Uev1A counteracts oncogenic Ras stimuli in both polyploid and diploid cells
- Department of Genetics and Cell Biology, College of Life Sciences, Nankai University, China
- Department of Biochemistry and Molecular Biology, College of Life Sciences, Nankai University, China
- Nankai International Advanced Research Institute (SHENZHEN FUTIAN), China
Figures
Figure 1
Genetic screen identifies Uev1A as a crucial protector against RasG12V-induced nurse cell death.
(A) Schematic cartoon for Drosophila ovariole. During oogenesis, germline stem cell (GSC) undergoes asymmetric division to generate two daughter cells: one that self-renews and maintains GSC identity, and the other, called a cystoblast, that differentiates to support oogenesis. As differentiation progresses, each cystoblast performs four rounds of division with incomplete cytokinesis to produce 16 interconnected cystocytes, establishing a germline cyst. This germline cyst is then surrounded by epithelial follicle cells to form an egg chamber. Within each egg chamber, one of the 16 germ cells becomes the oocyte, while the remaining 15 differentiate into nurse cells. These nurse cells undergo G/S endocycling, becoming polyploid to aid in oocyte development. (B) Representative germarium and early-stage egg chamber with Flag-RasG12V overexpression driven by bam-GAL4-VP16. The red arrow denotes an early-stage egg chamber. (C) Genetic screening strategy. Genotype of ‘bam>RasGG12V’: bam-GAL4-VP16/FM7;; UASp-RasG12V/TM6B. (D) Representative ovaries and egg chambers (DAPI staining). The red arrows in (D) denote degrading egg chambers. Scale bars: 200 μm. (E) Quantification data. 30 ovaries from 7-day-old flies were quantified for each genotype. Statistical significance was determined using t test (groups = 2) or one-way ANOVA (groups >2): ** (p<0.01) and *** (p<0.001).
Figure 2 with 1 supplement
Uev1A protects against the nurse cell death induced by direct overexpression of RasG12V.
(A, C, and F) Representative samples (DAPI staining). (B) Molecular information of the uev1aΔ1 and uev1aΔ2 mutations. The red dashed lines represent nucleotide deletions. (D and G) Quantification data. 30 ovaries from 3-day-old flies were quantified for each genotype. Statistical significance was determined using t test (groups = 2) or one-way ANOVA (groups>2): **** (p<0.0001). (E) Protein sequence alignment of Uev1A, UBE2V1, and UBE2V2. It was performed using CLUSTALW and ESPript 3.0 software.
Figure 2—figure supplement 1
Uev1A protects against Yki3SA-induced nurse cell death.
(A) Representative ovaries (DAPI staining). The red arrows denote degrading egg chambers. Scale bars: 200 μm. (B) Quantification data. 30 ovaries from 7-day-old flies were quantified for each genotype. Statistical significance was determined using t test: * (p<0.05) and **** (p<0.0001).
Figure 3 with 3 supplements
Roles of the DNA damage response (DDR) pathway and p53 in RasG12V-induced nurse cell death.
(A) Representative ovaries (DAPI staining). Scale bars: 200 μm. (B) Quantification data. 30 ovaries from 3-day-old flies were quantified for each genotype. Statistical significance was determined using one-way ANOVA: **** (p<0.0001). (C and E) Representative samples. Scale bars: 20 μm. (D) Schematic cartoon for uev1a-flag knock-in.
Figure 3—figure supplement 1
Oncogenic RasG12V intrinsically triggers nurse cell death.
(A) Representative ovaries (DAPI staining). Scale bars: 200 μm. (B) Quantification data. 30 ovaries from 3-day-old flies were quantified for each genotype. Statistical significance was determined using the t test: **** (p<0.0001).
Figure 3—figure supplement 2
Uev1A is expressed in stretch follicle cells.
Representative ovaries.
Figure 3—figure supplement 3
Uev1A does not directly degrade the RasG12V oncoproteins.
These experiments were performed at 29°C. All images are of the same magnification.
Figure 4
Uev1A collaborates with CycA to mitigate RasG12V-induced nurse cell death.
(A, C, E, and F) Representative ovaries. DAPI staining in (A and C). Scale bars: 200 μm in (A and C), 20 μm in (E and F). (B, D, and G) Quantification data. 30 ovaries (B and D) and 15 size-matched egg chambers (G) from 3-day-old flies were quantified for each genotype. Statistical significance was determined using t test (groups = 2) or one-way ANOVA (groups >2): **** (p<0.0001).
Figure 5 with 2 supplements
Uev1A collaborates with the anaphase-promoting complex or cyclosome (APC/C) complex to mitigate RasG12V-induced nurse cell death.
(A and C) Representative ovaries (DAPI staining). The red arrows in (A) denote degrading egg chambers. Scale bars: 200 μm. (B and D) Quantification data. 30 ovaries from 7-day-old (B) or 3-day-old (D) flies were quantified for each genotype. Statistical significance was determined using one-way ANOVA: **** (p<0.0001).
Figure 5—figure supplement 1
Expression pattern of Uev1A in germarium.
Representative sample.
Figure 5—figure supplement 2
Uev1A, Ben, and Cdc27 work together to protect nurse cells from death during normal oogenesis.
These experiments were performed at 29°C. (A) Representative ovaries (DAPI staining). The red arrows denote degrading egg chambers. Scale bars: 200 μm. (B) Quantification data. 30 ovaries from 7-day-old flies were quantified for each genotype. Statistical significance was determined using one-way ANOVA: **** (p<0.0001).
Figure 6 with 2 supplements
Uev1A, Ben, and Cdc27 work together to degrade CycA through the proteasome.
(A and B) Co-immunoprecipitation (co-IP) assays. The tagged proteins were co-expressed in S2 cells to assess physical interactions. As shown in (A), Uev1A interacts specifically with three APC/C subunits: Mr (APC2), Cdc16 (APC6), and Cdc23 (APC8). Assays in (B) demonstrate a physical interaction between CycA and Cdc27 (APC3). (C–E) CycA stability assays. CHX: a protein-synthesis inhibitor; MG132: a proteasome inhibitor; CQ: a lysosome inhibitor. In (D), the relative levels of CycA proteins were quantified using the following formula: (Mean gray value of the CycA/β-Actin band at n hours post-treatment) ÷ (Mean gray value of the CycA/β-Actin band at 0 hr). Three independent replicates were conducted at each time point, and statistical significance was determined using two-way ANOVA with multiple comparisons: **** (p<0.0001). (F and G) CycA ubiquitination assays in S2 cells. As shown in (F), Cdc27 promotes CycA ubiquitination in a Uev1A/Ben-dependent manner. Assays in (G) indicate that the K11 and K63 of ubiquitin are required for CycA ubiquitination.
-
Figure 6—source data 1
PDF files that contain original western blots indicating the relevant bands and treatments.
- https://cdn.elifesciences.org/articles/107104/elife-107104-fig6-data1-v1.zip
-
Figure 6—source data 2
Original files for western blot analysis.
- https://cdn.elifesciences.org/articles/107104/elife-107104-fig6-data2-v1.zip
Figure 6—figure supplement 1
Co-immunoprecipitation (co-IP) results.
The tagged proteins were co-expressed in S2 cells to assess physical interactions. Physical interaction was observed between Uev1A and Ben (A). No interaction was detected between Uev1A and Cdc27, Fzr, or Fzy (B, D, E), nor between Ben and Cdc27 (C).
-
Figure 6—figure supplement 1—source data 1
PDF files that contain original western blots indicating the relevant bands and treatments.
- https://cdn.elifesciences.org/articles/107104/elife-107104-fig6-figsupp1-data1-v1.zip
-
Figure 6—figure supplement 1—source data 2
Original files for western blot analysis.
- https://cdn.elifesciences.org/articles/107104/elife-107104-fig6-figsupp1-data2-v1.zip
Figure 6—figure supplement 2
RNAi efficiency assays.
The #1 double-stranded RNAs (dsRNAs) were employed in RNAi assays targeting uev1a, ben, and cdc27 in Figure 6C, D, and F.
-
Figure 6—figure supplement 2—source data 1
PDF files that contain original western blots indicating the relevant bands and treatments.
- https://cdn.elifesciences.org/articles/107104/elife-107104-fig6-figsupp2-data1-v1.zip
-
Figure 6—figure supplement 2—source data 2
Original files for western blot analysis.
- https://cdn.elifesciences.org/articles/107104/elife-107104-fig6-figsupp2-data2-v1.zip
Figure 7
Uev1A inhibits the overgrowth of germline tumors induced by oncogenic RasG12V.
(A and C) Representative ovaries (DAPI staining). All images in (A) are of the same magnification. Scar bars in (C): 200 μm. (B) Quantification data for ovarian size. The largest 2D area of each ovary in a single confocal focal plane was scanned, and its size was measured using ImageJ. 30 ovaries from 3-day-old flies were analyzed for each genotype. (D) Representative samples. The germline stem cells (GSCs) within stem cell niches are outlined by yellow dashed lines. Both images are of the same magnification. (E) Quantification data for GSC numbers per germarium. Germ cells that directly contact cap cells and contain dot-like spectrosomes were counted as GSCs. 100 germaria from 14-day-old flies were quantified for each genotype. In (B and E), statistical significance was determined using t test: n.s. (p>0.05) and * (p<0.05).
Figure 8 with 2 supplements
Prognostic significance and tumor-suppressive effects of UBE2V1 and UBE2V2 on KRAS-mutant colorectal cancer.
(A) Kaplan-Meier analysis of relapse-free survival in KRAS-mutant colorectal cancer patients with high or low expression levels of UBE2V1 and UBE2V2. (B and E) The knockdown efficiency assays. The relative mRNA levels were normalized to GAPDH. (C–G) Assays to evaluate the effects of UBE2V1- and UBE2V2-RNAi on colony formation and cell viability in SW480 and HCT116 cells. In (B, C, E, and F), three independent replicates were conducted, and statistical significance was determined using t test. In (D and G), five (D) and six (G) independent replicates were conducted at each time point, and statistical significance was determined using two-way ANOVA with multiple comparisons. * (p<0.05), *** (p<0.001), and **** (p<0.0001).
Figure 8—figure supplement 1
The Cancer Genome Atlas (TCGA) analysis comparing UBE2V1 and UBE2V2 expression levels in colorectal cancer patients with and without RAS mutations.
The TCGA patient data were downloaded from the UCSC Xena website: the RNA-seq data (Version: 05-09-2024) and the somatic mutation data (Version: 08-05-2024). Statistical significance was determined using t test: n.s. (p>0.05).
Figure 8—figure supplement 2
Knocking down either UBE2V1 or UBE2V2 alone mildly influences the growth of colorectal cancer cell lines.
(A and C) The knockdown efficiency assays. The relative mRNA levels were normalized to GAPDH. Three independent replicates were conducted, and statistical significance was determined using one-way ANOVA. (B and D) Assays to evaluate the effects of UBE2V1- and UBE2V2-RNAi on colony formation and cell viability in SW480 cells. Six independent replicates were conducted at each time point, and statistical significance was determined using two-way ANOVA with multiple comparisons. n.s. (p>0.05), * (p<0.05), ** (p<0.01), *** (p<0.001), and **** (p<0.0001).
Figure 9 with 2 supplements
Overexpression of UBE2V1 or UBE2V2 suppresses the growth of KRAS-mutant colorectal cancer.
(A and B) Subcutaneous tumorigenesis assays in nude mice, where tumors were excised, photographed, and weighed 28 days after tumor cell injection. (C and D) Immunohistochemical staining to assess CycA expression and Ki-67 positivity in tumor tissues. All images in (C) are of the same magnification. In (B-1), six independent replicates were conducted, and statistical significance was determined using two-way ANOVA with multiple comparisons. In (B-2 and D), six independent replicates were conducted, and statistical significance was determined using one-way ANOVA. ** (p<0.01), *** (p<0.001), and **** (p<0.0001). (E) Working model. By degrading CycA, Uev1A and the E3 APC/C complex counteract oncogenic Ras stimuli, thereby protecting against cell death in polyploid Drosophila nurse cells and suppressing overgrowth in diploid Drosophila germline and human colorectal tumor cells.
Figure 9—figure supplement 1
Validation of UBE2V1/2 overexpression in colorectal cancer cell lines.
(A) Western blotting to confirm the transient overexpression of UBE2V1 and UBE2V2 in SW480 and HCT116 cell lines. β-Actin was used as the loading control. (B) Western blotting to confirm the stable overexpression of UBE2V1 and UBE2V2 in SW480 cells, with UBE2V1-OE #1 and UBE2V2 #3 cell lines utilized in subcutaneous tumorigenesis assays. α-Tubulin was used as the loading control. In both (A) and (B), cells transfected with an empty overexpression vector served as the control.
-
Figure 9—figure supplement 1—source data 1
PDF files that contain original western blots indicating the relevant bands and treatments.
- https://cdn.elifesciences.org/articles/107104/elife-107104-fig9-figsupp1-data1-v1.zip
-
Figure 9—figure supplement 1—source data 2
Original files for western blot analysis.
- https://cdn.elifesciences.org/articles/107104/elife-107104-fig9-figsupp1-data2-v1.zip
Figure 9—figure supplement 2
UBE2V1/2 overexpression suppresses the growth of colorectal cancer cell lines.
(A and B) 5-Ethynyl-2’-deoxyuridine (EdU) incorporation assays to assess the effects of UBE2V1 and UBE2V2 overexpression (OE) on cell proliferation in SW480 and HCT116 cells. Empty OE vector was used as the control. All images in (A) are of the same magnification. (C–E) Assays to evaluate the effects of UBE2V1- and UBE2V2-OE on colony formation and cell viability in SW480 and HCT116 cells. In (B and D), three independent replicates were conducted, and statistical significance was determined using one-way ANOVA. In (E), five independent replicates were conducted, and statistical significance was determined using two-way ANOVA with multiple comparisons. * (p<0.05), ** (p<0.01), and **** (p<0.0001).
Tables
Appendix 1—key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background (Mus musculus) | Balb/c (CAnN.Cg-Foxn1nu/Crl) nude mice | Beijing Vital River Laboratory Animal Technology Co., Ltd. | 401 | |
| Genetic reagent (Drosophila melanogaster) | bam-GAL4-VP16 | Chen and McKearin, 2003 | ||
| Genetic reagent (D. melanogaster) | nos-GAL4-VP16 | Van Doren et al., 1998 | ||
| Genetic reagent (D. melanogaster) | nos-cas9 | Kondo and Ueda, 2013 | ||
| Genetic reagent (D. melanogaster) | FRT2A | BDSC | 1997 | |
| Genetic reagent (D. melanogaster) | puc-lacZ | Bloomington Drosophila Stock Center (BDSC) | 98329 | |
| Genetic reagent (D. melanogaster) | UAS-bam-RNAi | BDSC | 33631 | |
| Genetic reagent (D. melanogaster) | UASp-BicD-RNAi | TsingHua Fly Center (THFC) | THU4454 | |
| Genetic reagent (D. melanogaster) | UASp-cdc27-RNAi | THFC | TH201500102.S | |
| Genetic reagent (D. melanogaster) | UASp-Cdk1 | BDSC | 65396 | |
| Genetic reagent (D. melanogaster) | UASp-CycA | BDSC | 85308 | |
| Genetic reagent (D. melanogaster) | UASp-CycB | BDSC | 85312 | |
| Genetic reagent (D. melanogaster) | UASp-dsor1-RNAi | THFC | THU0677 | |
| Genetic reagent (D. melanogaster) | UASp-fzr-RNAi | THFC | TH201500745.S | |
| Genetic reagent (D. melanogaster) | UASp-GFP | Zhang et al., 2024a | ||
| Genetic reagent (D. melanogaster) | UASp-GFP-RNAi | BDSC | 44412, 44415 | |
| Genetic reagent (D. melanogaster) | UASz-lacZ | Zhang et al., 2024b | ||
| Genetic reagent (D. melanogaster) | UASp-lmgA-RNAi | THFC | THU4085 | |
| Genetic reagent (D. melanogaster) | UASp-lok-RNAi | THFC | TH01867.N | |
| Genetic reagent (D. melanogaster) | UASp-mr-RNAi | THFC | THU5250 | |
| Genetic reagent (D. melanogaster) | UASp-p53-RNAi | THFC | THU5318 | |
| Genetic reagent (D. melanogaster) | UASp-RasG12V | Zhang et al., 2024b | ||
| Genetic reagent (D. melanogaster) | UASp-rl-RNAi | THFC | THU3530 | |
| Genetic reagent (D. melanogaster) | UASp-shtd-RNAi | THFC | TH201500835.S | |
| Genetic reagent (D. melanogaster) | UASp-Stg | BDSC | 58439 | |
| Genetic reagent (D. melanogaster) | UASp-tefu-RNAi | THFC | THU5591 | |
| Genetic reagent (D. melanogaster) | UASp-uev1a-RNAi | BDSC | 66947 | |
| Genetic reagent (D. melanogaster) | UASz-flag-RasG12V | This paper | Construction information described in the Materials and methods section | |
| Genetic reagent (D. melanogaster) | UASz-UBE2V1 | This paper | Construction information described in the Materials and methods section | |
| Genetic reagent (D. melanogaster) | UASz-UBE2V2 | This paper | Construction information described in the Materials and methods section | |
| Genetic reagent (D. melanogaster) | UASz-uev1a | This paper | Construction information described in the Materials and methods section | |
| Genetic reagent (D. melanogaster) | UASz-Yki3SA | Zhang et al., 2024a | ||
| Genetic reagent (D. melanogaster) | nos-int; attP40 | BDSC | 79604 | |
| Genetic reagent (D. melanogaster) | uev1a Δ1 | This paper | Construction information described in the Materials and methods section | |
| Genetic reagent (D. melanogaster) | uev1a Δ2 | This paper | Construction information described in the Materials and methods section | |
| Genetic reagent (D. melanogaster) | uev1a-flag | This paper | Construction information described in the Materials and methods section | |
| Genetic reagent (D. melanogaster) | All deficiency Drosophila strains (including 7584) | The Core Facility of Drosophila Resource and Technology (CEMCS), Chinese Academy of Sciences (CAS), China | The stock numbers are the same as in BDSC | |
| Cell line (D. melanogaster) | Schneider 2 (S2) cells | Beyotime Biotechnology | Cat# C7925, RRID:CVCL_Z232 | |
| Cell line (Homo sapiens) | 293T cells | The American Type Culture Collection (ATCC) | Cat# CRL-3216, RRID:CVCL_0063 | |
| Cell line (H. sapiens) | HCT116 cells | ATCC | Cat# CCL-247, RRID:CVCL_VU38 | |
| Cell line (H. sapiens) | SW480 cells | ATCC | Cat# CCL-228, RRID:CVCL_0546 | |
| Transfected construct (H. sapiens) | Control shRNA | This paper | CCTAAGGTTAAGTCGCCCTCG | |
| Transfected construct (H. sapiens) | UBE2V1 shRNA #1 | This paper | CTCGGGCAGATGACATGAAAT | |
| Transfected construct (H. sapiens) | UBE2V1 shRNA #2 | This paper | GCATCACCACAGGCTGGCTCA | |
| Transfected construct (H. sapiens) | UBE2V2 shRNA #1 | This paper | GTCTTAAATCAACAACCTTCT | |
| Transfected construct (H. sapiens) | UBE2V2 shRNA #2 | This paper | GCTCCTCCGTCAGTTAGATTT | |
| Antibody | Anti-α-Spectrin (Mouse monoclonal) | Developmental Studies Hybridoma Bank (DSHB) | RRID:AB_528473 | IF (1:100) |
| Antibody | Anti-β-Actin (Mouse monoclonal) | Abmart | RRID:AB_2936240 | WB (1:5000) |
| Antibody | Anti-β-Actin (Mouse monoclonal) | Zenbio | Cat# 200068-8F10 | WB (1:5000) |
| Antibody | Anti-CycA (Rabbit polyclonal) | Whitfield et al., 1990 | IF (1:1000) | |
| Antibody | Anti-Flag (Mouse monoclonal) | Sigma | Cat# F1804, RRID:AB_262044 | IF (1:500) |
| Antibody | Anti-Flag (Mouse monoclonal) | Utibody | Cat# UM3009 | IP (1:200), WB (1:5000) |
| Antibody | Anti-γH2AV (Mouse monoclonal) | DSHB | PRID: AB_2618077 | IF (1:200) |
| Antibody | Anti-HA (Mouse monoclonal) | Utibody | Cat# UM3004 | IP (1:200), WB (1:3000) |
| Antibody | Anti-Myc (Mouse monoclonal) | Utibody | Cat# UM3011 | IP (1:200), WB (1:3000) |
| Antibody | Anti-UBE2V2 (Mouse monoclonal) | Santa Cruz Biotechnology | Cat# sc-377254 | WB (1:2000) |
| Antibody | Anti-α-Tubulin (Rabbit polyclonal) | Proteintech | Cat# 14555-1-AP | WB (1:5000) |
| Antibody | Anti-β-Tubulin (Rabbit polyclonal) | Zenbio | Cat# 380628 | WB (1:5000) |
| Antibody | Anti-CycA (Rabbit polyclonal) | Immunoway | Cat# YT1167 | IF (1:200) |
| Antibody | Anti-Flag (Rabbit monoclonal) | Zenbio | Cat# R24091 | IP (1:200), WB (1:5000) |
| Antibody | Anti-HA (Rabbit monoclonal) | Zenbio | Cat# 301113 | IP (1:200), WB (1:3000) |
| Antibody | Anti-Ki67 (Rabbit polyclonal) | Proteintech | Cat# 27309-1-AP | IF (1:2000) |
| Antibody | Anti-Myc (Rabbit polyclonal) | ABclonal | Cat# AE009 | IP (1:200), WB (1:3000) |
| Antibody | Anti-UBE2V1 (Rabbit polyclonal) | Wanleibio | Cat# WL04482 | WB (1:2000) |
| Antibody | Alexa Fluor 546 goat anti-mouse | Invitrogen | Cat# A-11030 | IF (1:2000) |
| Antibody | HRP Goat anti-Mouse IgG(H+L) | SIMUBIOTECH | Cat# S2002 | IF (1:2000) |
| Antibody | HRP Goat anti-Rabbit IgG(H+L) | SIMUBIOTECH | Cat# S2001 | IF (1:2000) |
| Recombinant DNA reagent | pCDH-CMV | Addgene | RRID:Addgene_72265 | |
| Recombinant DNA reagent | pCDH-CMV-UBE2V1 | This paper | Construction information described in the Materials and methods section | |
| Recombinant DNA reagent | pCDH-CMV-UBE2V2 | This paper | Construction information described in the Materials and methods section | |
| Recombinant DNA reagent | pCFD3 | Addgene | RRID:Addgene_49410 | |
| Recombinant DNA reagent | pCFD3-uev1a-gRNA-1 | This paper | Construction information described in the Materials and methods section | |
| Recombinant DNA reagent | pLKO-CMV-puro | Addgene | RRID:Addgene_131700 | |
| Recombinant DNA reagent | pLKO-CMV-copGFP-puro-shNC | This paper | Construction information described in the Materials and methods section | |
| Recombinant DNA reagent | pLKO-CMV-copGFP-puro-shUBE2V1-#1 | This paper | Construction information described in the Materials and methods section | |
| Recombinant DNA reagent | pLKO-CMV-copGFP-puro-shUBE2V1-#2 | This paper | Construction information described in the Materials and methods section | |
| Recombinant DNA reagent | pLKO-CMV-copGFP-puro-shUBE2V2-#1 | This paper | Construction information described in the Materials and methods section | |
| Recombinant DNA reagent | pLKO-CMV-copGFP-puro-shUBE2V2-#2 | This paper | Construction information described in the Materials and methods section | |
| Recombinant DNA reagent | pMD2.G | Addgene | RRID:Addgene_12259 | |
| Recombinant DNA reagent | psPAX2 | Addgene | RRID:Addgene_12260 | |
| Recombinant DNA reagent | pU6-BbsI-chiRNA | Addgene | RRID:Addgene_45946 | |
| Recombinant DNA reagent | pU6-uev1a-gRNA-2 | This paper | Construction information described in the Materials and methods section | |
| Recombinant DNA reagent | pUASt-attB | Drosophila Genomics Resource Center (DGRC) | RRID:DGRC_1419 | |
| Recombinant DNA reagent | pUASt-APC7-Myc | This paper | Construction information described in the Materials and methods section | |
| Recombinant DNA reagent | pUASt-Flag-ben | This paper | Construction information described in the Materials and methods section | |
| Recombinant DNA reagent | pUASt-Flag-cycA | This paper | Construction information described in the Materials and methods section | |
| Recombinant DNA reagent | pUASt-HA-Ub | This paper | Construction information described in the Materials and methods section | |
| Recombinant DNA reagent | pUASt-HA-Ub7KR | This paper | Construction information described in the Materials and methods section | |
| Recombinant DNA reagent | pUASt-HA-Ub6KR+K11 | This paper | Construction information described in the Materials and methods section | |
| Recombinant DNA reagent | pUASt-HA-Ub6KR+K48 | This paper | Construction information described in the Materials and methods section | |
| Recombinant DNA reagent | pUASt-HA-Ub6KR+K63 | This paper | Construction information described in the Materials and methods section | |
| Recombinant DNA reagent | pUASt-HA-uev1a | This paper | Construction information described in the Materials and methods section | |
| Recombinant DNA reagent | pUASt-Myc-APC4 | This paper | Construction information described in the Materials and methods section | |
| Recombinant DNA reagent | pUASt-Myc-Cdc16 | This paper | Construction information described in the Materials and methods section | |
| Recombinant DNA reagent | pUASt-Myc-Cdc23 | This paper | Construction information described in the Materials and methods section | |
| Recombinant DNA reagent | pUASt-Myc-Cdc27 | This paper | Construction information described in the Materials and methods section | |
| Recombinant DNA reagent | pUASt-Myc-Fzr | This paper | Construction information described in the Materials and methods section | |
| Recombinant DNA reagent | pUASt-Myc-Fzy | This paper | Construction information described in the Materials and methods section | |
| Recombinant DNA reagent | pUASt-Myc-Ida | This paper | Construction information described in the Materials and methods section | |
| Recombinant DNA reagent | pUASt-Myc-Mr | This paper | Construction information described in the Materials and methods section | |
| Recombinant DNA reagent | pUASz1.0 | DGRC | RRID:DGRC_1431 | |
| Recombinant DNA reagent | pUASz-flag-RasG12V | This paper | Construction information described in the Materials and methods section | |
| Recombinant DNA reagent | pUASz-UBE2V1 | This paper | Construction information described in the Materials and methods section | |
| Recombinant DNA reagent | pUASz-UBE2V2 | This paper | Construction information described in the Materials and methods section | |
| Recombinant DNA reagent | pUASz-uev1a | This paper | Construction information described in the Materials and methods section | |
| Recombinant DNA reagent | pUASz-uev1a-donor | This paper | Construction information described in the Materials and methods section | |
| Recombinant DNA reagent | pUASz-Yki3SA | This paper | Construction information described in the Materials and methods section | |
| Sequence-based reagent | uev1a#1_F | This paper | PCR primers | GAATTAATACGACTCACTATAGGGAGAACGGAATTTCCGCTTACTG |
| Sequence-based reagent | uev1a#1_R | This paper | PCR primers | GAATTAATACGACTCACTATAGGGAGACGGACCGATGATCATGCC |
| Sequence-based reagent | uev1a#2_F | This paper | PCR primers | GAATTAATACGACTCACTATAGGGAGACACTAAAGATCGAGTGCG |
| Sequence-based reagent | uev1a#2_R | This paper | PCR primers | GAATTAATACGACTCACTATAGGGAGATGCCAGCTTCAGGTTCTC |
| Sequence-based reagent | ben#1_F | This paper | PCR primers | GAATTAATACGACTCACTATAGGGAGACCACGTCGCATCATCAAG |
| Sequence-based reagent | ben#1_R | This paper | PCR primers | GAATTAATACGACTCACTATAGGGAGAAGTCTTCGACGGCATATTTC |
| Sequence-based reagent | ben#2_F | This paper | PCR primers | GAATTAATACGACTCACTATAGGGAGACAGATCCGGACCATATTG |
| Sequence-based reagent | ben#2_R | This paper | PCR primers | GAATTAATACGACTCACTATAGGGAGATCAGTCTTCGACGGCATATTTC |
| Sequence-based reagent | cdc27#1_F | This paper | PCR primers | GAATTAATACGACTCACTATAGGGAGATCGCCCAGGATCTGATTAAC |
| Sequence-based reagent | cdc27#1_R | This paper | PCR primers | GAATTAATACGACTCACTATAGGGAGAGCAGCGACAGATCCTTCTTC |
| Sequence-based reagent | cdc27#2_F | This paper | PCR primers | GAATTAATACGACTCACTATAGGGAGAGATGATGGGCAAAAAGCTAAAG |
| Sequence-based reagent | cdc27#2_R | This paper | PCR primers | GAATTAATACGACTCACTATAGGGAGACCATCGGCCGATTGTTTC |
| Sequence-based reagent | AcGFP-F | This paper | PCR primers | GAATTAATACGACTCACTATAGGGAGATGCACCACCGGCAAGCTGCCTG |
| Sequence-based reagent | AcGFP-R | This paper | PCR primers | GAATTAATACGACTCACTATAGGGAGAGGCCAGCTGCACGCTGCCATC |
| Sequence-based reagent | GAPDH-F | This paper | PCR primers | ACAACTTTGGTATCGTGGAAGG |
| Sequence-based reagent | GAPDH-R | This paper | PCR primers | GCCATCACGCCACAGTTTC |
| Sequence-based reagent | UBE2V1-F | This paper | PCR primers | CGGGCTCGGGAGTAAAAGTC |
| Sequence-based reagent | UBE2V1-R | This paper | PCR primers | AGGCCCAATTATCATCCCTGT |
| Sequence-based reagent | UBE2V2-F | This paper | PCR primers | TGGACAGGCATGATTATTGGGC |
| Sequence-based reagent | UBE2V2-R | This paper | PCR primers | CTAACACTGGTATGCTCCGGG |
| Commercial assay or kit | BCA Protein Assay Kit | Beyotime Biotechnology | Cat# P0012 | |
| Commercial assay or kit | CCK8 Kit | APExBIO | Cat# K1018 | |
| Commercial assay or kit | EdU Incorporation Assay Kit | Beyotime Biotechnology | Cat# C0075 | |
| Commercial assay or kit | SPARKscript II All-in-one RT SuperMix kit | SparkJade | Cat# AG0305-C | |
| Commercial assay or kit | SYBR Green Premix Pro Taq HS qPCR kit | ACCURATE BIOLOGY | Cat# AG11701-S | |
| Commercial assay or kit | T7 RiboMAX Express RNAi System | Promega | Cat# P1700 | |
| Commercial assay or kit | TriQuick Reagent kit | Solarbio | Cat# R1100 | |
| Chemical compound, drug | Chloroquine (CQ) | Selleck | Cat# S6999 | |
| Chemical compound, drug | Cycloheximide (CHX) | MCE | Cat# HY-12320 | |
| Chemical compound, drug | MG132 | Selleck | Cat# S2619 | |
| Chemical compound, drug | Protein G Sepharose | Cytiva | Cat# 17061801 | |
| Chemical compound, drug | Puromycin | Solarbio | Cat# P8230 | |
| Software, algorithm | Adobe Photoshop 2022 | San Jose, CA, USA | RRID:SCR_014199 | |
| Software, algorithm | ImageJ | NIH | RRID:SCR_003070 | |
| Software, algorithm | GraphPad Prism | GraphPad Software, Inc | RRID:SCR_002798 | |
| Other | DMSO | Macklin | Cat# D6258 | |
| Other | Dulbecco’s Modified Eagle Medium | Gibco | Cat# C11995500BT | |
| Other | Fetal Bovine Serum (FBS) | Lonsera | Cat# S711-001S | |
| Other | Insect Culture Medium | Union | Cat# UK1000 | |
| Other | Lipofectamine 2000 | Thermo Fisher | 11668027 |
Additional files
-
MDAR checklist
- https://cdn.elifesciences.org/articles/107104/elife-107104-mdarchecklist1-v1.docx
-
Source data 1
Screen results.
- https://cdn.elifesciences.org/articles/107104/elife-107104-data1-v1.xlsx
-
Source data 2
All genotypes.
- https://cdn.elifesciences.org/articles/107104/elife-107104-data2-v1.xlsx
-
Source data 3
Raw quantification data.
- https://cdn.elifesciences.org/articles/107104/elife-107104-data3-v1.xlsx
Download links
A two-part list of links to download the article, or parts of the article, in various formats.
Downloads (link to download the article as PDF)
Open citations (links to open the citations from this article in various online reference manager services)
Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)
Uev1A counteracts oncogenic Ras stimuli in both polyploid and diploid cells
eLife 14:RP107104.
https://doi.org/10.7554/eLife.107104.3
