 9 | 0 | (0.0%) | 1 | (11.1%) | 8 | (88.9%) |
| PostBL | 8 | 6 | (75.0%) | 2 | (25.0%) | 0 | (0.0%) |
| PostBL + A | 7 | 2 | (28.6%) | 1 | (14.3%) | 4 | (57.1%) |
| DorBL | 12 | 8 | (66.7%) | 3 | (25.0%) | 1 | (8.3%) |
| DorBL + V | 14 | 5 | (35.7%) | 2 | (14.3%) | 7 | (50.0%) |
| VentBL | 22 | 15 | (68.2%) | 7 | (31.8%) | 0 | (0.0%) |
| VentBL + D | 11 | 2 | (18.2%) | 2 | (18.2%) | 7 | (63.6%) |
Accessory limb model (ALM) experiments at the four orientations.
(A) Schematic image of anatomy at the stylopod level of axolotl limb. Hematoxylin and eosin (HE) staining (bright field) and acetylated alpha tubulin, visualized by immunofluorescence (green, dark field), are shown in the right panels. Black and white arrows, respectively, indicate major blood vessels and nerves. H: humerus, AHL: Anconaeus humeralis lateralis, HAB: Humeroantebrachialis, CBL: Coracobrachialis longus. (B‒I) Blastemas induced at the anterior, posterior, dorsal, or ventral region by skin wounding plus nerve deviation without (B‒E) or with (F‒I) skin grafting from the opposite side of the limb. (F‒I) Limb patterning was observed (n = 8/9 for F, 4/7 for G, 7/14 for H, and 7/11 for I, see Table 1 for more detail). Images were captured at 10 and 60 dps. Scale bar = 3 mm (A, B). (B–I) are all shown at the same magnification.
Gene expression patterns in ALM blastemas
To elucidate the characteristics of the ALM blastemas that typically fail to form limbs (AntBL, PostBL, DorBL, and VentBL), we analyzed gene expression patterns at 10 dps (Figure 2, Figure 2—figure supplement 1). Lmx1b, a gene necessary and sufficient for establishing the dorsal identity in mesenchymal cells in developing limb buds (Vogel et al., 1995; Chen et al., 1998; Chen and Johnson, 2002), was used as a dorsal marker because we previously reported that Lmx1b is exclusively expressed in dorsal-derived cells and can be activated in the ALM experiment (Iwata et al., 2020; Yamamoto et al., 2022). The expression patterns of Fgf8, Shh, and Lmx1b were investigated using in situ hybridization (ISH). In AntBL and PostBL, Lmx1b expression was restricted to the dorsal half of the blastemas (Figure 2B, G, Figure 2—figure supplement 1A, D, n = 5/5 for both), suggesting the presence of both dorsal and ventral tissues. These expression patterns correspond to the anatomically defined dorsoventral borders (Figure 1A). In contrast, Lmx1b was expressed throughout the entire region of DorBL (Figure 2L, Figure 2—figure supplement 1G, n = 6/6), whereas no Lmx1b expression was detected in VentBL (Figure 2Q, Figure 2—figure supplement 1J, n = 6/6), suggesting the absence of ventral tissue in DorBL and dorsal tissue in VentBL. Consistent with previous studies, Fgf8 expression was observed in AntBL (Figure 2C, Figure 2—figure supplement 1B, n = 4/5), but not in PostBL (Figure 2H, Figure 2—figure supplement 1E, n = 5/5, Nacu et al., 2016). Conversely, Shh expression was detected in PostBL (Figure 2I, Figure 2—figure supplement 1F, n = 5/5), but not in AntBL (Figure 2D, Figure 2—figure supplement 1C, n = 5/5). In DorBL and VentBL, Shh expression was largely absent (Figure 2N, Figure 2—figure supplement 1I, n = 5/6; Figure 2S, Figure 2—figure supplement 1L, n = 6/6), whereas Fgf8 expression was present in both (Figure 2M, Figure 2—figure supplement 1H, n = 4/6; Figure 2R, Figure 2—figure supplement 1K, n = 4/6). In DorBL, Shh expression was observed in only one out of six samples, possibly due to ventral tissue contamination, as described above. These results suggest that Fgf8 expression is independent of the co-existence of dorsal and ventral tissues, whereas Shh expression appears to require their presence.
Gene expression patterns of the accessory limb model (ALM)-induced blastemas.
Sections of anteriorly (A‒D), posteriorly (F‒I), dorsally (K‒N), or ventrally (P‒S) induced blastemas at 10 dps. Acetylated alpha tubulin (A‒P) was visualized by immunofluorescence. Expression of Lmx1b (B‒Q), Fgf8 (C‒R), and Shh (D‒S) in the regions indicated by white boxes in (A‒P) was visualized by in situ hybridization. Images of the entire blastema are provided in Figure 2—figure supplement 1. Fgf8 expression was observed in AntBL (C), DorBL (M), and VentBL (R) (n = 4/5, 4/6, and 4/6, respectively). Shh expression was observed in PostBL (I) (n = 5/5). In each case, these expression patterns of Fgf8 and Shh were focal and only a few cells expressed Fgf8 or Shh. Black and white arrowheads indicate the signals of Fgf8 and Shh expression, respectively. The dotted line indicates the epithelial–mesenchyme border. (E‒T) Schematic images of gene expression patterns. (U, V) Quantitative analysis of Fgf8 and Shh expression in ALM blastemas. Data are presented as mean ± SEM (n = 5 for all groups). n.s.: no significant difference, *p < 0.05, **p < 0.005 (two-tailed Welch’s t-test). Scale bar in (A) = 700 μm. (A–P) are all shown at the same magnification.
Induction of Shh expression requires both dorsal and ventral cells
The absence of Shh expression in most DorBL and VentBL, combined with its consistent expression in all PostBL—which contain both Lmx1b-positive and Lmx1b-negative regions—suggests that the induction of Shh expression depends on the presence of both dorsal and ventral cells (Figure 2). To test this hypothesis, we performed cell-tracing experiments using GFP-expressing skin from transgenic animals (Figure 3). We induced VentBL in leucistic animals and then grafted the posterior half of the dorsal skin (VentBL + PDgfp) or the posterior half of the ventral skin (VentBL + PVgfp) from GFP transgenic animals (Figure 3A). Similarly, DorBL was induced in wild-type animals, and the posterior half of the dorsal skin (DorBL + PDgfp) or the posterior half of the ventral skin (DorBL + PVgfp) from GFP transgenic animals was grafted (Figure 3A). GFP-positive mesenchymal cells derived from the posterior skin were expected to express Shh if provided with a suitable environment, because posteriorly derived cells, not anteriorly derived cells, are known to have the competency to express Shh in a blastema—that is, whether a cell is capable of expressing Shh depends on its original positional identity (Iwata et al., 2020), but whether it actually expresses Shh should depend on the environment in which the cell is placed. If the induction of Shh expression depends on the co-existence of dorsal and ventral cells, Shh expression in the GFP-positive cells should be observed in VentBL + PDgfp and DorBL + PVgfp but not in DorBL + PDgfp or VentBL + PVgfp. Samples were collected at 10 dps, and the expression of Shh and Lmx1b was analyzed using ISH. In all four experimental groups, Lmx1b expression patterns in the GFP-negative regions were consistent with those in DorBL and VentBL (Figure 3D, F, H, J). In DorBL + PDgfp and VentBL + PDgfp, Lmx1b expression was observed in GFP-positive mesenchymal cells, whereas GFP-positive cells in DorBL + PVgfp and VentBL + PVgfp were Lmx1b-negative (Figure 3C‒F). These Lmx1b expression patterns suggest that dorsoventral tissue contact was present in VentBL + PDgfp and DorBL + PVgfp but absent in DorBL + PDgfp and VentBL + PVgfp. In the GFP-positive cells derived from PDgfp skin, Shh expression was observed in VentBL + PDgfp (Figure 3C, n = 4/6) but not in DorBL + PDgfp (Figure 3E, n=6/6). Similarly, in the GFP-positive cells derived from PVgfp skin, Shh expression was observed in DorBL + PVgfp (Figure 3I, n = 3/6) but not in VentBL + PVgfp (Figure 3G, n = 7/7). In addition, Shh expression was observed in some GFP-negative mesenchymal cells in samples where Shh expression was observed in GFP-positive cells. These results suggest that the induction of Shh expression in posteriorly derived cells requires the co-existence of dorsal and ventral cells.
Co-existence of dorsal and ventral cells induces Shh expression.
(A) Experimental scheme. Posterior half of dorsal (PDgfp) or ventral (PVgfp) GFP-expressing skin was grafted on VentBL (VentBL + PDgfp; C, D/VentBL + PVgfp; G, H), or DorBL (DorBL + PDgfp; E, F/DorBL + PVgfp; I, J) region. (B) Induced blastemas at 10 dps; images of bright and dark fields are merged. (C‒J) Dark and bright fields of the same sections of induced blastemas at 10 dps. Red boxes in (C‒I) indicate the corresponding regions of lower images. Expression of Shh and Lmx1b was visualized by in situ hybridization. GFP signals were visualized by immunofluorescence. Arrowheads indicate the cells expressing Shh. Shh expression was observed in VentBL + PDgfp (C) and DorBL + PVgfp (I) (n = 4/6 and 3/6, respectively), but not in DorBL + PDgfp (E) and VentBL + PVgfp (G) (n = 6/6 and 7/7, respectively). The dotted line indicates the epithelial–mesenchyme border. For all samples, we collected serial sections spanning the entire blastema. For blastemas in which Shh expression was observed, we present representative sections showing the signal. For blastemas without detectable Shh expression, we present a section from the central region that contains GFP-positive cells. Scale bar = 3 mm (B) and 700 μm (C). (C–J) are all shown at the same magnification.
Limb formation in the absence of dorsoventral tissue contact
DorBL and VentBL failed to form limbs (Figure 1D, E). Shh expression was absent in these blastemas, whereas Fgf8 was expressed (Figure 2). Results from the cell-tracing experiments suggest that Shh expression requires the co-existence of dorsal and ventral cells (Figure 3). Based on these findings, we hypothesized that while the co-existence of dorsal and ventral cells is necessary to induce Shh expression, it is not directly required for limb patterning if SHH protein is externally provided. To test this hypothesis, we overexpressed Shh in DorBL and VentBL (Figure 4A, B). As a positive control, Shh was overexpressed in AntBL, where Fgf8 was expressed but Shh expression was absent (Figure 2C, D), because a previous study has shown that Shh overexpression to AntBL can induce limb patterning (Nacu et al., 2016). As a result, Shh-electroporated AntBL, DorBL, and VentBL formed limbs (n = 10/19, 6/18, and 8/14, respectively, Figure 4C‒G). In contrast, GFP-electroporated DorBL and VentBL (negative controls) failed to form limbs (n = 7/7 and 6/6, respectively). We further analyzed the anatomy of the induced limbs (Figure 4H–K, Figure 4—figure supplement 1). Because ALM-induced limbs frequently exhibit abnormal and highly variable morphologies, which makes it difficult to use consistent anatomical landmarks such as particular digits or muscle groups, we focused our analysis on morphological symmetry. We found that limbs formed from DorBL and VentBL exhibited symmetric structures along the dorsoventral axis, suggesting double-dorsal and double-ventral structures, respectively (Figure 4J, K, Figure 4—figure supplement 1C, D). In contrast, limbs formed from AntBL, which contained both Lmx1b-positive and Lmx1b-negative regions (Figure 2B), exhibited asymmetric structures similar to those of normal limbs (Figure 4H, I, Figure 4—figure supplement 1A, B). To evaluate the symmetry of the limbs, we applied a machine learning-based method using ilastik because staining intensity varied among samples, such that a region identified as ‘muscle’ in one sample could be assigned differently in another if classification were based solely on color. The machine-learning classifier trained separately for each sample allowed us to group the same tissues consistently within that sample irrespective of intensity differences. To minimize the effects of curvature or fixation-induced distortion, the boxes with a width of 400 μm were selected, and the angle was adjusted so that the outer contour (epidermal surface) was aligned symmetrically; this procedure was applied uniformly across all conditions to avoid bias. Each pixel in the images was classified into five classes (Classes 1–5, Figure 4L). In this process, we annotated regions of background (Class 1), cartilage (Class 2), muscle (Class 3), other connective tissue (Class 4), and epidermis (Class 5) as training data for classification. Using these annotated regions as references, pixels were automatically classified into the five classes. Each class was assumed to primarily represent these tissues and regions with similar characteristics. Symmetry scores were then calculated for each class individually and for the combined set of all classes (Figure 4M‒R, see Materials and methods). The analysis revealed that symmetry scores for Classes 2 and 3, which encompass cartilage and muscle, and scores for the combined set of all classes were significantly higher in limbs formed from DorBL and VentBL compared to intact limbs (Figure 4N, O, R). In contrast, the differences in symmetry scores for Classes 1, 4, and 5 in these limbs were relatively small (Figure 4M, P, Q), likely because the axis of symmetry was manually set to maximize the external shape as symmetrically as possible. No significant differences in symmetry scores across all classes were observed between intact limbs and limbs formed from AntBL. These results suggest that limbs formed from DorBL and VentBL exhibit symmetric internal structures compared to normal limbs. Therefore, Shh overexpression appears to compensate for the lack of co-existence of dorsal and ventral cells in limb patterning, without inducing new dorsal or ventral identities. Thus, we conclude that the co-existence of both dorsal and ventral cells is critical for inducing Shh expression, which in turn is essential for limb patterning.
Limb formation without the co-existence of dorsal and ventral cells by Shh overexpression.
(A) Experimental scheme. Shh-p2A-GFP- or GFP-containing pCS2 vector was electroporated (EP) into AntBL, DorBL, and VentBL. (B) Induced blastemas at 14 dps; images of bright and dark fields are merged. (C‒G) Phenotypes at 90 dps. Limb patterning was observed in (E‒G) (n = 10/19, 6/18, and 8/14, respectively). (H‒K) Histological analysis of intact and induced limbs. Standard Masson’s trichrome staining was performed on the transverse sections. The dotted boxes indicate the regions shown in (L). (L) Upper panels: analyzed regions for calculating symmetry scores. Lower panels: images after pixel classification by machine learning. (M‒R) Symmetry scores of each class. Scores obtained from the same limb are plotted at the same x-coordinates. Data are presented as mean ± SEM. n.s.: no significant difference, *p < 0.05, **p < 0.005 (two-tailed Welch’s t-test). Scale bar = 2 mm (B), 4 mm (C‒G), and 1 mm (H‒K).
-
Figure 4—source code 1
Source code for calculating the symmetry score.
- https://cdn.elifesciences.org/articles/106917/elife-106917-fig4-code1-v1.zip
The molecular basis of the dorsal- and ventral-mediated signals
To investigate the molecular basis of dorsal- and ventral-mediated signals, we performed RNA-seq analysis on DorBL and VentBL and identified differentially expressed genes (DEGs) between the two groups (p < 0.05, Figure 5A). Among the DEGs, we specifically focused on genes annotated as ‘intercellular signaling molecules’ in PANTHER and identified 21 genes (Figure 5B). In this analysis, we found that 5 genes were expressed at higher levels in DorBL and 16 genes were expressed at higher levels in VentBL (Figure 5B). Notably, Wnt4, Wnt10b, Fgf2, Fgf7, and Tgfb2, which encode secreted proteins, belong to the WNT, FGF, and TGFB families, which play key roles in major signaling pathways regulating limb developmental processes, and we focused on these five genes. To examine whether these genes regulate the induction of Shh expression in ALM blastemas, we overexpressed each gene in either DorBL or VentBL. As a result, Shh expression was observed in Wnt10b-electroporated VentBL (n = 4/5) and Fgf2-electroporated DorBL (n = 5/7, Figure 5C). In contrast, Shh expression was not detected in Wnt10b-electroporated DorBL (n = 6/6) or Fgf2-electroporated VentBL (n = 5/5). Similarly, Shh expression was not detected in Fgf7- or Tgfb2-electroporated DorBL (n = 5/5 for both) or in Wnt4-electroporated VentBL (n = 6/6). To confirm the ISH data, we performed RT-qPCR on Fgf2- or GFP (control)-electroporated DorBL and Wnt10b- or GFP (control)-electroporated VentBL and observed significant upregulation in Shh expression (Figure 5D, E). In Wnt10b-electroporated VentBL, Axin2, a downstream transcriptional target of canonical WNT signaling, and Lef1, a canonical WNT pathway effector expressed in axolotl limb mesenchyme (Glotzer et al., 2022), were also upregulated (Figure 5F, G). Next, to confirm Shh induction by WNT signaling in VentBL, we treated VentBL with 1 μM 6-bromoindirubin-3-oxime (GSK-3 Inhibitor, BIO). As a result, Shh expression was relatively higher in BIO-treated VentBL compared to DMSO-treated control VentBL (Figure 5—figure supplement 1B, D, E). Additionally, symmetric limbs were formed in Wnt10b-electroporated VentBL (n = 3/12), BIO-treated VentBL (n = 3/8), and in Fgf2-electroporated DorBL (n = 5/10), consistent with the results of Shh overexpression (Figure 5H–J, Figure 5—figure supplements 1C, F‒H and 2A, B). These findings suggest that WNT10B, expressed highly in dorsal blastema cells, and FGF2, expressed highly in ventral blastema cells, function as the dorsal- and ventral-mediated signals, respectively, to induce Shh expression, which subsequently supports limb patterning.
Identification of candidate molecules of the dorsal- and ventral-mediated signals.
RNA-seq was performed on DorBL and VentBL at 10 dps. (A) MA plot of the result. (B) List of differentially expressed genes (DEGs) annotated as ‘intercellular signaling molecules’. (C) Bright and dark fields of sections of DorBL and VentBL at 10 dps with candidate genes introduced. Expression of Shh and Lmx1b was visualized by in situ hybridization, and GFP signals were visualized by immunofluorescence. Arrowheads indicate the cells expressing Shh. The white boxes indicate the regions of the lower panels. Images of dark and bright fields of Shh are obtained from the same section. For samples with detectable Shh expression, the window was placed in the region where the signal was observed, and for conditions without detectable Shh expression, the window was positioned in a comparable region containing GFP-positive cells. Shh expression was observed in Wnt10b-electroporated VentBL (n = 4/5) and Fgf2-electroporated DorBL (n = 5/7), but not in Wnt10b-electroporated DorBL (n = 6/6), Fgf2-electroporated VentBL (n = 5/5), Fgf7-electroporated DorBL (n = 5/5), Tgfb2-electroporated DorBL (n = 5/5), or in Wnt4-electroporated VentBL (n = 6/6). (D, E) Quantitative analysis of Shh expression in Fgf2- or GFP-electroporated DorBL and Wnt10b- or GFP-electroporated VentBL. Data are presented as mean ± SEM (n = 7 for both). In each case, Fgf2 or Wnt10b was electroporated into the DorBL or VentBL induced in the left limb, and GFP was electroporated into the contralateral right limb of the same animal. (F, G) Quantitative analysis of Axin2 and Lef1 expression in Wnt10b- or GFP-electroporated VentBL. Data are presented as mean ± SEM (n = 7 for both). (H, I) The limbs formed from VentBL with Wnt10b and DorBL with Fgf2 at 90 dps. Histological analysis and pixel classification were performed in the same way as in Figure 4. The dotted boxes indicate the regions shown in the right panels. (J) Symmetry scores of each class. Scores obtained from the same limb are plotted at the same x-coordinates. The plots of ‘int’ are the same plots as in Figure 4. Data are presented as mean ± SEM. n.s.: no significant difference, *p<0.05, **p<0.005 (two-tailed paired t-test for D‒G, and two-tailed Welch’s t-test for J). Scale bar = 700 μm (C), 4 mm (H, I, upper panels), and 1 mm (H, I, lower panels). Images in (C) are all shown at the same magnification.
To test whether our model applies to normal regeneration, we analyzed Wnt10b and Fgf2 expression in amputation-induced blastemas (Figure 5—figure supplement 3). We first performed ISH on blastemas at several stages (early bud [EB], middle bud [MB], and late bud [LB]), but the signals were weak and inconsistent, and we could not reliably detect clear expression domains (Figure 5—figure supplement 3A). We then performed RT-qPCR on manually microdissected dorsal and ventral halves of MB blastemas (Figure 5—figure supplement 3B). We found that Wnt10b and Fgf2 were expressed at significantly higher levels in the dorsal and ventral halves, respectively, compared to the opposite half. This dorsoventral-biased expression of Wnt10b and Fgf2 is consistent with our RNA-seq data from ALM blastemas. We next quantified Wnt10b, Fgf2, and Shh expression across stages (intact, EB, MB, LB, and early digit [ED]) and found that Wnt10b and Fgf2 expression peaked at the MB stage, whereas Shh expression peaked later, at the LB stage (Figure 5—figure supplement 3C). This temporal offset in Shh upregulation relative to Wnt10b and Fgf2 supports a model in which WNT10B and FGF2 act upstream to induce Shh expression.
To identify the cell populations expressing Wnt10b and Fgf2 during normal regeneration, we reanalyzed published single-cell RNA-seq data from a 7 dpa (MB) blastema (Li et al., 2021, Figure 5—figure supplement 4). The dataset was reclustered, and clusters were assigned using known markers (Prrx1 for mesenchyme and Krt17 for epithelium, Figure 5—figure supplement 4A, B). As expected, Lmx1b, Fgf8, and Shh were detected in the mesenchymal cluster (Figure 5—figure supplement 4C, F, G). Fgf2 was also expressed in the mesenchymal cluster (Figure 5—figure supplement 4E). In contrast, Wnt10b expression was detected in both mesenchymal and epithelial clusters (Figure 5—figure supplement 4D), but these results may partially reflect technical bias, as low-level signals of epithelial and CT/fibroblast markers can be detected outside their expected clusters (Figure 5—figure supplement 4A, B). Both Wnt10b and Fgf2 were expressed in only a few cells, consistent with the ISH data (Figure 5—figure supplement 3A). We then examined the relationships between these genes. Fgf8 and Shh were expressed in both Lmx1b-positive and Lmx1b-negative cells (Figure 5—figure supplement 4H, I), but Fgf8 and Shh themselves were mutually exclusive (Figure 5—figure supplement 4M). These expression patterns of Fgf8, Shh, and Lmx1b in the normal blastema are consistent with those observed in ALM blastemas (Figure 2). For Wnt10b and Fgf2, their expression did not follow Lmx1b expression (Figure 5—figure supplement 4J, K), and Wnt10b and Fgf2 themselves were not exclusive (Figure 5—figure supplement 4L). Together with the RT-qPCR data (Figure 5—figure supplement 3B), these results suggest that Wnt10b and Fgf2 are not exclusively confined to purely dorsal or ventral cells at the single-cell level, even though they show dorsoventral bias when assessed in bulk tissue.
Limb formation without nerve deviation and ventral skin grafting
A previous study demonstrated that a cocktail of BMP2, FGF2, and FGF8 can substitute for nerve deviation in the ALM experiment on the anterior region, suggesting that nerves contribute to blastema induction by supplying these proteins (Makanae et al., 2014a). We found that FGF2 can also substitute for ventral tissue in DorBL (Figure 5), suggesting that FGF2 serves not only as part of the nerve factors in blastema induction but also as the ventral-mediated signal in limb patterning. To investigate whether supplementation with BMP2, FGF2, and FGF8 to the dorsal region could substitute for both nerve deviation and ventral skin grafting, we performed experiments involving gelatin beads soaked in these proteins (Figure 6). The dorsal or ventral skin was removed at the zeugopod level, and a BMP2 + FGF2 + FGF8-soaked gelatin bead was grafted at 3 dps without nerve deviation. Blastema induction was observed in both experimental groups (Figure 6A, B, upper panels). We investigated gene expression patterns in the induced blastemas and found that both Fgf8 and Shh were expressed in blastemas induced at the dorsal site (n = 8/8), whereas Shh expression was absent in ventral blastemas (n = 5/5), although Fgf8 expression was detected in most cases (n = 4/5, Figure 6C, D, F, G). Lmx1b expression patterns corresponded to those observed in DorBL and VentBL (Figure 6E, H, n = 8/8 and 5/5, respectively). Furthermore, limb patterning was observed in the dorsal groups (n = 12/20) but not in the ventral groups (n = 17/17, Figure 6A, B, lower panels). These findings demonstrate that a straightforward procedure involving dorsal skin wounding and supplementation with BMP2, FGF2, and FGF8 is sufficient to induce accessory limb formation. This method enabled the induction of an ectopic limb without surgical nerve deviation, but a previous study has shown that fine nerve ingrowth can still occur when blastemas are induced by a BMP2 + FGF2 + FGF8-soaked bead (Makanae et al., 2014b). These recruited nerves may be functional after blastema induction. Remarkably, this method also enabled the induction of multiple limbs within the same limb. Grafting BMP2 + FGF2 + FGF8-soaked beads to multiple dorsal sites resulted in the formation of multiple limbs along the proximodistal axis (n = 16/35, Figure 6I‒L). Despite careful implantation designed to avoid injuring deep tissues, one sample displayed a fusion of the stylopod with the host humerus—a phenotype associated with deep wounding (Satoh et al., 2010; Makanae et al., 2014a). This suggests that contributions from a broader cellular population cannot be excluded. However, because this fusion was not consistently observed, and because ectopic limbs induced at the forearm (zeugopod) level did not exhibit such fusion (n = 1/6 for stylopod-level inductions; n = 0/10 for zeugopod-level inductions, Figure 6L1, L2), the data suggest that most ectopic limbs would have developed without substantial ventral-cell contribution. These results refine our understanding of the role of FGF2 in the ALM, particularly its critical function on the dorsal side.
Limb formation at the dorsal region by BMP2 + FGF2 + FGF8 supplementation.
14 and 60 dps phenotypes of BMP2 + FGF2 + FGF8 supplementation by bead grafting at the dorsal (A) or ventral (B) region. Neither nerve deviation nor skin grafting was performed. Limb patterning was observed in the dorsa group (A) (n = 12/20) but not in the ventral group (B) (n = 0/17). (C‒H) Expression patterns of Fgf8, Shh, and Lmx1b of induced blastemas at 10 dps. Gene expression was visualized by in situ hybridization. The dotted line indicates the external shape of the blastema. Fgf8 expression was detected in both dorsal and ventral groups (n = 8/8 for C and 5/5 for F), whereas Shh expression was detected only in the dorsal group (D) (n = 8/8) and not in the ventral group (G) (n = 0/5). (I, J) Phenotype obtained by BMP2 + FGF2 + FGF8 supplementation to two dorsal regions of an identical limb. (K, L) Phenotype obtained by BMP2 + FGF2 + FGF8 supplementation to five dorsal regions of an identical limb (n = 16/35). Scale bar = 3 mm (B), 700 μm (H), 2 cm (J), and 1 cm (K, L). (A, B), (C–H), or (I, J) are shown at the same magnification.
Discussion
Dorsal- and ventral-mediated signals are required for the induction of Shh expression
In axolotl limb regeneration, cells derived from all four positional origins—anterior, posterior, dorsal, and ventral—are required for an induced blastema to form a limb. This was confirmed through the ALM experiments (Figure 1). The gene expression patterns in these ALM blastemas revealed distinct molecular characteristics for each group (Figure 2). Fgf8 expression in AntBL and Shh expression in PostBL are consistent with a previous report (Nacu et al., 2016). The absence of SHH in AntBL and of FGF8 in PostBL likely accounts for their failure to form limbs. Lmx1b expression in the dorsal half of both AntBL and PostBL suggests that both dorsal and ventral tissues co-existed in these blastemas (Figure 2B, G, Figure 2—figure supplement 1A, D). In contrast, DorBL and VentBL exhibited distinct Lmx1b expression patterns, suggesting that most cells in DorBL and VentBL are derived from dorsal or ventral origins, respectively (Figure 2L, Q, Figure 2—figure supplement 1G, J). A possible explanation for the lack of Shh expression in DorBL and VentBL is that the induction of Shh expression may depend on the co-existence of dorsal and ventral cells, although Fgf8 can be expressed independently of the co-existence of dorsal and ventral cells (Figure 2M, N, R, S, U, V, Figure 2—figure supplement 1H, I, K, L). This idea is supported by the cell-tracing experiment (Figure 3). In these assays, the posteriorly derived cells expressed Shh only when both dorsal and ventral cells were present. These results strongly suggest that the co-existence of dorsal and ventral cells is necessary for inducing Shh expression. Consequently, one of the essential roles of the dorsal and ventral cells in limb patterning is to mediate signals required for Shh induction in the posterior cells, which facilitates the anteroposterior interaction.
Our findings clarify the hierarchical relationship between dorsal- and ventral-mediated signals and anteroposterior interaction. Our data demonstrate that dorsal and ventral cells are essential for inducing Shh expression in a regenerating blastema. Furthermore, we showed that DorBL and VentBL, which typically fail to form a limb, could form patterned limbs with ectopic Shh expression, even in the absence of dorsal and ventral cell co-existence (Figure 4). Furthermore, such limbs exhibited dorsally or ventrally symmetric structures (Figure 4F, G, J‒R, Figure 4—figure supplement 1C, D), highlighting that dorsoventral patterning depends on the cell origin. Thus, we concluded that dorsal- and ventral-mediated signals are essential for patterned limb formation via inducing Shh expression.
WNT10B and FGF2 as dorsal- and ventral-mediated signals
We identified Wnt10b and Fgf2 as candidate genes encoding the dorsal- and ventral-mediated signals required to induce Shh expression, respectively (Figure 5). Our DEG analysis between DorBL and VentBL revealed higher Wnt10b expression in DorBL and higher Fgf2 expression in VentBL (Figure 5A, B). Wnt10b-electroporation in VentBL and Fgf2-electroporation in DorBL induced Shh expression and subsequent limb patterning (Figure 5C‒E). Wnt4 expression was also elevated in DorBL, while Fgf7 and Tgfb2 were upregulated in VentBL. However, we did not observe Shh induction in the Fgf7-electroporated or Tgfb2-electroporated DorBL or in the Wnt4-electroporated VentBL. FGF7 is known to be capable of inducing the apical ectodermal ridge (AER) in chick limb development (Yonei-Tamura et al., 1999), but little is known about its role in limb regeneration. In newt limb regeneration, KGFR, which acts as an FGF7 receptor, is expressed in the basal layer of the wound epithelium, while FGFR1, which acts as an FGF2 receptor, is primarily expressed in the mesenchyme (Poulin et al., 1993). This differential expression pattern suggests that FGF2 and FGF7 target distinct cell populations, potentially explaining the differences in their ability to induce Shh expression. The difference in the ability of Wnt10b and Wnt4 to induce Shh expression in VentBL may reflect differences in how these ligands activate downstream WNT signaling programs. WNT10B is a potent activator of the canonical WNT signaling pathway (Bennett et al., 2005), although WNT10B has also been reported to trigger a β-catenin-independent pathway (Lin et al., 2021). Similarly, WNT4 can activate both the canonical WNT signaling pathways and a non-canonical, β-catenin-independent pathway (Li et al., 2013; Li et al., 2019). We also observed Shh induction in BIO-treated VentBL, indicating that the canonical WNT signaling pathway regulates Shh expression. However, it is uncertain why Shh expression was observed in Wnt10b-electroporated VentBL, but not in Wnt4-electroporated VentBL. One possible explanation is that different WNT ligands can engage the same receptors (Frizzled/LRP6) yet elicit distinct downstream programs, suggesting that such ligand-specific outputs may vary depending on cell context (Voss et al., 2025). Regarding Tgfb2, TGF-β signaling has been implicated in blastema induction during salamander limb regeneration (Sader and Roy, 2022; Lévesque et al., 2007). However, little is known about the relationship between TGF-β signaling and Shh induction in limb development and regeneration, suggesting that TGF-β signaling does not play a primary role in Shh induction. Consistent with this, we did not observe Shh induction in the Tgfb2-electroporated DorBL, as described above. This suggests that TGFB2 signaling may be involved in dorsoventral regulation independent of Shh induction. Taken together, among the candidate genes we identified, WNT10B via the canonical WNT pathway and FGF2 via FGFR1 appear to regulate Shh induction and the subsequent patterning process.
WNT signaling may be the key for the dorsal properties in limb formation. It has been reported that canonical WNT/β-catenin signaling plays essential roles in limb regeneration among vertebrates, including axolotls (Kawakami et al., 2006; Lovely et al., 2022). In the present study, we demonstrated that introducing Wnt10b or BIO treatment could induce Shh expression in VentBL, facilitating limb patterning. In mouse limb development, Wnt10b is expressed in the AER (Witte et al., 2009), and mutations in Wnt10b are associated with Split-Hand/Foot Malformation (Ugur and Tolun, 2008; Al Ghamdi et al., 2020; Bilal et al., 2023). However, there is no evidence suggesting that Wnt10b contributes to dorsal specificity during limb development. This raises questions about whether the function of Wnt10b is unique to axolotls or whether its orthologs in other species might share functional redundancy with other WNT genes. Further studies are needed to clarify this point. Notably, WNT10B utilizes the canonical Wnt signaling pathway, similar to WNT7A, a well-known WNT family gene critical for dorsoventral limb patterning in amniotes. In amniotes, Wnt7a is expressed in the dorsal ectoderm of developing limb buds and induces Lmx1b expression in dorsal mesenchyme, thereby establishing dorsal characteristics (Riddle et al., 1995; Cygan et al., 1997; Chen and Johnson, 2002). In axolotls, dorsal-specific Wnt7a expression has not been confirmed. Our RNA-seq analysis showed that there was almost no significant difference in Wnt7a expression levels between DorBL and VentBL (log2 (normalized counts) = 5.97, log2 (fold change) = –0.810, p = 0.401), consistent with previous studies (Shimokawa et al., 2013). Similarly, there was no significant difference in En1 expression (log2 (normalized counts) = 0.909, log2 (fold change) = –1.812, p = 0.264). In amniote limb development, En1 is expressed in the ventral ectoderm, where it restricts Wnt7a expression to the dorsal ectoderm and thereby prevents induction of Lmx1b in the ventral mesenchyme (Loomis et al., 1996; Logan et al., 1997; Chen and Johnson, 2002). These results suggest that Wnt7a does not have a dorsal-specific function, at least in axolotl limb regeneration. While WNT10B could function as a dorsal-mediated signal, WNT10B is unlikely to induce dorsal identity, as ectopic Lmx1b expression was not observed in Wnt10b-introduced VentBL, which formed double-ventral limbs (Figure 5F‒H). This indicates that Wnt10b in axolotl limb regeneration does not simply replace the function of Wnt7a in amniote limb development. Nevertheless, the involvement of canonical WNT signaling in dorsal function and limb morphogenesis remains an important area for further investigation.
We identified FGF2 as the ventral-mediated signal, which plays a crucial role in the limb patterning process during axolotl limb regeneration. This aligns with previous studies showing that Fgf2 expression correlates with limb regeneration in salamanders (Giampaoli et al., 2003). Fgf2 expression was relatively high in VentBL, and Fgf2-introduced DorBL formed patterned limbs (Figure 5). These results indicate that Fgf2 overexpression can substitute for the presence of ventral cells in the limb patterning process. It is noteworthy that FGF2 application does not appear to induce ventral identity, as the limbs formed from Fgf2-introduced DorBL exhibited dorsally symmetric limb structures. The use of FGF signaling as a ventral-mediated output downstream of dorsoventral identity has not been documented in other species examined to date. Whether this represents an axolotl-specific regulatory mechanism or a broader function of FGF signaling in limb morphogenesis remains to be determined.
Our findings suggest that although WNT10B and FGF2 act as dorsal- and ventral-mediated signals, they do not alter dorsal or ventral identity itself. In amniote limb development, WNT7A and EN1 regulate dorsoventral identity through Lmx1b expression. In contrast, in axolotls, Wnt10b-electroporation in VentBL or Fgf2-electroporation in DorBL did not affect the expression patterns of Lmx1b (Figure 5C). Moreover, the limbs formed from such DorBL and VentBL exhibited dorsally or ventrally symmetric structures (Figure 5H–J, Figure 5—figure supplement 2). These findings suggest that dorsoventral identities in axolotls are not affected by Wnt10b or Fgf2 overexpression. We previously reported that the expression patterns of Lmx1b in axolotl limb regeneration are likely to depend on the positional origins of cells (Iwata et al., 2020; Yamamoto et al., 2022). The identities of cells along the dorsoventral axis may be controlled by their positional memory and determined before the initiation of limb regeneration.
The present study revealed that the dorsal- and ventral-mediated signals WNT10B and FGF2 regulate Shh expression during limb patterning in axolotls. These findings highlight a degree of conservation between axolotl limb regeneration and amniote limb development. In amniote limb development, FGF and WNT signaling pathways are key regulators of Shh expression. In developing amniote limb buds, Fgf2 is expressed in the ectoderm, including the AER, and in adjacent mesoderm, and promotes distal outgrowth. FGFs, including FGF2, supplied from the AER are known to maintain Shh expression (Laufer et al., 1994; Niswander et al., 1994; Yang and Niswander, 1995; Li et al., 1996). Similarly, WNT7A regulates Shh expression in amniote limb development, and loss of WNT7A function results in reduced Shh expression in the zone of polarizing activity and the deletion of posterior structures (Parr and McMahon, 1995). Thus, our findings provide new insight into both conserved and divergent aspects of dorsal- and ventral-mediated signaling in the regulation of Shh expression, thereby furthering our understanding of limb morphogenesis.
In this study, RNA-seq analysis of ALM blastemas induced on the dorsal or ventral side listed Wnt10b and Fgf2 as genes that are more highly expressed in DorBL and VentBL, respectively. In the ALM context, Wnt10b or Fgf2 overexpression was sufficient to substitute for dorsal or ventral tissues, respectively, and to drive Shh induction and subsequent limb patterning even in the absence of those tissues (Figure 5). However, in amputation-induced blastemas during normal regeneration, ISH did not reveal clear expression patterns for Wnt10b or Fgf2 (Figure 5—figure supplement 3A), and reanalysis of single-cell RNA-seq from the regenerating blastema (Li et al., 2021) showed that their expression did not strictly follow Lmx1b expression (Figure 5—figure supplement 4J, K). These results may partially reflect technical bias; low-level signals of epithelial and CT/fibroblast markers can be detected outside their expected clusters (Figure 5—figure supplement 4A, B). Moreover, because we focused our reanalysis on the 7 dpa (MB) sample—guided by our bulk RT-qPCR data suggesting that the expression of these gene peaks at the MB stage (Figure 5—figure supplement 3C)—it remains possible that clearer, and potentially different, expression patterns could be observed if other datasets are used. By contrast, and consistent with our bulk RNA-seq results, RT-qPCR of manually microdissected dorsal and ventral halves of regenerating blastemas showed that Wnt10b and Fgf2 were expressed at significantly higher levels in the dorsal and ventral halves, respectively (Figure 5—figure supplement 3B). These results suggest that Wnt10b expression and Fgf2 expression are mediated by dorsal and ventral cells, respectively, but their expression is not restricted to dorsal or ventral cells. Our results on Wnt10b-electroporated VentBL and Fgf2-electroporated DorBL suggest that both activation of WNT10B and FGF2 is required for Shh induction and proceeds with limb patterning. To fully understand axolotl limb regeneration, it will be important to determine how Wnt10b and Fgf2 expression is regulated, how their downstream programs are deployed, and how dorsal and ventral cells respond to these signals in future studies.
The dorsoventral-mediated Shh induction mechanism
In the present study, we found the importance of the co-presence of cells carrying the anterior, posterior, dorsal, and ventral identity for successful axolotl limb patterning (Figure 7). In our proposed model, following amputation, nerves first trigger blastema induction by secreting nerve factors, such as BMPs and FGFs (Makanae et al., 2014a, Satoh et al., 2016). These nerve factors stimulate connective tissue cells, including dermal cells, to generate multipotent mesenchymal blastemal cells (Muneoka et al., 1986; Kragl et al., 2009; Hirata et al., 2010; Gerber et al., 2018). Within the induced blastema, Wnt10b and Fgf2 expression are mediated by the dorsal and ventral cells, respectively. In the next phase, the co-existence of WNT10B and FGF2 signaling induces Shh expression in the posterior region of the blastema. During this phase, Fgf8 is expressed in the anterior mesenchyme independently of the co-existence of dorsal and ventral cells (Figure 7A). These expression patterns of Wnt10b, Fgf2, Shh, and Fgf8 may be mediated by the positional memory of cells (Otsuki and Tanaka, 2022). In the subsequent phase, the anteroposterior interaction, mediated by FGF8 and SHH, supports distal outgrowth to form a limb. This model explains previous observations in studies on double-half limbs and ALM blastemas (AntBL, PostBL, DorBL, and VentBL), which typically fail to form a limb. In blastemas induced from double-anterior and double-posterior limbs, or AntBL (Figure 7B) and PostBL (Figure 7C), SHH or FGF8 proteins are likely absent due to the lack of posteriorly or anteriorly derived cells, respectively. Similarly, in blastemas induced by amputating double-dorsal and double-ventral limbs, or DorBL (Figure 7D) and VentBL (Figure 7E), FGF2 or WNT10B proteins are likely absent or insufficient because of the lack of ventrally or dorsally derived cells, respectively. This results in the absence of SHH, even if posteriorly derived cells are present. In all these cases, the absence of either FGF8 or SHH disrupts the anteroposterior interaction, leading to failure in limb patterning. We conclude that the requirement for cells derived from all four positional origins is underpinned by this model. In this model, dorsal- and ventral-mediated signals activate the posterior SHH, enabling mutual interaction with the anterior FGF8. This interplay ensures proper anteroposterior interaction and complete limb patterning. Our findings contribute to understanding how the integration of four positional identities—dorsal, ventral, anterior, and posterior—drives proper limb patterning during axolotl limb regeneration.
The dorsoventral-mediated Shh induction mechanism.
Schematic images of a normal blastema (A), AntBL (B), PostBL (C), DorBL (D), and VentBL (E). Green, red, blue, and yellow boxes within the blastema represent cells derived from anterior, posterior, dorsal, and ventral regions, respectively. Colored arrows indicate the presence of the corresponding signals mediated by these cells. In this model, limb patterning requires both FGF8 and SHH, and Shh expression in posteriorly derived cells is induced by the co-existence of WNT10B and FGF2.
Materials and methods
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Gene (Ambystoma mexicanum) | WNT4 | AXOLOTL-OMICS | AMEX60DD052091 | |
| Gene (Ambystoma mexicanum) | WNT10B | AXOLOTL-OMICS | AMEX60DD029981 | |
| Gene (Ambystoma mexicanum) | TGFB2 | AXOLOTL-OMICS | AMEX60DD036126 | |
| Gene (Ambystoma mexicanum) | FGF2 | AXOLOTL-OMICS | AMEX60DD044865 | |
| Gene (Ambystoma mexicanum) | FGF7 | AXOLOTL-OMICS | AMEX60DD003767 | |
| Genetic reagent (Ambystoma mexicanum) | Wild type (leucistic) | Hiroshima University Amphibian Research Center | Wild type (leucistic) | Procured from the Hiroshima University Amphibian Research Center |
| Antibody | anti-GFP (rabbit IgG, polyclonal) | MBL | RRID:AB_591819 | (1:500) |
| Antibody | anti-acetylated alpha tubulin (mouse IgG, monoclonal) | Santa Cruz | RRID:AB_628409 | (1:1000) |
| Antibody | anti-mouse IgG Alexa 488 (goat IgG, polyclonal) | Invitrogen | RRID:AB_143160 | (1:1000) |
| Antibody | anti-rabbit IgG Alexa 488 (donkey IgG, polyclonal) | Invitrogen | RRID:AB_2535792 | (1:500) |
| Recombinant DNA reagent | Wnt10b-p2a-AcGFP-pCS2 (plasmid) | This paper | N/A | Available from our group upon request |
| Recombinant DNA reagent | Wnt4-p2a-AcGFP-pCS2 (plasmid) | This paper | N/A | Available from our group upon request |
| Recombinant DNA reagent | Fgf2-p2a-AcGFP-pCS2 (plasmid) | This paper | N/A | Available from our group upon request |
| Recombinant DNA reagent | Fgf7-p2a-AcGFP-pCS2 (plasmid) | This paper | N/A | Available from our group upon request |
| Recombinant DNA reagent | Tgfb2-p2a-AcGFP-pCS2 (plasmid) | This paper | N/A | Available from our group upon request |
| Peptide, recombinant protein | Bmp2 | R&D Systems | Cat#355-BM | |
| Peptide, recombinant protein | Fgf2 | R&D Systems | Cat#3139-FB | |
| Peptide, recombinant protein | Fgf8 | R&D Systems | Cat#423-F8 | |
| Commercial assay or kit | MS222 | Sigma-Aldrich | Cat#A5042 | |
| Commercial assay or kit | FEWBlue TA PCR Cloning Kit, pTAC-2 | BioDynamics Lab Inc | Cat#DS126 | |
| Commercial assay or kit | SP6 RNA Polymerase | Takara | Cat#2520A | |
| Commercial assay or kit | T7 RNA Polymerase | Takara | Cat#2540A | |
| Commercial assay or kit | PrimeScript II 1st strand cDNA Synthesis Kit | Takara | Cat#6210A | |
| Commercial assay or kit | KAPA SYBR Fast qPCR Kit | Kapa Biosystems | Cat#KK4605 | |
| Commercial assay or kit | Genopure Maxi kit | Roche | Cat#03143422001 | |
| Commercial assay or kit | In-Fusion HD Cloning Kit | Clontech | Cat#639648 | |
| Chemical compound, drug | 6-Bromoindirubin-3-oxime (BIO) | Selleck | Cat#S7198 | |
| Software, algorithm | StepOne Software v2.1 system | Thermo Fisher Scientific | RRID:SCR_023455 | |
| Software, algorithm | ilastik | Berg et al., 2019 | RRID:SCR_015246 | |
| Software, algorithm | Seurat | Hao et al., 2021 | RRID:SCR_016341 | |
| Other | Proteinase K | Invitrogen | Cat#25530049 | |
| Other | 5-Bromo-4-chloro-3-indolyl Phosphate p-Toluidine Salt (BCIP) | Nacalai | Cat#05643-11 | |
| Other | Nitro Blue Tetrazolium (NBT) | Nacalai | Cat#24720-01 | |
| Other | Hoechst | Nacalai | Cat#19172-51 | (5 µl/40 ml TBST) |
| Other | TriPure reagent | Roche | Cat#11667157001 |
Animal procedures
Request a detailed protocolAxolotls between 4 and 15 cm from snout to tail tip were housed in tap water at 22°C. Both forelimbs and hind limbs were used for surgical procedures without distinction. We did not specifically distinguish between the sexes of the animals. This is because there is no evidence of gender-based differences in limb regeneration. Transgenic axolotls were obtained from the Ambystoma Genetic Stock Center (http://www.ambystoma.org/genetic-stock-center). Animals were anesthetized in 0.1% MS222 (Sigma-Aldrich) solution before surgical procedures.
In the ALM experiments, skin was peeled from the anterior, posterior, dorsal, or ventral side of a limb at the stylopod level, so that the skin of the opposite side was not injured. Thus, the size of the injured area depended on the limb size. Then, thick bundles of nerve trunks running the center of a limb were deviated to the injured region. For the cell-tracing experiment, a piece of posterior half of the dorsal or ventral skin was obtained from GFP-expressing transgenic animals and grafted to the ALM region.
Protein-soaked beads for grafting were prepared as previously described (Makanae et al., 2014b; Kashimoto et al., 2023). In brief, air-dried gelatin beads were allowed to swell in stock solution (1 μg/μl) prepared following the manufacturer’s instructions. Equal amounts of proteins were used when formulating the combination protein mixture. Beads were soaked in the mixture of proteins (Bmp2 [mouse], Fgf2 [mouse], and Fgf8 [human/mouse]; R&D Systems) overnight at 4°C. For control experiments, gelatin beads were soaked in DDW. Before grafting, dorsal or ventral skin was peeled because full-thickness skin inhibits limb regeneration (Thornton, 1962; Mescher, 1976; Tsai, 2020). The beads were grafted under the wounded epidermis at 3 dps. The limbs were fixed 10 days after grafting. The details of grafting procedures are as previously described (Makanae et al., 2014a; Kashimoto et al., 2023).
To analyze skeletal patterns, induced limbs were stained with alcian blue and alizarin red. Samples were fixed in 100% ethanol for 1 day at room temperature, then stained with Alcian blue solution (Wako, pH 2.0) in 20% acetic acid (Nacalai Tesque) with 80% ethanol solution at 37°C overnight. Then, samples were washed in tap water several times and fixed in 10% Formaldehyde Neutral Buffer Solution (Nacalai Tesque) for 1 day. Samples were then stained with Alizarin red S (Nacalai Tesque) in the solution (4% KOH:10% Formaldehyde Neutral Buffer Solution = 2:3) at room temperature for 1 day. Finally, samples were placed in graded glycerol with 4% KOH for clearing.
For BIO treatment, 10 mM stock solution of 6-bromoindirubin-3-oxime (BIO, Selleck, S7198) dissolved in DMSO was stored in the dark at 4°C. Axolotls soon after surgery were raised in tap water with BIO solution (experimental) or with the same amount of solvent, DMSO (control), until 14 dps for RT-qPCR and 30 dps for phenotype analysis. The containers, including water and axolotls, were kept in the dark during BIO or DMSO treatment. For BIO treatment, axolotls between 4 and 5 cm from snout to tail tip were used.
The care and treatment of the animals in this study was carried out under protocols approved by the Animal Care and Use Committee of Okayama University (reference no. 2024252). Every possible measure was taken to minimize animal suffering, in line with the NIH Guide for the Care and Use of Laboratory Animals.
Sectioning and histological staining
Request a detailed protocolSamples were fixed in 4% PFA/PBS overnight at room temperature before sectioning. The fixed samples were embedded in O.C.T. compound (Sakura) following 30% sucrose/PBS treatment for approximately 12 hr at 4°C. Frozen sections of 14 μm thickness were prepared using Leica CM1850 (Nussloch). The sections were well dried under an air dryer and kept at –80°C until use.
Standard hematoxylin and eosin (HE) staining and Masson’s trichrome staining were used for histological analysis. To visualize cartilage formation, Alcian blue staining was performed before HE staining. In brief, sections were washed in tap water several times to remove the O.C.T. compound. Then, the sections were stained with Alcian blue (Wako, pH 2.0), and then HE staining was performed. Trichrome stain (Masson) kit (Sigma, HT15-1KT) was used for trichrome staining. The stained sections were mounted using Softmount (Wako).
In situ hybridization
Request a detailed protocolISH was performed as described previously (Yamamoto et al., 2022). For probe synthesis, target genes cloned on pTAC-2 plasmid (BioDynamics Lab Inc) were amplified by PCR using M13 primers. PCR fragments were purified and used as an RNA probe template. RNA probe synthesis was performed with Sp6 or T7 RNA polymerase (Takara) for 3 hr, and RNA was hydrolyzed, depending on the length of targets. The sections were washed in PBT to remove the O.C.T. compound, treated with proteinase K (10 μg/ml) (Invitrogen)/PBT for 20 min at room temperature, washed in PBT, treated with 4% PFA/PBS for 20 min at room temperature, washed in PBT, and then probes were hybridized at 62.5°C for approximately 18 hr. The sections were washed in wash buffer 1 (formamide:H2O:20× SSC [3 M NaCl:0.3 M sodium citrate, pH 5.0] = 2:1:1), and then in wash buffer 2 (formamide:H2O:20× SSC = 5:1:4). The samples were then incubated with anti-digoxigenin-AP Fab fragments (Sigma-Aldrich, 1/1000) for 2 hr at room temperature. Samples were stained with BCIP (Nacalai Tesque) and NBT (Nacalai Tesque) in alkaline phosphatase buffer (0.1 M NaCl, 0.1 M Tris-HCl [pH 9.5], 0.1% Tween20) for 18 hr at room temperature after washing in TBST.
Immunofluorescence
Request a detailed protocolImmunofluorescence on sections was carried out based on a previous report (Yamamoto et al., 2022). The antibodies were as follows: anti-GFP (MBL, #598, 1/500), anti-acetylated alpha tubulin (Santa Cruz, #sc-23950, 1/1000), anti-mouse IgG Alexa 488 (Invitrogen, #A11017, 1/1000), and anti-rabbit IgG Alexa 488 (Invitrogen, #A21206, 1/500). Nuclei were stained with Hoechst (Nacalai Tesque), and images were captured using an Olympus BX51 system.
RNA-seq analysis
Request a detailed protocolTotal RNA was extracted from DorBL and VentBL at 10 dps using TriPure reagent (Roche), following the manufacturer’s instructions. Three biological replicates were prepared for both samples. 150 bp paired-end RNA-seq reads were obtained under contract to Rhelixa (Tokyo, Japan), using Illumina Nova Seq 6000 and SMART-Seq HT Plus Kit (#R400449). RNA-seq data were analyzed on Galaxy (https://usegalaxy.eu/root) as follows. Sequence reads were trimmed and the quality was filtered by Trimmomatic v0.39 (Bolger et al., 2014) with the following parameters (LEADING:20, TRAILING:20, SLIDINGWINDOW:4:15, and MINLEN:36). Axolotl genome data (AmexG_v6.0-DD) and annotation data (AmexT_v47-AmexG_v6.0-DD.gtf) were obtained from AXOLOTL-OMICS (https://www.axolotl-omics.org/) (Schloissnig et al., 2021). Mapping to the Axolotl genome (AmexG_v6.0-DD) was performed with HISAT2 v2.2.1 (Kim et al., 2015). Count data were obtained with featureCounts v2.0.8 (Liao et al., 2014) on the basis of the Axolotl gene model (AmexT_v47-AmexG_v6.0-DD.gtf). DEGs were identified with DESeq2 v2.11.40.8 (Love et al., 2014) (p < 0.05). Among identified DEGs (DorBL > VentBL; 762 genes, VentBL > DorBL; 513 genes), genes annotated as ‘intercellular signaling molecule’ were explored on PANTHER (https://www.pantherdb.org/; Thomas et al., 2003), and 21 genes (DorBL > VentBL; 5 genes, VentBL > DorBL; 16 genes) were identified as candidate genes of dorsal- and ventral-mediated signals, as shown below:
DorBL > VentBL:
WNT4 (AMEX60DD052091), WNT10B (AMEX60DD029981), SEMA3A (AMEX60DD023165), LECT2 (AMEX60DD041044), ANGPTL5 (AMEX60DD049512).
VentBL > DorBL:
FCN1 (AMEX60DD050926), CXCL14 (AMEX60DD028973), DNER (AMEX60DD002010), FGF7 (AMEX60DD003767), CXCL12 (AMEX60DD052412), CXCL8 (AMEX60DD044133), SEMA6A (AMEX60DD042813), ANGPTL2 (AMEX60DD050490), ANGPTL6 (AMEX60DD031854), FGL2 (AMEX60DD006387), VWDE (AMEX60DD022491), TGFB2 (AMEX60DD036126), FGF2 (AMEX60DD044865), EFNA4 (AMEX60DD014882), EFNA3 (AMEX60DD014867), ANGPTL1 (AMEX60DD018261).
Cloning candidate genes and preparation of construct vectors for overexpression
Request a detailed protocolAmong the identified candidate genes, we focused on Wnt10b, Wnt4, Fgf2, Fgf7, and Tgfb2. We cloned these genes in pTAC-2 plasmids from cDNA obtained from blastemas. The following primers were used:
Wnt10b Fwd: ATGGCCCACAGCTCACCCTCCGACACC
Wnt10b Rev: TCACTTGCACACATTCACCCATTCTGTG
Wnt4 Fwd: ATGGATGCTCACGAAAGCAGCGTATATC
Wnt4 Rev: TCACCGGCAGGTGTGCATTTCTACCAC
Fgf2 Fwd: ATGGCGGCGGGGAGCATCACCACCTTGC
Fgf2 Rev: TCAACTCTTGGCCGACATGGGAAGGAAAAG
Fgf7 Fwd: ATGCGCAGATGGGTGCTAGCTTGGATC
Fgf7 Rev: TCATGTGTTATTGGATATACGCATTGGA
Tgfb2 Fwd: ATGAGATTACAATTACTGAGAAAAAAAAATG
Tgfb2 Rev: TTAGCTGCACTTGCAAGATTTTACAATCA
We then inserted these genes to p2a-AcGFP-pCS2 vectors with In-Fusion HD Cloning Kit (Clontech). The following primers were used for PCR before In-Fusion reaction:
pCS2 inverse Fwd: GCTACTAACTTCAGCCTGCTGAAGCAGG
pCS2 inverse Rev: CATCGATGGGATCCTGCAAAAAGAACAAGTAGCTT
Wnt10b Fwd: AGGATCCCATCGATGGCCCACAGCTCACCCTCCGA
Wnt10b Rev: GCTGAAGTTAGTAGCCTTGCACACATTCACCCA
Wnt4 Fwd: AGGATCCCATCGATGGATGCTCACGAAAGCAGCG
Wnt4 Rev: GCTGAAGTTAGTAGCCCGGCAGGTGTGCATTTCTA
Fgf2 Fwd: AGGATCCCATCGATGGCGGCGGGGAGCATCACCA
Fgf2 Rev: GCTGAAGTTAGTAGCACTCTTGGCCGACATGGGAA
Fgf7 Fwd: AGGATCCCATCGATGCGCAGATGGGTGCTAGCTTG
Fgf7 Rev: GCTGAAGTTAGTAGCTGTGTTATTGGATATACGCA
Tgfb2 Fwd: AGGATCCCATCGATGAGATTACAATTACTGAGAAA
Tgfb2 Rev: GCTGAAGTTAGTAGCGCTGCACTTGCAAGATTTTA
Finally, the following DNA constructs were obtained: Wnt10b-p2a-GFP (pCS2), Wnt4-p2a-GFP (pCS2), Fgf2-p2a-GFP (pCS2), Fgf7-p2a-GFP (pCS2), and Tgfb2-p2a-GFP (pCS2).
Electroporation
Request a detailed protocolEach DNA construct was injected directly into the target region. Immediately after injection, electric pulses were applied (20 V, 50-ms pulse length, 950-ms interval, 10 times) with NEPA21 (Nepa gene). The injected DNA constructs were as follows: pCS2-AcGFP, pCS2-Shh-p2a-AcGFP, Wnt10b-p2a-GFP (pCS2), Wnt4-p2a-GFP (pCS2), Fgf2-p2a-GFP (pCS2), Fgf7-p2a-GFP (pCS2), and Tgfb2-p2a-GFP (pCS2). All plasmids were purified using a Genopure Maxi kit (Roche). Electroporation was performed at –3, 4, and 7 dps, and samples were fixed at 10 dps for ISH. To analyze the phenotype of 90 dps samples, electroporation was performed at –3, 4, 7, 10, 15, 20, 25, and 30 dps.
qRT-PCR
Request a detailed protocolThe procedures of qRT-PCR were previously described (Yamamoto et al., 2022). In brief, RT was performed using Prime Script II (Takara), and RT-qPCR was performed using KAPA SYBR FAST qPCR Master Mix (Kapa Biosystems) and StepOne (Thermo Fisher Scientific). For all biological replicates, at least four technical replicates were performed. Based on the QC criteria of the StepOne Software v2.1 system, measurements flagged as an outlier within a replicate group or showing multiple Tm peaks were excluded. Primers were as follows:
Ef-1α Fwd: AACATCGTGGTCATCGGCCAT
Ef-1α Rev: GGAGGTGCCAGTGATCATGTT
Shh Fwd: GCTCTGTGAAAGCAGAGAACTCG
Shh Rev: CGCTCCGTCTCTATCACGTAGAA
Axin2 Fwd: GGCACTGACTTATCCCCAGG
Axin2 Rev: GCATCATTGGCTGTCAACGG
Lef1 Fwd: CTACACCGAGATCAGCCACC
Lef1 Rev: GCTGTGGTAGGAGTTGTGGG
Lmx1b Fwd: CTGGTCCATGGCTACGATCT
Lmx1b Rev: TTAGCAGCAGAAACGGGACT
Wnt10b Fwd: CAGAAGAGACCCAGGTGCAG
Wnt10b Rev: CGAAGGCCCAAGATGTCTGT
Fgf2 Fwd: TCTTCCTTCGCATCAACCCC
Fgf2 Rev: TTTCATTGCCATCAACCGCC
RNA for Figure 5—figure supplement 1E was prepared from 1 μM BIO- or DMSO-treated VentBL at 14 dps. Ef-1α was used as the internal control.
Pixel classification and calculating symmetry scores
Request a detailed protocolA machine learning-based method was applied for pixel classification using ilastik software (downloaded on https://www.ilastik.org/). The details and workflows were previously described (Berg et al., 2019). Each pixel in the images was classified into five classes. The regions of the background (Class 1), cartilage (Class 2), muscle (Class 3), other connective tissue (Class 4), and epidermis (Class 5) were annotated for training data. Using these annotated regions as references, pixels were automatically classified into the respective classes. In this process, the same training data were used for images obtained from the same limb. Then, symmetry scores were calculated for each class individually and for the combined set of all classes. In this process, the external shape of the section, which could bend randomly during sample fixation process, would affect the symmetry scores if the entire region were used. To focus on the symmetry of the anatomical patterns, images with 400 μm width were prepared (Figures 4L and 5E, F). The symmetry scores of pixel-classified images were calculated using Python. First, the center of the dorsal end and ventral end was set as the axis of symmetry. Then, one side of the image was flipped. Next, color masks were generated for both sides of the image. These masks identified pixels that matched the specified color. Pixels were considered to match if their RGB values were within the given tolerance range for all three channels. In pixel comparison, the masks for one side and the other side were compared to calculate the following pixels:
Matching pixels: The number of pixels that match in both sides for the specified color.
Total pixels: The total number of pixels matching the color in either side.
The symmetry scores were computed as (number of matching pixels)/(total pixels in both sides). The scores were obtained from 12 areas of each group. For statistical analysis, a two-tailed Welch’s t-test was used. In this analysis, each group was compared to the intact limb group because the intact limb should be set as a typical asymmetrical structure.
Reanalyzing single-cell data
Request a detailed protocolWe reanalyzed published single-cell RNA-seq data from a 7 dpa (MB) blastema (Li et al., 2021, under accession code PRJNA589484, Figure 5—figure supplement 4). We constructed a transcriptome index for axolotl from the available genome assembly and gene annotation (AmexG_v6.0-DD genome and AmexT_v47-AmexG_v6.0-DD annotation, Schloissnig et al., 2021). The transcript set was used to build a salmon index with default k-mer length (31), and without decoy sequences, and gene-level UMI counts were generated using the Alevin module of salmon, which performs lightweight (quasi-)mapping of reads directly to the transcriptome index (Patro et al., 2017; Srivastava et al., 2019). The mapping was done on Galaxy (https://usegalaxy.eu). This procedure yielded a whitelist of 8925 barcodes, corresponding to putative cells, and produced a per-cell by per-gene UMI count matrix. According to the Alevin summary output, 77.4% of reads aligned to the indexed axolotl transcriptome after barcode correction and UMI deduplication. The resulting count matrix was exported in Matrix Exchange (MEX) format (matrix.mtx, barcodes.tsv, and features.tsv).
The data were then imported into R (RStudio environment) as a Seurat object, a data structure for scRNA-seq data (Hao et al., 2021). Cells were filtered based on standard quality-control metrics, excluding droplets with extremely low gene complexity, extremely high total UMI counts, or unusually high mitochondrial or ribosomal RNA content. For normalization and integration of cells into a shared space, counts were log-normalized using Seurat’s NormalizeData (default LogNormalize method with a scale factor of 10,000), and highly variable genes (HVGs) were identified using FindVariableFeatures (vst method; 2000 features). The data were scaled with ScaleData, and principal component analysis (PCA) was performed on the HVGs (RunPCA, 50 components). The first 30 principal components were used to construct a nearest-neighbor graph (FindNeighbors) and to perform community detection-based clustering (FindClusters, resolution = 0.3). The same set of PCs (dims 1:30) was also used for nonlinear dimensionality reduction by UMAP (RunUMAP). Gene expression patterns were visualized using FeaturePlot with order = TRUE so that high-expressing cells are drawn on top of low- or non-expressing cells. We also generated two-gene ‘co-expression’ maps by classifying cells as expressing gene A only, gene B only, both, or neither, and overlaying these classes on the UMAP using DimPlot.
Statistics and reproducibility
Request a detailed protocolWe did not employ strict statistical methods to determine the sample size, but given the high reproducibility of the results, we considered these sample sizes to be sufficient. The investigators were not blinded to allocation during the experiments or outcome assessment due to the nature of the sample preparation. In all experiments, strict randomization was not performed; however, the animals used were selected at random.
Data availability
RNA-seq FASTQ files have been deposited in the DNA Data Bank of Japan (DDBJ; https://www.ddbj.nig.ac.jp/) under BioProject accession PRJDB38065 and DRA accession DRA023661.
-
DNA Data Bank of Japan (DDBJ)ID PRJDB38065. RNA-seq of dorsally and ventrally blastemas induced by accessory limb model (ALM) at 10 days post surgery.
-
NCBI Sequence Read ArchiveID SRX7140465. blastema 7dpa.
References
-
A classification system for split-hand/ foot malformation (SHFM): A proposal based on 3 pedigrees with WNT10B mutationsEuropean Journal of Medical Genetics 63:103738.https://doi.org/10.1016/j.ejmg.2019.103738
-
ilastik: interactive machine learning for (bio)image analysisNature Methods 16:1226–1232.https://doi.org/10.1038/s41592-019-0582-9
-
Sequence variants in the WNT10B underlying non-syndromic split-hand/foot malformationMolecular Syndromology 14:469–476.https://doi.org/10.1159/000531069
-
Trimmomatic: a flexible trimmer for Illumina sequence dataBioinformatics 30:2114–2120.https://doi.org/10.1093/bioinformatics/btu170
-
Regenerative ability of double-half and half upper arms in the newt, Notophthalmus viridescensThe Journal of Experimental Zoology 204:307–323.https://doi.org/10.1002/jez.1402040302
-
Interactions between dorsal-ventral patterning genes lmx1b, engrailed-1 and wnt-7a in the vertebrate limbThe International Journal of Developmental Biology 46:937–941.https://doi.org/10.1387/ijdb.12455631
-
A stepwise model system for limb regenerationDevelopmental Biology 270:135–145.https://doi.org/10.1016/j.ydbio.2004.02.016
-
BookThe accessory limb model: an alternative experimental system of limb regenerationIn: Kumar A, Simon A, editors. Salamanders in Regeneration Research: Methods and Protocols. Springer Nature Link. pp. 101–113.https://doi.org/10.1007/978-1-4939-2495-0_8
-
Expression of FGF2 in the limb blastema of two Salamandridae correlates with their regenerative capabilityProceedings. Biological Sciences 270:2197–2205.https://doi.org/10.1098/rspb.2003.2439
-
Dermal fibroblasts contribute to multiple tissues in the accessory limb modelDevelopment, Growth & Differentiation 52:343–350.https://doi.org/10.1111/j.1440-169X.2009.01165.x
-
Stability and plasticity of positional memory during limb regeneration in Ambystoma mexicanumDevelopmental Dynamics 249:342–353.https://doi.org/10.1002/dvdy.96
-
BookBead implantation and delivery of exogenous growth factorsIn: Seifert AW, Currie JD, editors. Salamanders: Methods and Protocols. Springer. pp. 209–216.https://doi.org/10.1007/978-1-0716-2659-7_14
-
Wnt/β-catenin signaling regulates vertebrate limb regenerationGenes & Development 20:3232–3237.https://doi.org/10.1101/gad.1475106
-
HISAT: a fast spliced aligner with low memory requirementsNature Methods 12:357–360.https://doi.org/10.1038/nmeth.3317
-
FGF-2 influences cell movements and gene expression during limb developmentJournal of Experimental Zoology 274:234–247.https://doi.org/10.1002/(SICI)1097-010X(19960301)274:4<234::AID-JEZ4>3.0.CO;2-Q
-
Wnt10b-GSK3β-dependent Wnt/STOP signaling prevents aneuploidy in human somatic cellsLife Science Alliance 4:e202000855.https://doi.org/10.26508/lsa.202000855
-
Wnt signaling coordinates the expression of limb patterning genes during axolotl forelimb development and regenerationFrontiers in Cell and Developmental Biology 10:814250.https://doi.org/10.3389/fcell.2022.814250
-
Effects on adult newt limb regeneration of partial and complete skin flaps over the amputation surfaceThe Journal of Experimental Zoology 195:117–128.https://doi.org/10.1002/jez.1401950111
-
Positional memory in vertebrate regeneration: a century’s insights from the salamander limbCold Spring Harbor Perspectives in Biology 14:a040899.https://doi.org/10.1101/cshperspect.a040899
-
Tgf-β superfamily and limb regeneration: Tgf-β to start and Bmp to endDevelopmental Dynamics 251:973–987.https://doi.org/10.1002/dvdy.379
-
Regulation of proximal‐distal intercalation during limb regeneration in the axolotl (Ambystoma mexicanum)Development, Growth & Differentiation 52:785–798.https://doi.org/10.1111/j.1440-169X.2010.01214.x
-
Lmx-1b and Wnt-7a expression in axolotl limb during development and regenerationOkajimas Folia Anatomica Japonica 89:119–124.https://doi.org/10.2535/ofaj.89.119
-
Influence of head skin on limb regeneration in urodele amphibiansThe Journal of Experimental Zoology 150:5–15.https://doi.org/10.1002/jez.1401500103
-
On the process of reproduction of the members of the aquatic salamanderQuart J Sci Lit Arts Lib 16:84–86.
-
Inhibition of wound epidermis formation via full skin flap surgery during axolotl limb regenerationJournal of Visualized Experiments 160:e61522.https://doi.org/10.3791/61522
-
Homozygous WNT10b mutation and complex inheritance in Split-Hand/Foot MalformationHuman Molecular Genetics 17:2644–2653.https://doi.org/10.1093/hmg/ddn164
-
Lmx1b activation in axolotl limb regenerationDevelopmental Dynamics 251:1509–1523.https://doi.org/10.1002/dvdy.476
-
FGF7 and FGF10 directly induce the apical ectodermal ridge in chick embryosDevelopmental Biology 211:133–143.https://doi.org/10.1006/dbio.1999.9290
Article and author information
Author details
Funding
Japan Society for the Promotion of Science (20H03264)
- Akira Satoh
Japan Society for the Promotion of Science (24K02034)
- Akira Satoh
Japan Society for the Promotion of Science (24KJ1718)
- Sakiya Yamamoto
The funders had no role in study design, data collection, and interpretation, or the decision to submit the work for publication.
Acknowledgements
We are grateful to R Iwata and T Satoh for supporting office work and animal housing. Animals were obtained through Hiroshima University Amphibian Research Center. This work is supported by the Japan Society for the Promotion of Science KAKENHI grant-in-aid for scientific research (B) (20H03264 and 24K02034 to AS) and by a Grant-in-Aid for Japan Society for the Promotion of 805 Science fellows (24KJ1718 to SY).
Ethics
The care and treatment of the animals in this study was carried out under protocols approved by the Animal Care and Use Committee of Okayama University (reference no. 2024252). Every possible measure was taken to minimize animal suffering, in line with the NIH Guide for the Care and Use of Laboratory Animals.
Version history
- Sent for peer review:
- Preprint posted:
- Reviewed Preprint version 1:
- Reviewed Preprint version 2:
- Version of Record published:
Cite all versions
You can cite all versions using the DOI https://doi.org/10.7554/eLife.106917. This DOI represents all versions, and will always resolve to the latest one.
Copyright
© 2025, Yamamoto et al.
This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.
Metrics
-
- 1,229
- views
-
- 59
- downloads
-
- 2
- citations
Views, downloads and citations are aggregated across all versions of this paper published by eLife.
Citations by DOI
-
- 1
- citation for umbrella DOI https://doi.org/10.7554/eLife.106917
-
- 1
- citation for Reviewed Preprint v1 https://doi.org/10.7554/eLife.106917.1