Starvation of the bacterium Vibrio atlanticus induces simultaneous attacks on the dinoflagellate Alexandrium pacificum
eLife Assessment
This important study convincingly shows that Vibrio bacteria act as predators of ecologically significant algae that contribute to harmful blooms in the lab and in their natural habitat, and that predation is induced by starvation. The authors suggest a working model that can be the basis for future work on this system. The study will be very impactful to those interested in the diversity of microbial predator-prey interactions and controlling toxic algal bloom.
https://doi.org/10.7554/eLife.107221.4.sa0Important: Findings that have theoretical or practical implications beyond a single subfield
- Landmark
- Fundamental
- Important
- Valuable
- Useful
Convincing: Appropriate and validated methodology in line with current state-of-the-art
- Exceptional
- Compelling
- Convincing
- Solid
- Incomplete
- Inadequate
During the peer-review process the editor and reviewers write an eLife Assessment that summarises the significance of the findings reported in the article (on a scale ranging from landmark to useful) and the strength of the evidence (on a scale ranging from exceptional to inadequate). Learn more about eLife Assessments
Abstract
Phytoplankton serve as a source of nutrients for bacteria in the marine environment. The interactions between algae and bacteria are known to include mutualism, commensalism, competition, or antagonism. This occurs in the microenvironment surrounding phytoplankton cells, the phycosphere, an interface rich in nutrients and organic molecules exuded by the cells. Here, based on in situ observations and on an in vitro interaction study, we report on a novel form of starvation-induced hunting that the cells of selected Vibrio species exert on dinoflagellates. The results showed that Vibrio atlanticus was capable of attacking and killing the dinoflagellate Alexandrium pacificum ACT03. Briefly, the observed mechanism of algal-killing consists of first, the ‘immobilization stage’ involving the secretion of algicidal metabolites that disrupt the flagella of the algae. In the ‘attack stage’, Vibrios simultaneously surround algal cells at high density for a brief period without invading them. Finally, the ‘killing stage’ in which the lysis and consumption of the dinoflagellates occur. By using a combination of biochemical, proteomic, molecular, and fluorescence microscopy approaches, we showed that this relationship is not related to the decomposition of algal organic matter, Vibrio quorum-sensing pathways, toxicity of the algae, or pathogenicity of the bacterium but is conditioned by nutrient stress, iron availability, and linked to the iron-vibrioferrin transport system of V. atlanticus. This is the first evidence of a new mechanism that could be involved in regulating Alexandrium spp. blooms and giving Vibrio a competitive advantage in obtaining nutrients from the environment. The interaction model we propose here suggests that Vibrio could play a role in regulating the proliferation of Alexandrium spp., giving it a competitive advantage in obtaining nutrients from the environment.
Introduction
Harmful algal blooms (HABs) have experienced an increase in their occurrence, intensity, and geographical distribution on a global scale, resulting in adverse environmental, health, and socioeconomic impacts (Marampouti et al., 2021). HABs have a considerable impact on human health as a result of direct exposure to volatile toxins or by toxic seafood consumption (Burkholder et al., 2018). From an ecological point of view, the expansion of HABs can result in the erosion of biodiversity because they cause massive mortality of marine species and they are generally monospecific in nature (Chai et al., 2020). In coastal areas, understanding the biological interactions that control toxic algal blooms is therefore a major ecological challenge. Among HAB-causing organisms, a number of Alexandrium species have been placed on the list of invasive Mediterranean species. Among them, Alexandrium pacificum is a flagellated eukaryotic unicellular organism that together with Alexandrium tamarense and Alexandrium fundyense forms the ‘Alexandrium tamarense’ complex responsible for paralytic shellfish poisoning (PSP) worldwide (Hadjadji et al., 2020). Since 1998, A. pacificum (former A. catenella) was monitored by the French phytoplankton observation and monitoring network (Rephy) in the Thau lagoon (French Mediterranean) because it produces paralytic shellfish toxins (PSTs) resulting in PSP syndrome.
Laanaia (Laanaia et al., 2013) showed that in Thau lagoon, a water temperature around 20 °C for several days and organic and inorganic nutrients in sufficient concentrations are parameters favoring the development of A. pacificum, whose massive blooms occur in autumn. Algal blooms are seasonal events resulting in a rapid increase in the concentration of a species of algae in an aquatic environment. Depending on the species of phytoplankton, tolerance to physicochemical parameters varies, which influences when blooms occur (Rijal Leblad et al., 2020). Interestingly, although the collapse of phytoplankton blooms has been previously attributed to viruses (Pal et al., 2020), some ecological studies have suggested an important role of algicidal bacteria (Su et al., 2007; Wang et al., 2010). Among them, several are belonging to the Vibrio genus (Li et al., 2014; Wang et al., 2020).
Vibrio (class γ-proteobacteria) are common microorganisms in marine systems worldwide (Baker-Austin et al., 2017; Mavian et al., 2020), where they are important components of the food chain, particularly in biodegradation, nutrient regeneration, and biogeochemical cycles (Oberbeckmann et al., 2012). Vibrio is one of the most studied bacterial taxa due to their ubiquity in coastal marine systems and their capacity to cause infections in humans and animals, leading sometimes to epizootic or zoonotic epidemics (Roux et al., 2015; Mavian et al., 2020). Vibrio are extremely adaptable to their environment (Johnson, 2013). The main factors influencing their occurrence and distribution in water are temperature, salinity, nutrient availability (Wang et al., 2020), multiple strategies such as biofilm formation on biotic and abiotic surfaces (Espinoza-Vergara et al., 2020), or interactions with a multitude of other organisms such as eukaryotic predators (Drebes Dörr and Blokesch, 2020) or plankton (Lopez-Joven et al., 2018) are used by Vibrio in the environment. There is also evidence that global climate change has increased Vibrio-associated illnesses affecting humans and animals (Brumfield et al., 2021; Muhling et al., 2017). However, the drivers and dynamics of Vibrio survival and propagation in the marine environment are not yet fully understood.
A substantial number of research articles have highlighted the potential of γ-proteobacteria to exert algicidal activity against dinoflagellates, supporting the hypothesis that γ-proteobacteria such as Vibrio play a role in the control of algal blooms in situ (Coyne et al., 2022). However, the mechanisms behind Vibrio-driven algal lysis in the environment remain to be elucidated. Particularly, it is unclear how in the water column, algicidal compounds secreted by bacteria can concentrate around the algae to exert their lytic effect.
This study aims to describe observations made in the natural environment between Vibrio bacteria and Alexandrium algal blooms, and to determine in vitro the main factors involved in this relationship. Using a combination of biochemical, proteomic, molecular, and fluorescence microscopy approaches, we explored the role in algal toxicity, bacterial pathogenicity, and the quorum-sensing (QS) pathway on this relationship and showed the important role of nutrient stress and the iron uptake pathway in this unique Vibrio/Alexandrium interaction.
Methods
Quantification of Alexandrium algae and Vibrio bacteria in the environment by qPCR
Seawater samples were collected in the Thau Lagoon (southern France, a shallow Mediterranean ecosystem open to the sea Abadie et al., 1999), during spring and autumn 2015. Briefly, samples were collected from the subsurface (–50 cm) near an oyster table at a phytoplankton surveillance site (part of the REPHY network, N 43°26.058’ and E 003°39.878’). Once a week during spring and autumn 2015, during field sampling campaigns, 20 L of water was filtered on board through a 180-μm-pore-size nylon membrane. At the laboratory, according to Lopez-Joven et al., 2018 seawater was fractionated into two size classes as follows: 2 L of the above filtrate was filtered through a 0.8-μm-pore-size polycarbonate Whatman Nuclepore membrane to obtain organisms in the 0.8–180 μm range corresponding to plankton-associated Vibrio and living Alexandrium forms. Then, the filtrate from the 0.8 µm membrane was filtered again through a 0.2-μm-pore-size polycarbonate Whatman Nuclepore membrane until the membrane was saturated. Alexandrium cells, ranging from 25 to 40 µm, belong to the microphytoplankton and are therefore retained in the 0.8–180 µm fraction. Any Vibrio cells potentially associated with or attached to Alexandrium cells will also be retained in this fraction. Vibrio cells are approximately 0.5–0.8 µm thick. The fraction between 0.2 and 0.8 µm therefore includes the free-living Vibrio. The bacterial population collected on 0.8-µm-pore-size filters was designated the particle-associated community, and the population on 0.2-µm-pore-size filters was designated as the free-living community. Membranes (in triplicate) were then conserved in 500 µL of 100% EtOH at –20 °C. Environmental DNA (eDNA) was extracted from the MF Millipore membrane using the Macherey-Nagel NucleoSpin Tissue Kit and resuspended in 100 µL of water. The samples were then stored at –20 °C after eDNA quantity and purity were assessed using a NanoDrop system (NanoDrop Technologies, Wilmington, DE, USA). PCR amplification reactions were done on a Roche LightCycler 480 Real-Time thermocycler (qPHD platform, University of Montpellier, France) using specific primer pairs (Table 3). Typically, the reactions contained 1 µL of template DNA (the DNA concentration for all samples varied from 1 to 40 μg mL−1), 0.5 µL of each primer (3.33 µM), and 4 µL of reaction mixture (SYBR Green Master Mix) in a total volume of 6 μL. The reaction parameters were as follows: 5 min at 95 °C (initial denaturation) and 40 cycles of 10 s at 95 °C (denaturation), 10 s at the corresponding hybridization temperature (Table 3), and 10 s at 72 °C (elongation). Melting curve profiles were generated by increasing the temperature from 65°C to 95°C at 0.5 °C s–1. Amplification products were analyzed using LightCycler software (Roche Diagnostics). Vibrio spp. and A. pacificum and A. tamarense were quantified by constructing calibration curves based on DNA from the Vibrio atlanticus LGP32 reference strain (former V. tasmaniensis LGP32) and from the A. pacificum reference strain (ACT03: A. catenella strain isolated from Thau in 2003) and the A. tamarense reference strain (ATT07: A. tamarense isolated from Thau in 2007) (not shown).
Strains and growth conditions
Vibrio strains. Wild-type and isogenic mutants of V. atlanticus LGP32 (Table 1) were used in this study. Deletion-mutants included ΔluxR, ΔluxS, ΔluxM, and ΔpvuB isogenic strains. The ΔpvuB mutant was constructed here by allelic exchange as described previously by Le Roux (Le Roux et al., 2007). We also used V. atlanticus LGP32 carrying the pSW3654T-GFP plasmid (Le Roux et al., 2007), hereafter referred to as V. atlanticus LGP32-GFP. Bacterial strains were grown at 22 ± 1°C in Zobell medium (0.38 µM iron (III)). When needed, 25 μg mL–1 chloramphenicol (Cm) was added to cultures of V. atlanticus LGP32-GFP (Le Roux et al., 2007).
Ability of Vibrio strains to attack and to lyse Alexandrium pacificum.
ND: not determined.
| Vibrio species | Strains | Virulence for fish or invertebrates | References | AttackA. pacificum | LyseA. pacificum | |
|---|---|---|---|---|---|---|
| Vibrio atlanticus LGP32 | WT | Yes | Gay et al., 2004 | + | + | |
| // | WT +pSW3654T-GFP | Yes | Le Roux et al., 2007 | + | + | |
| // | ΔLuxM | ND | Ifremer Institute, France | + | + | |
| // | ΔLuxS | ND | // | + | + | |
| // | ΔLuxR | ND | // | + | + | |
| // | ΔPvuB | ND | This work | - | + | |
| Vibrio tasmaniensis | J5-9 | Yes | Lemire et al., 2015 | + | + | |
| // | LMG20012T | No | Thompson et al., 2003 | + | + | |
| Vibrio crassostreae | J2.9 | Yes | Lemire et al., 2015 | + | + | |
| // | J2-8 | No | // | + | + | |
| Vibrio fischeri | ES114 | ND | Mandel et al., 2008 | + | + | |
| Vibrio harveyi | ATCC14126 | Yes | Liu et al., 1996 | + | + | |
| Vibrio aestuarianus | janv-32 | Yes | Labreuche et al., 2010 | + | + | |
Phytoplankton strains
Non-axenic phytoplankton species (Table 2) were grown in batch culture in enriched natural sea water (ENSW, 6.55 µM iron (III)) with a salinity of 36 practical salinity units (PSU) at 22 ± 1°C under cool white fluorescent illumination (100 µmol photons m–2 s–1) and a 12 hr:12 hr light:dark cycle (Harrison et al., 1980). The algae were used for experiments in their exponential growth phase.
Ability of V. atlanticus LGP32 to degrade flagella, attack, and lyse the targeted dinoflagellates spp. commonly found in the Mediterranean Sea.
ND not determined.
| Dinoflagellates species | Strains | Toxicity for human | References | Flagella degraded | Cells Attacked | Cells Lysed |
|---|---|---|---|---|---|---|
| Alexandrium pacificum | ACT03, Thau, France | Yes | Laabir et al., 2011 | + | + | + |
| Alexandrium catenella | Bizerte, Tunisia | Yes | Fertouna-Bellakhal et al., 2015 | + | + | + |
| // | F3-9F, Tarragona, Spain | ND | // | + | + | + |
| // | C10-5, Annaba, Algeria | Yes | Hadjadji et al., 2020 | + | + | + |
| Alexandrium tamarense | ATT07, Thau, France | No | Rolland et al., 2012 | + | + | + |
| Alexandrium spp. | Golf of Tunis, Tunisia | ND | Algal collection University of Montpellier, France | + | + | + |
| // | Bizerte, Tunisia | ND | // | + | + | + |
| // | Mediterranean coast, Morocco | ND | // | + | + | + |
| Prorocentrum lima | PLBZT14, Bizerte, Tunisia | Yes | Ben-Gharbia et al., 2016 | - | - | - |
| Coolia monotis | CMBZT14, Bizerte, Tunisia | ND | // | - | - | - |
| Vulcanodinium rugosum | IFR-VRU-01, Ingril, France | Yes | Abadie et al., 2015 | - | - | - |
| Karenia selliformis | Golf of Gabes, Tunisia | ND | Algal collection University of Montpellier, France | - | - | - |
| Scripsiella trochoidae | Mellah Lagoon, Algeria | - | // | - | - | - |
| Gyrodinium impudicum | Golf of Tunis, Tunisia | - | // | - | - | - |
| Amphidium carterae | SAMS, Scotland | ND | SAMS laboratory, Scotland | - | - | - |
| Gymnodinium catenatum | M'diq Bay, Morocco | + | Rijal Leblad et al., 2020 | + | + | + |
Co-culture assay
For each tested phytoplankton species (Table 2), 2x104 cells harvested in their exponential growth phase (doubling time between 5 and 7 days) were placed in 20 mL of ENSW medium in a 50 mL suspension culture flask (Cellstar PS, Greiner bio-one). After incubation for 24 hr at 22 ± 1°C under cool white fluorescent illumination, 40 µL of Vibrio strains (Table 1) grown for 12, 36, 60, and 156 hr in Zobell medium or in Zobell medium supplemented with FeCl3 (6 µM iron (III)) or with boron (H3BO3; 0.47 mM) or the corresponding culture supernatant were added to the phytoplankton cells (Table 2). After incubation at 22 ± 1°C for 0, 15, 30, 45, and 60 min under cool white fluorescent lights, living, non-swimming, attacked, and lysed phytoplankton cells were counted in a sedimentation chamber under an inverted microscope. The number of lysed cells corresponded to phytoplankton cells showing disrupted membranes. Non-swimming algae were not counted as lysed cells. For Vibrio analysis, 100 µL of a 1:10 serial dilution mixture in ENSW (from 10–2 to 10–10) was plated on Vibrio Selective TCBS (thiosulfate-citrate-bile salts-sucrose) agar (in triplicate). After incubation for 24 hr at 22 ± 1°C, the number of living Vibrio cells was determined by counting colony-forming units (CFUs). The data come from three independent experiments using independent phytoplankton cultures and independent bacterial cultures.
Microscope observations
The dynamic of the interaction between A. pacificum ACT03 isolated from the French Thau Lagoon, south of France (Laabir et al., 2011) and V. atlanticus LGP32, which is an oyster pathogen isolated from the French Atlantic coast (Gay et al., 2004) and present in the Thau Lagoon (Lopez-Joven et al., 2018) was surveyed. As the A. pacificum ACT03 strain (Table 2) used in the study is not axenic, there is potential for bacteria other than V. atlanticus LGP32 to be present in the experiments. To elucidate the interaction without thoroughly accounting for the non-axenic cells, interaction was observed under a Zeiss Axio upright fluorescence microscope equipped with an AxioCamMRm 2 digital microscope camera using V. atlanticus LGP32 tagged with green fluorescent protein (GFP). Lasers were used at excitation wavelength (λex) 488 nm for GFP (emission wavelengths (λem): 505–530 nm) and λex 532 nm for plankton chloroplasts (λem 560–630 nm). Images were taken sequentially to avoid cross-contamination between fluorochromes. Sequences of images were merged during the Vibrio-Alexandrium interaction using ZEN 2012 (blue edition) software. Interaction events between Vibrio strains and phytoplankton strains were also observed under a Leica TCS SPE confocal laser scanning system connected to a Leica DM 2500 upright microscope camera (Montpellier RIO Imaging Platform, University of Montpellier, France).
Comparative proteomic analysis
Vibrio sampling and protein extraction
V. atlanticus LGP32 was grown for 60 hr at 22 °C in artificial seawater (high nutrient stress, cond. 1) or 12 hr at 22 °C in Zobell media (no nutrient stress, cond. 2). After 10 min centrifugation at 8000 rpm, crude protein extracts of V. atlanticus LGP32 in each culture condition (triplicates) were obtained by sonication on ice at 20% amplitude for 20 s in 200 µL of ice-cold denaturing buffer (7 M urea, 2 M thiourea, 4% CHAPS in 30 mM Tris-HCl, pH 8.5) and clarified by centrifugation at 2000 x g, 15 min, 4 °C. The protein concentration of the supernatant was estimated using the 2D Quant Kit (Cytiva, MERCK) and samples were stored at –80 °C until use.
Two-dimensional gel electrophoresis (2D gel)
Protein extracts were individually analyzed on 2D gel electrophoresis (six gels per condition each corresponding to different biological replicates). To do so, 100 µg of proteins from each extract was added to rehydration buffer (7 M urea, 2 M thiourea, 4% CHAPS, 65 mM DTT) for a total volume of 350 µL. They were then individually loaded onto 17 cm isoelectric focusing strips (Bio-Rad) with a stabilized non-linear pH ranging from 3 to 10. Due to the high complexity of the protein profile in the acidic part (left) of the gel pH 3–10, we conducted additional ‘close-up’ analyses in gels using 17 cm isoelectric focusing strips (Bio-Rad) with a narrower, stabilized pH gradient ranging from 4 to 7. Strips were rehydrated passively for 5 hr at 22 °C, followed by active rehydration for 14 hr under a 50 V current at 22 °C (to help large proteins enter the strips). Thereafter, isoelectrofocusing was carried out using the following program: 50 V for 1 hr, 250 V for 1 hr, 8000 V for 1 hr and a final step at 8000 V for a total of 140,000 V.hr with a slow ramping voltage (quadratic increasing voltage) at each step. Focused proteins were reduced by incubating the strip twice in equilibration buffer (1.5 M Tris, 6 M urea, 2% SDS, 30% glycerol; bromophenol blue, pH 8.8) containing DTT (130 mM) at 55 °C. Then, they were alkylated by incubation with equilibration buffer containing iodoacetamide (135 mM) on a rocking agitator (400 rpm) at room temperature protected from light. Proteins were also separated according to their molecular weight (second dimension) on 12% acrylamide/0.32% piperazine diacrylamide gels run at 25 mA per gel for 30 min followed by 75 mA per gel for 8 hr using a Protean II XL system (Bio-Rad). Gels were stained using an MS-compatible silver staining protocol and scanned using a ChemiDoc MP Imaging System (Bio-Rad) associated with Image Lab software version 4.0.1 (Bio-Rad).
Comparative bioinformatics analysis of 2D gels
Twelve gels (six per condition) were selected for comparative analysis on PD-Quest v. 7.4.0 (Bio-Rad) to identify changes in protein abundance between the proteomic profiles of V. atlanticus LGP32 cultured in contrasting nutrient conditions (ENSW/Zobell). Spots whose mean intensity across six replicates per strain was two times higher or lower than those from the other strain, with a p<0.01 (Mann-Whitney U-test), were considered significantly different in terms of abundance between the two conditions (quantitative difference). Differentially represented spots were then excised from the gels, destained, trypsin-digested, and the obtained peptides were identified by tandem mass spectrometry (MS-MS) using the PISSARO platform facility (University of Rouen, France). To identify protein(s) present in each spot, the obtained peptides were compared with V. atlanticus LGP32 reference genome (https://vibrio.biocyc.org/). The genes whose peptides matched strongly were retrieved and used for a BLASTx query against non-redundant databases to determine the protein identity of the best match. A gene was considered as strongly matched when at least two peptides matched the sequence with a coverage of >6%. Their theoretical isoelectric point (pI) and molecular weights were also calculated using the Expasy server (https://www.expasy.org/) to compare them with the location of the spot on the gel. Altogether, these complementary analyses made it possible to characterize the protein identity of each spot with confidence.
Gene expression analysis
Vibrio sampling and RNA extraction
V. atlanticus LGP32 was grown in Zobell media for 36 hr and 60 hr at 22 °C (decline phase of growth, nutrient stress) or for 12 hr at 22 °C (exponential growth phase, no nutrient stress). Total RNA was isolated from V. atlanticus LGP32 using the standard TRIzol method (Invitrogen Life Technologies SAS, Saint-Aubin, France) and then treated with DNase (Invitrogen) to eliminate genomic DNA contamination. After sodium acetate precipitation, the quantity and quality of the total RNA were determined using a NanoDrop spectrophotometer and agarose gel electrophoresis. Following heat denaturing (70 °C for 5 min), reverse transcription was performed using 1 μg of RNA prepared with 50 ng μL–1 oligo-(dT) 12–18 mer in a 20 μL reaction containing 1 mM dNTPs, 1 unit μL–1 RNAseOUT, and 200 units μL–1 Moloney murine leukemia virus reverse transcriptase (M-MLV RT) in reverse transcriptase buffer, according to the manufacturer’s instructions (Invitrogen Life Technologies SAS, Saint-Aubin, France).
PCR amplification
Amplification reactions were analysed using a Roche LightCycler 480 Real-Time thermocycler (Bio-Environnement platform, University of Perpignan, France). In this study, several PCR primer pairs were designed using Primer3 software (optimal primer size: 20 bases; Tm: 60 °C; primer GC%: 50; 2GC clamp and product size range: 150–200 bp) and calibrated with V. atlanticus LGP32 genomic DNA (Table 1). To determine the qPCR efficiency of each primer pair used, standard curves were generated using seven serial dilutions of genomic DNA (10–2, 10–3, 10–4, 10–5, 10–7, and 10–8; not shown); the qPCR efficiencies of the tested genes varied between 1.85 and 2.08 (Table 3). For gene expression, reverse transcription was performed with 1 µg of total RNA using random hexamers and SuperScript IV reverse transcriptase (Invitrogen). The total qPCR reaction volume was 10 μL and consisted of 5 μL of cDNA (diluted 1:5), 2.5 μL of SensiFAST SYBR No-ROX Mix (Bioline), and 100 nM or 300 nM PCR primer pair (Table 3). The reaction parameters were as follows: 2 min at 95 °C (initial denaturation) and 40 cycles of 5 s at 95 °C (denaturation), 10 s at 59 °C (annealing), and 20 s at 72 °C (elongation). The specificity of each PCR was checked by measuring fluorescent signals during melting curve analysis (PCR product heated from 65°C to 95°C continuously and slowly at 0.1 °C s−1). Relative expression was calculated by normalization to the expression of two constitutively expressed housekeeping genes, namely, 6PKF (VS_2913) and CcmC (VS_0852), using the delta-delta threshold cycle (ΔΔCt) method (Pfaffl, 2001).
Oligonucleotide sequences of primers used for RNA expression analysis.
| Species | genes | Primer Sequences | Tm (°C) | Efficiency | References |
|---|---|---|---|---|---|
| Alexandrium pacificum (ACT03) | 18S – 28S rRNA ITS region | TGATATTGTGGGCAACTGTAA | 54 | Genovesi et al., 2011 | |
| AACATCTGTTAGCTCACGGAA | |||||
| Alexandrium tamarense (ATT07) | 18S – 28S rRNA ITS region | TGGTAATTCTTCATTGATTACAATG | 54 | // | |
| AACATCTGTTAGCTCACGGAA | |||||
| Vibrios spp. | 16 S | CGGTGAAATGCGTAGAGAT | 62 | Kita-Tsukamoto et al., 1993 | |
| TTACTAGCGATTCCGAGTTC | |||||
| Vibrio atlanticus LGP32 | LuxN (VS_II0260) | CACTTGCTAGTATCATCGC | 60 | 1.92 | This work |
| ATCGAGTTAGCAAGAGCAC | |||||
| // | LuxM (VS_II0261) | TCCACTTATCACAAACAGG | 60 | 1.91 | // |
| ACTGTACTTCCATTTGTCG | |||||
| // | LuxP (VS_II0355) | AAGTTCAGGATGAACCTATC | 60 | 1.89 | // |
| CAAAGAGATACTTTGCTGAG | |||||
| // | LuxS (VS_2562) | ACTCTCGAGCACCTATACG | 60 | 1.85 | // |
| GAAGGCGTACCAATCAAGC | |||||
| // | CqsS (VS_1725) | GACATCTATTGATGTTATGC | 60 | 1.91 | // |
| TCACCCACTTCACGTAACTG | |||||
| // | PvsA (VS_II0355),Vibrioferrin biosynthesis protein | CAGAGCAAGAGCTAGAACC | 59 | 1.91 | // |
| TCGTTGAGAACCTGACGAG | |||||
| // | PvuB (VS_II1126), ABC transporter vibrioferrin uptake FecB | TAGTGCAACCATGGGAATCG | 57 | 2.01 | // |
| TAAACCGTACGTAGACGCTC | |||||
| // | PvuA2 (VS_II1127), Vibrioferrin receptor FecA | GGAGCTACAAGCATTCGTTC | 57 | 2.08 | // |
| TTCGTCATATGGTCGCTTCG | |||||
| // | Housekeeping gene 1, CcmC (VS_0852) | ATTGCCGCCTTTATCGGTTT | 60 | Vanhove et al., 2016 | |
| CAAGCACCCCACATTGGTTT | |||||
| // | Housekeeping gene 2, 6-phosphofructokinase (VS_2913) | GCCGTCACTGTGGTGACCTT | 60 | // | |
| TGCTTCTTGCCTTTCGCAAT |
Detection of quorum-sensing signaling molecules
Vibrio culture
To detect the QS molecules (AI-2, AI-1, and CAI-1), V. atlanticus LGP32 was grown in Zobell media for 12 hr (exponential growth phase, control) and 60 hr (decline phase of growth, nutrient stress).
AI-2 analysis
Bioluminescence assay using the QS bioluminescent of Vibrio campbellii MM32 (luxN::Cm, luxS::Tn5Kan) was used to detect AI-2 molecules in culture supernatants. Briefly, Vibrio cultures were centrifuged at 17,000 x g for 10 min, and the resulting supernatants were filtered on 0.22 μm. Then 20 μL of the filtrates were mixed with 180 μL of V. campbellii MM32 diluted 1:5000 then incubated at 30 °C and 100 rpm. Luminescence and cell density (OD620) were collected in triplicate and analysed according to Tourneroche et al., 2019.
AI-1 and CAI-1 extraction and LC-MS analysis
Chemical analyses were conducted with a Q Exactive Focus Orbitrap System coupled to an Ultimate 3000 ultrahigh-performance liquid chromatography (UHPLC) system (Thermo Fisher Scientific) according to Rodrigues et al., 2022. Briefly, ethyl acetate (2 mL) was added into each culture (2 mL). This mixture was shaken overnight at room temperature (150 rpm). The two phases were then separated, and the aqueous phase was extracted once again. The two obtained organic phases were pooled, and the solvent was evaporated under vacuum. The crude extracts were dissolved in 500 µL LC-MS grade methanol for analysis. The experiments were performed using biological triplicates, each of which was analyzed in triplicate. Analyses of extracts and standards (3 μL injected) were performed in electrospray positive ionization mode in the 50–750 m/z range in centroid mode. The parameters were as follows: spray voltage: 3 kV; sheath flow rate: 75; aux gas pressure: 20; capillary temperature: 350 °C; heater temperature: 430 °C. The analysis was conducted in Full MS data-dependent MS2 mode (Discovery mode). Resolution was set to 70,000 in Full MS mode, and the AGC (automatic gain control) target was set to 1x106. In MS2, resolution was 17,500, AGC target was set to 2x105, isolation window was 0.4 m/z, and normalized collision energy was stepped to 15, 30, and 40 eV. The UHPLC column was a Phenomenex Luna Omega Polar C18 1.6 μm, 150x2.1 mm. The column temperature was set to 42 °C, and the flow rate was 0.4 mL min–1. The solvent system was a mixture of water (A) with increasing proportions of acetonitrile (B), with both solvents modified with 0.1% formic acid. The gradient was as follows: 1% B 3 min before injection, then from 1 to 15 min, a gradient increase of B up to 100% (curve 5), followed by 100% B for 5 min. The flow was injected into the mass spectrometer starting immediately after injection. All data were acquired and processed using FreeStyle 1.5 software (Thermo Fisher Scientific).
Chemicals and solvents
N-acyl-homoserine lactones (AHL) were obtained from Cayman Chemical (Ann Arbor, MI, USA). Stock solutions were obtained by dissolving standards in methanol or dichloromethane (C18-AHL) at a concentration of 1 mg mL–1 and stored at –80 °C. Standard solutions for UHPLC-high-resolution tandem mass spectrometry (HRMS) analyses were prepared by diluting each individual standard solution with methanol in order to obtain a concentration range from 2000–20 ng mL–1. LC-MS grade methanol, acetonitrile, and formic acid were purchased from Biosolve (Biosolve Chimie, Dieuze, France), analytical-grade ethyl acetate was obtained from Sigma-Aldrich. Pure water was obtained from Elga Purelab Flex System (Veolia LabWater STI, Antony, France).
Nature of lytic compounds secreted by V. atlanticus LGP32
To determine the temperature-sensitivity of the lytic compounds secreted, V. atlanticus LGP32 grown for 60 hr in Zobell media at 22 °C was filtered through a 10 kDa membrane (Amicon Ultra-4 filter unit). The eluate containing molecules with MW below 10 kDa was then incubated in a water bath at 100 °C for 30 min. Boiled filtrates (0.1 mL) were subsequently used to inoculate A. pacificum (ACT03 strain) cultures, then lytic activity was observed under the Leica TCS SPE confocal laser scanning system. Zobell media with the same treatment was used as control.
Statistical analysis
Environmental data
Statistical analyses were performed using R 3.6.3 software (R Development Core Team, 2024) using RStudio. The relationship between Alexandrium and Vibrio was explored separately in spring and autumn. We used a generalized linear model specifying a Gaussian family. For spring, the dataset for salinity and temperature was complete (14 periods of observation). An influential period was detected and removed from the dataset because no dead Alexandrium cells were observed. The effects of explanatory variables such as log10 (Vibrio +1), salinity, and temperature were centered, reduced, and tested as fixed effects with a linear relationship. Model selection was performed using the Akaike information criterion corrected for small sample size (AICc). Models were considered different whenever the difference between their AICc value and the lowest AICc value (ΔAICc) was lower than 2 (Burnham and Anderson, 2002). Alexandrium distribution and model residuals were checked for normal distribution assumptions (QQ plot and Shapiro-Wilk test). For autumn, the dataset was complete for 10 periods of observation. Salinity and temperature were missing for three periods. We explored the relationship between Alexandrium and Vibrio alone using the method detailed above for spring.
In vitro data. Statistical analyses were performed using one-way ANOVA (analyzed by pair) followed by Tukey’s test (Statistica 10.0 software, StatSoft, Maison-Alfort, France). *p<0.05, **p<0.01, ***p<0.001.
Results
Concomitant occurrence of A. pacificum ACT03, A. tamarense ATT07, and free-living Vibrio spp. in the Thau lagoon
In the spring and autumn of 2015, in the Thau Lagoon (Figure 1A), we detected Alexandrium algae (A. pacificum ACT03 and A. tamarense ATT07, both alive and in degraded cell forms) and free-living Vibrio, but no plankton-associated Vibrio were observed (Figure 1B, Supplementary file 1). Using model selection based on AICc, we found no significant relationship between Alexandrium (A. pacificum ACT03, A. tamarense) and Vibrio spp. abundances in autumn. This result is consistent with Vibrio’s difficulty in growing at temperatures below 20 °C, as well as with the many environmental factors that can influence the dynamics of algae proliferation (Laanaia et al., 2013). Interestingly, in spring 2015, the mean densities of all Alexandrium cells (degraded and alive) and of free-living Vibrio were positively correlated. The lowest AICc was obtained with the model explaining degraded form of Alexandrium density based on the free Vibrio density (Figure 1C). Given that, this model is not so different from the model with only the intercept, but better than any other linear combination with other potentially interfering drivers, such as temperature and salinity (Figure 1D), we searched for evidence of a relationship between Vibrio and Alexandrium by studying their interaction in vitro.
Dynamics of Alexandrium and Vibrio in the environment.
(A) Location of the monitoring station in the Thau Lagoon (southern France). (B) Mean abundance (DNA equiv.) of Vibrio spp. (16 S) and Alexandrium spp. (A. pacificum ACT03+A. tamarense ATT07). Vibrio cells (black line with diamond dot) and degraded Alexandrium cells (grey line with round dot) were detected in the 0.2–0.8 μm fraction (free Vibrio fraction) in spring and autumn 2015. Living Alexandrium cells (grey line with round dot) but no plankton-associated Vibrio spp. (black line with diamond dot) were evident in the 0.8–180 μm in spring and autumn. (C) Results of the Akaike Information Criterion (AICc) test conducted to select a model for explaining the mean value of dead Alexandrium (degraded cells) in spring. (D) Wald test of the AICc model explaining the mean value of dead Alexandrium in spring by free Vibrio.
V. atlanticus LGP32 feeds on A. pacificum ACT03
To investigate whether Alexandrium interacts with Vibrio, we incubated in Enriched Natural Sea Water (ENSW) A. pacificum ACT03 (2.0x104 cells) with V. atlanticus LGP32 previously grown for 12 hr in Zobell media (initial concentration of 8.8x107 cells mL–1). In interaction with V. atlanticus LGP32, A. pacificum ACT03 cell abundance decreased significantly from 2.1x104 cells mL–1 after 1 hr of exposure to 1.1x104 cells mL–1 after 48 hr of exposure (Figure 2A), while the V. atlanticus LGP32 concentration grew significantly after 26 hr of interaction, reaching a maximum peak density of 7.6x107 CFU mL–1 at 34 hr (Figure 2B). In the control experiment where A. pacificum ACT03 was cultured alone in ENSW, the algal concentration remained stable over time (Figure 2A) and no bacteria were on the corresponding TCBS plates (Vibrio selective medium). In the control where V. atlanticus LGP32 was grown alone in ENSW, the bacterial concentration decreased from 7.0×10⁵ CFU/mL after 1 hr of incubation to 1.1×10⁵ CFU/mL after 48 hr of incubation (Figure 2B). These results show that the interaction between V. atlanticus LGP32 and A. pacificum ACT03 leads to a decline in the algal population and promotes the growth of V. atlanticus LGP32. This suggests that V. atlanticus LGP32 is able to feed on A. pacificum ACT03.
Incubation of V. atlanticus LGP32 and Alexandrium pacificum ACT03 in enriched natural seawater (ENSW).
(A) A. pacificum ACT03 cultured alone (grey bar) and incubated with V. atlanticus LGP32 (black bar) in ENSW. (B) V. atlanticus LGP32 cultured alone (grey bar) and incubated with A. pacificum ACT03 (black bar) in ENSW. (C) Snapshot of the interaction between V. atlanticus LGP32-GFP cells (60 hour culture) and one cell of A. pacificum ACT03 taken at 8:00 of co-culture. (D) Chronological snapshots of the interaction (70 pictures, one per second). V. atlanticus LGP32 (small green cells) and A. pacificum ACT03 cell (large red cell). All experiments were done in triplicate. Asterisks indicate significant differences in a multiple comparison test (One-way ANOVA with post hoc Tukey test), *p≤0.05.
V. atlanticus LGP32 performs attacks on A. pacificum ACT03
Epifluorescence microscopy observation of GFP-labeled V. atlanticus LGP32 (previously grown in Zobell medium) in interaction showed that V. atlanticus LGP32 cells are capable of simultaneously attacking A. pacificum ACT03 cells (Figure 2C and Video 1). The attacks were extremely rapid, with empty thecae (algal envelopes) observed in the medium after less than 60 s (Figure 2D and Video 2). During the attack, V. atlanticus LGP32 did not invade the algal cell but remained clustered on the cell surface (Figure 2C).
Dynamics of V. atlanticus LGP32-Alexandrium pacificum ACT03 interaction.
GFP-tagged V. atlanticus (small green cells); living A. pacificum (large red cells); lysed A. pacificum (large green cells) filmed under an epifluorescence microscope.
Second-by-second timing of V. atlanticus LGP32 attacking Alexandrium pacificum ACT03.
GFP-tagged V. atlanticus (small green cells); A. pacificum living cell (large red cells) filmed under an epifluorescence microscope.
Attack of A. pacificum ACT03 is activated by V. atlanticus LGP32 starvation
In 2002, Martin hypothesized that nutritional stress induces bacteria to lyse algae (Martin, 2002). To test this hypothesis, we monitored V. atlanticus LGP32 behavior in response to starvation (Figure 3). We observed that V. atlanticus LGP32 in exponential growth phase (12 hr of culture in Zobell medium, 8.8x107 cells mL–1) did not interact with A. pacificum ACT03 cells for the first hour of contact (Figure 3A, B and C). In contrast, V. atlanticus LGP32 in the decline phase (36 hr of culture in Zobell medium, 1.3x107 cells mL–1) induced a significant decrease in the number of motile algae cells by 8.9% after 15 min and by 43.3% after 60 min (Figure 3A). This phenomenon corresponded to the degradation and/or disruption of algal flagella (Video 3). The flagella no longer functioned correctly, which caused irregular swimming of the algae (Video 3, left cell). This was followed by a complete cessation of swimming. When the flagellum detached from the algae (Video 3, right cell), the attack occurred. With starved V. atlanticus LGP32 (60 hr of culture in Zobell medium, 0.6x107 cells mL–1), algae immobilization was fast and significant (91.4% in 15 min, Figure 3A), and algae were attacked individually being targeted by V. atlanticus LGP32 cells (Video 4). The percentage of cells attacked and killed peaked at 30% after 15–30 min of contact (Figure 3B and B1) and then decreased. After 1 hr, attacks had stopped with approximately 40% of the algal cells still alive (Figure 3B1 and C). Although it remains unclear whether the attacks occur during a specific phase of growth, it is evident that the cells are already weakened before attack as they have all lost their flagella. An old-starved culture of V. atlanticus LGP32 (126 hr of culture in Zobell medium, <0.1 x 107 cells mL–1) significantly immobilized A. pacificum ACT03 cells within a few minutes, with lysis occurring immediately (Figure 3A and C), making it impossible to detect attacks by V. atlanticus LGP32 (Figure 3B). The lysis phase corresponded to initial vesicle formation followed by the bursting of A. pacificum ACT03 cells (Figure 3C and C1 and Video 5). Importantly, Vibrio densities decreased with culture age, ruling out the possibility that the stronger predation observed in older cultures was driven by higher bacterial densities.
Role of V. atlanticus LGP32 starvation in the interspecific interaction process.
Experiments were conducted by incubating A. pacificum ACT03 with V. atlanticus LGP32 previously grown for 12, 36, 60, and 126 h in Zobell medium. (A) Cumulative percentage of motile A. pacificum ACT03 cells. (B) Cumulative number of cells attacked by V. atlanticus LGP32 and (C) Cumulative cell lysis after 0, 15, 30, 45, and 60 min of interaction. Corresponding pictures showing (A1) Black arrows indicate unhooked and degraded flagellum from A. pacificum ACT03 flagellum, (B1) Chronological sequence of five snapshots showing V. atlanticus LGP32-GFP cells (60 hour culture) and A. pacificum ACT03 cells, during the first hour of their interaction. V. atlanticus LGP32 (small green cells), living A. pacificum ACT03 (large red cells), and dead A. pacificum ACT03 (large green cell). (C1) Black arrow 1 indicates vesicle formation on A. pacificum ACT03 cell and black arrow 2 indicates lysed A. pacificum ACT03 cell. All percentages were determined based on a minimum of 2000 cells of A. pacificum ACT03. All experiments were done in triplicate. Asterisks indicate significant differences in a multiple comparison test (One-way ANOVA with post hoc Tukey test), ***p≤0.001.
Degradation and disruption of Alexandrium pacificum ACT03 flagella.
Effect of Vibrio supernatant on the first stage of the interaction filmed under a confocal microscope.
Attacks of V. atlanticus LGP32 on target Alexandrium pacificum ACT03.
This video, recorded under a confocal microscope, shows Vibrios simultaneously attacking a first immobilized Alexandrium cell, then moving on to attack a second cell without ever targeting the other cells present, suggesting active communication between the Vibrio bacteria. V. atlanticus LGP32 (small cells); A. pacificum ACT03 (large cells).
Vesicle formation and bursting of an Alexandrium pacificum ACT03.
Direct effect of Vibrio supernatant on Alexandrium after 126 hr of culture filmed under a confocal microscope.
We next tested whether this lytic effect was linked to Vibrio culture supernatant and mediated by thermostable molecule(s) secreted by Vibrio (Figure 3—figure supplement 1). The culture supernatant of starved culture of V. atlanticus LGP32 (60 hr) filtered through a 10 kDa membrane and then incubated at 100 °C for 30 min still possessed its lytic properties, indicating that the algicidal compounds produced by V. atlanticus LGP32 are small thermostable molecules unlikely to be lytic enzymes or lysins able to digest the algae cell. However, these experimental observations clearly show the key role of nutrient limitation in triggering the attack behavior and the secretion of lytic compounds of V. atlanticus LGP32.
Attack occurs on A. pacificum ACT03 in exponential phase of growth
Here, we wondered whether the live/dead status of algae is important for V. atlanticus LGP32-mediated attacks targeting. To this end, A. pacificum ACT03 in exponential growth phase was first exposed for 30 min to the supernatant of a 126 hr culture of V. atlanticus LGP32, which induced lysis of 70% of the A. pacificum ACT03 cells (Figure 3C and C1 (arrow 2) and Video 4). Next, cells of V. atlanticus LGP32 from a 60 hour culture, capable of attacking A. pacificum ACT03 cells (Figure 3B), were added. For 1 hr of exposure, no attack was observed on the previously lysed algae. This result is similar to what is observed on the Video 1 with flash attacks only on immobilized, but not degraded A. pacificum ACT03 cells (red), and not on lysed cells (green). In addition, no attacks occurred on cells from an old A. pacificum ACT03 culture (1 month culture). Together, with the very short duration of attacks (Video 1), these results indicate that V. atlanticus LGP32 attacked exponentially growing cells of A. pacificum ACT03, but not decomposing algae, suggesting that this behavior is not just an opportunistic response of heterotrophic bacteria to organic substrates.
Attack is independent of quorum sensing
Considering the simultaneous action of V. atlanticus LGP32 in attacks on A. pacificum ACT03, we tested whether the attack process depended on the key physiological mechanism that regulates many functions in marine microbial cells, QS (Lami, 2019; Papenfort and Bassler, 2016), a type of cell-cell communication. Although QS is a cell-density-dependent mechanism, our results showed no attack from a 12 hr culture of V. atlanticus LGP32 up to a concentration of 4x106 Vibrio mL–1 (Figure 4A). Attacks were only observed with V. atlanticus LGP32 from a 60 hr culture at low concentration of 5x103 Vibrio mL–1 to the highest concentration tested of 5x105 Vibrio mL–1 (Figure 4A), consistent with the hypothesis that the attacks were independent of Vibrio density.
Role of quorum sensing and the vibrioferrin iron uptake pathway in the interaction process.
(A) Effect of V. atlanticus LGP32 cell density on the attack process. A. pacificum ACT03 cells (1x103 cells mL–1) were incubated with V. atlanticus LGP32 grown for 60 hr in Zobell medium at concentrations ranging from 5.103 to 5 x 105 cells mL−1 (black bars). For comparison, A. pacificum ACT03 incubated with V. atlanticus LGP32 grown for 12 hr in Zobell medium at concentrations ranging from 5x103–4 x 106 cells mL−1 (grey bars). The image on the bars indicates either unaffected algae (live red algae) or algae attacked by Vibrio (algae covered with green Vibrio cell) during the interaction (B) CqsS, luxM, luxN, luxS, and luxP quorum sensing and PvsA, PvuB, and PvuA2 vibrioferrin pathway genes expression in V. atlanticus LGP32 grown for 12, 36, and 60 hr in Zobell medium. (C) Effect of V. atlanticus LGP32 mutants on the attack process. Experiments were conducted by incubating A. pacificum ACT03 with V. atlanticus LGP32, V. atlanticus LGP32 tagged with GFP, V. atlanticus LGP32 washed with ENSW or V. atlanticus LGP32 mutant ΔPvuB, ΔluxM, ΔluxR, and ΔluxS previously grown 60 hr in Zobell media (control). The percentage of A. pacificum ACT03 attacked was determined during the first 30 min of exposure. (D) Effect of V. atlanticus LGP32 culture media composition on the attack process. Experiments were conducted by incubating A. pacificum ACT03 with V. atlanticus LGP32 grown 60 hr in Zobell media supplemented with boron (H3BO3) or FeCl3. The results were compared with an exposure to V. atlanticus LGP32 grown 60 hr in Zobell media. All percentages were determined based on a minimum of 2000 cells of A. pacificum ACT03. All experiments were done in triplicate. Asterisks indicate significant differences in a multiple comparison test (One-way ANOVA with post hoc Tukey test), **p≤0.01, ***p≤0.001.
The analysis of the expression of genes involved in the known QS pathways in Vibrio cell (Figure 4—figure supplement 1) highlighted that only the AI-2 pathway was induced during nutrient stress of V. atlanticus LGP32, because only the expression of the AI synthase (LuxS) and its receptor (LuxP) increased significantly (Figure 4B; ANOVA p<0.05). This was confirmed by a QS bioluminescence assay, which showed AI-2 molecules (unquantified) in the Zobell culture supernatant of V. atlanticus LGP32 after 60 hr of culture but not after 12 hr of culture and not in the ENSW supernatant of V. atlanticus LGP32 after 12 or 60 hr of culture. UHPLC-HRMS/MS provided no evidence of detectable HAI-1 and CAI-1 in any experiments.
Targeted mutagenesis of key genes involved in two of the three known QS pathways in vibrios (Figure 4—figure supplement 1), ΔluxM (HAI-1 production), ΔluxS (AI-2 production), and ΔluxR (main high-density QS regulator), did not result in any changes in the attack behavior of V. atlanticus LGP32 (Figure 4C). Combined with the absence of overexpression of the CqsS gene (inducible by CAI-1) involved in the last known QS pathway in Vibrio (Figure 4—figure supplement 1), these results indicated that the attack by V. atlanticus LGP32 is most likely unrelated to QS.
Attack related to the availability of iron
The comparative analysis of the proteome of V. atlanticus LGP32 incubated 60 hr in artificial seawater (ENSW) versus V. atlanticus LGP32 grown 12 hr in Zobell nutrient-rich medium revealed 10 proteins that were differentially abundant under these two contrasting conditions (Figure 4—figure supplement 2). The two most down-regulated proteins correspond to be ß-ketoacyl-(acyl-carrier-protein) synthase II (–22-fold in ENSW compared to Zobell), a key regulator of bacterial fatty acid synthesis, and the dihydroorotase (–6.6-fold in ENSW compared to Zobell), an enzyme essential for pyrimidine biosynthesis and thus bacterial proliferation and growth. The low expression of these proteins in ENSW is consistent with V. atlanticus LGP32 nutritional starvation. The most up-regulated protein in starved V. atlanticus LGP32, with an increase of more than sixfold, was glucosamine-6-phosphate deaminase, an enzyme involved in bacterial energy metabolism probably necessary for its survival. Among the other up-regulated proteins, one was an iron siderophore-binding protein (Spot 4413, Figure 4—figure supplement 2) corresponding to the vibrioferrin outer membrane receptor PvuB, whose gene is part of the pvu operons involved in iron transport (Figure 4—figure supplement 1). Interestingly, the corresponding gene pvuB as well as the vibrioferrin membrane receptor gene pvuA2 (Figure 4—figure supplement 1) were both significantly induced in Vibrio under nutrient stress (Figure 4B; ANOVA p<0.01) but not the one involved in the vibrioferrin biosynthesis, pvsA (Figure 4B). Remarkably, of the 10 proteins identified by proteomic analysis and eliminated by mutation, only elimination of PvuB prevented V. atlanticus from attacking A. pacificum ACT03 (Figure 4C; ANOVA p<0.001). In the absence of the pvuB gene, V. atlanticus LGP32 was unable to simultaneously attack A. pacificum ACT03. In addition, V. atlanticus LGP32 cells that had been washed with ENSW to remove their culture supernatant metabolites also failed to attack A. pacificum ACT03 (Figure 4C; ANOVA p<0.001), which is congruent with the hypothesis that attacks depend on the V. atlanticus LGP32 vibrioferrin transport system. Finally, attacks increased significantly when FeCl3 was added to the Vibrio culture medium (Figure 4D) but not with boron known to be capable of being transported by vibrioferrin (see Figure 4D). Taken together, those results are consistent with the hypothesis that attacks are regulated by iron.
Attack is a Vibrio spp. behavior specific to Alexandrium spp
To evaluate the dinoflagellates specificity of the attack behavior, a selection of Vibrio spp. was co-cultured with a selection of dinoflagellate strains commonly found in the Mediterranean Sea. The results showed that, among the Vibrio spp. tested (pathogenic or not) all, when under nutrient stress, were able to secrete algicidal compounds, immobilize, attack and lyse A. pacificum ACT03 cells (Table 1) and no link to their pathogenicity for fish of invertebrates was observed (Table 1). Among the 16 dinoflagellates species tested, only Alexandrium spp. (non-toxic and PST producers) and Gymnodinium catenatum (PST producer) were immobilized, attacked, and lysed by V. atlanticus LGP32 (Table 2), but no link to PSTs was revealed (Table 2).
Discussion
Predation is a widespread mode of interaction for survival in the natural world (Finke and Denno, 2004; Sinclair et al., 2003). Predatory bacteria are found in a wide variety of environments and are commonly described as feeding on other bacteria, although some cases of predation on microbial eukaryotes have also been hypothesized (Johnke et al., 2014; Pérez et al., 2016). Conceiving predators as free-living organisms that kill other organisms and feed on them, this study suggests that Vibrio engage in a novel form of predation in which they kill and feed on algae.
In fact, the strategy developed by Vibrio to kill algae may be reminiscent of strategies previously described in the prokaryotes (Johnke et al., 2014). As shown in Video 1, the interaction between V. atlanticus LGP32 and A. pacificum ACT03 proceeds in three stages (Figure 5). The first stage, the ‘immobilization stage’, recalls the strategy used by Streptomyces to immobilize its prey (Kumbhar et al., 2014) based on the secretion of algicidal metabolites that disrupt the flagella. The second stage, the ‘attack stage’ corresponding to the physical contact between Vibrios and Alexandrium, is similar to the strategy used by Myxococcus xanthus and Lysobacter. These bacteria may require close proximity to their prey to cause lysis and utilize their biomass, although some can also kill prey at a distance through diffusible secretions (Martin, 2002; Genovesi et al., 2013; Pérez et al., 2016; Zhang et al., 2020). V. atlanticus LGP32 also surrounds A. pacificum ACT03 cells at high density for a very short time, but does not invade the algal cell. Visually, this phenomenon resembles bacteria clustering around lysed ciliate cells (Blackburn et al., 1998). The third stage, the ‘killing stage’, is similar to that of epibiotic bacterial predators, which induce the lysis of bacteria from the outside (Rashidan and Bird, 2001). Overall, these observations suggest that V. atlanticus LGP32 can exhibit a predatory behavior.
Schematic representation of a putative strategy developed by Vibrio spp. to feed on Alexandrium spp. and G. catenatum in the environment.
(A) Vibrio in the environment when subjected to starvation secrete non-protein lytic compounds. (B) Some of these lytic compounds degrade the flagella, immobilizing the alga (immobilization stage). (C) Then Vibrio swims and clusters around its prey (attack stage). (D) Lytic compounds released by Vibrio were able to concentrate around the algal cells, thereby lysing the algae (killing stage). (E) Feeding on the released nutrients, Vibrio multiply and then spread in the environment. Yellow clouds: Lytic compound release by Vibrio, Grey clouds: Algal nutrients released upon lysis.
The attack behavior of V. atlanticus LGP32 was linked to iron absorption, as mutants with impaired iron absorption completely lost their ability to attack the algae. Iron is an essential element for growth in most organisms, including phytoplankton (Martin and Fitzwater, 1988) and bacteria (Neilands, 1981), and its concentration in seawater is known to be very low, with measurements in the open ocean surface at 0.2 nM and in deep waters at 0.6 nM (Millero, 1998).
Moreover, its low solubility in seawater limits its availability (Bruland et al., 1994; Wu and Luther, 1994). To acquire iron, bacteria have developed systems based on the secretion (and subsequent uptake) of iron-chelating siderophores to obtain this element from the environment (Amin et al., 2009a). Therefore, many Vibrio spp. produce a siderophore known as vibrioferrin, which is synthesized and secreted by proteins encoded by the pvsABCDE gene cluster (Figure 4—figure supplement 1). Given that boron is known for its role in regulating a global bacterial cellular response to phytoplankton and to bind to vibrioferrin (Romano et al., 2013; Weerasinghe et al., 2013), we tested its potential involvement in simultaneous Vibrio attacks. Compared to the Zobell control, no effect on the number of attacks was observed. For iron-vibrioferrin uptake, Vibrio parahaemolyticus uses a membrane siderophore receptor, called PvuA, which is coupled to an inner membrane ATP-binding cassette (ABC). This ABC transporter system, which is comprised of proteins encoded by the pvuABCDE gene cluster (Figure 4—figure supplement 1), is required for the transport of the siderophore across the inner membrane (Tanabe et al., 2003). Siderophores are not only iron carriers but also important regulators of virulence (Miethke and Marahiel, 2007) and mediators of bacterial interaction with phytoplankton (Amin et al., 2009b; Kramer et al., 2020). We showed here a pivotal role of iron in the interaction between V. atlanticus LGP32 and A. pacificum ACT03. This mirrors the mutualistic interaction observed between G. catenatum and Marinobacter (Amin et al., 2009b). In fact, in natural settings, the co-occurrence of Marinobacter and G. catenatum is suggested to depend on a mutually beneficial utilization of iron and carbon resources (Bolch et al., 2011). As in the present study, iron seems to play a key role in the interaction. Indeed, the labile iron released through the photolysis of ferric chelates with vibrioferrin provides a crucial iron source for phytoplankton, which need substantial amounts of iron to support carbon fixation through photosynthesis (Amin et al., 2009a; Yang et al., 2021). This fixed carbon, in turn, sustains the growth of both the phytoplankton and their associated bacterial counterparts (Amin et al., 2009b; Kramer et al., 2020). Interestingly, if a general nutrient deficiency causes attacks, iron supplementation increases this number of attacks (Figure 4D), suggesting the importance of iron absorption in the attack behavior. Future studies should determine whether a nutrient deficiency increases the iron absorption capacity of Vibrio bacteria and whether this could play a major role in the attack mechanism.
This study showed that QS is not involved in microbial attacks. Thus, V. atlanticus LGP32 mutants lacking the genes involved in known QS pathways exhibit the same phenotype as wild-type V. atlanticus LGP32, and Vibrio density does not induce attacks. However, V. atlanticus LGP32 produces AI-2 during attacks. QS and iron acquisition are sometimes interconnected in Vibrio (McRose et al., 2018). For example, in Vibrio vulnificus, the production of vulnibactin (a siderophore) is known to be controlled by AI-2 (Kim and Shin, 2011). Similarly, AI-2 could be involved in the production of vibrioferrin in V. atlanticus LGP32.
In the natural environment, associations between bacteria and algae have already been observed (Lopez-Joven et al., 2018; Miller et al., 2005; Rosales et al., 2022; Xu et al., 2022). We have shown here that algal attacks by Vibrio can be carried out in vitro. Environmental data collected in the Thau lagoon showed a correlation between the presence of Alexandrium and that of Vibrio, suggesting that such interactions could also occur in the marine environment. If that were the case, this behavior would provide an important ecological advantage to Vibrio to obtain nutrients in the environment, where Alexandrium spp. and G. catenatum form blooms.
With more than 30 species distributed all over the world (Anderson et al., 2012; Hallegraeff et al., 2021), Alexandrium spp. and Gymnodinium spp., considered as invasive species by the Delivering Alien Invasive Species Inventories for Europe (http://www.europe-aliens.org), could play an unexpected and important role in maintaining, structuring, and regulating Vibrio populations in the ecosystem. In turn, Vibrio could contribute to the regulation and control of their blooms.
To conclude, this study reveals the capacity of some Vibrio spp. to act as facultative predator-like bacteria that hunt specific algae. In the current context of climate change, which is favorable to their development, monitoring the invasive algae Alexandrium spp. and G. catenatum should be considered not only for their potent harmful effect on humans and animals, but also because they may represent a potential source of nutrients for the expansion of Vibrio, particularly pathogenic species (Lemire et al., 2015).
Data availability
Data generated or analysed during this study are included in the manuscript.
References
-
Vibrioferrin, an unusual marine siderophore: iron binding, photochemistry, and biological implicationsInorganic Chemistry 48:11451–11458.https://doi.org/10.1021/ic9016883
-
Non-cholera vibrios: the microbial barometer of climate changeTrends in Microbiology 25:76–84.https://doi.org/10.1016/j.tim.2016.09.008
-
Reactive trace metals in the stratified central North PacificGeochimica et Cosmochimica Acta 58:3171–3182.https://doi.org/10.1016/0016-7037(94)90044-2
-
Environmental parameters associated with incidence and transmission of pathogenic Vibrio sppEnvironmental Microbiology 23:7314–7340.https://doi.org/10.1111/1462-2920.15716
-
BookFood Web and Ecosystem Impacts of Harmful Algae, in: Harmful Algal BloomsJohn Wiley & Sons, Ltd.https://doi.org/10.1002/9781118994672
-
BookSummaryIn: Burnham KP, Anderson DR, editors. Model Selection and Multimodel Inference: A Practical Information-Theoretic Approach. New York, NY: Springer. pp. 437–454.https://doi.org/10.1007/978-0-387-22456-5_8
-
Harmful algal blooms significantly reduce the resource use efficiency in a coastal plankton communityThe Science of the Total Environment 704:135381.https://doi.org/10.1016/j.scitotenv.2019.135381
-
Algicidal bacteria: a review of current knowledge and applications to control harmful algal bloomsFrontiers in Microbiology 13:871177.https://doi.org/10.3389/fmicb.2022.871177
-
Interbacterial competition and anti-predatory behaviour of environmental Vibrio cholerae strainsEnvironmental Microbiology 22:4485–4504.https://doi.org/10.1111/1462-2920.15224
-
The impact of protozoan predation on the pathogenicity of Vibrio choleraeFrontiers in Microbiology 11:17.https://doi.org/10.3389/fmicb.2020.00017
-
Two vibrio splendidus related strains collaborate to kill Crassostrea gigas: taxonomy and host alterationsDiseases of Aquatic Organisms 62:65–74.https://doi.org/10.3354/dao062065
-
Perceived global increase in algal blooms is attributable to intensified monitoring and emerging bloom impactsCommunications Earth & Environment 2:117.https://doi.org/10.1038/s43247-021-00178-8
-
Multiple micro-predators controlling bacterial communities in the environmentCurrent Opinion in Biotechnology 27:185–190.https://doi.org/10.1016/j.copbio.2014.02.003
-
Fitness factors in vibrios: a mini-reviewMicrobial Ecology 65:826–851.https://doi.org/10.1007/s00248-012-0168-x
-
Modulation of iron-uptake systems by a mutation of luxS encoding an autoinducer-2 synthase in Vibrio vulnificusBiological & Pharmaceutical Bulletin 34:632–637.https://doi.org/10.1248/bpb.34.632
-
Phylogenetic relationships of marine bacteria, mainly members of the family Vibrionaceae, determined on the basis of 16S rRNA sequencesInternational Journal of Systematic Bacteriology 43:8–19.https://doi.org/10.1099/00207713-43-1-8
-
Bacterial siderophores in community and host interactionsNature Reviews Microbiology 18:152–163.https://doi.org/10.1038/s41579-019-0284-4
-
Widespread predatory abilities in the genus StreptomycesArchives of Microbiology 196:235–248.https://doi.org/10.1007/s00203-014-0961-7
-
BookQuorum sensing in marine biofilms and environmentsIn: Lami R, editors. Quorum Sensing. Academic Press. pp. 55–96.https://doi.org/10.1016/B978-0-12-814905-8.00003-4
-
Construction of a Vibrio splendidus mutant lacking the metalloprotease gene vsm by use of a novel counterselectable suicide vectorApplied and Environmental Microbiology 73:777–784.https://doi.org/10.1128/AEM.02147-06
-
Isolation of Vibrio harveyi from diseased kuruma prawns Penaeus japonicusCurrent Microbiology 33:129–132.https://doi.org/10.1007/s002849900087
-
Mediterranean alien harmful algal blooms: origins and impactsEnvironmental Science and Pollution Research International 28:3837–3851.https://doi.org/10.1007/s11356-020-10383-1
-
Predatory prokaryotes: an emerging research opportunityJournal of Molecular Microbiology and Biotechnology 4:467–477.
-
Siderophore-based iron acquisition and pathogen controlMicrobiology and Molecular Biology Reviews 71:413–451.https://doi.org/10.1128/MMBR.00012-07
-
Solubility of Fe(III) in seawaterEarth and Planetary Science Letters 154:323–329.https://doi.org/10.1016/S0012-821X(97)00179-9
-
Iron absorption and transport in microorganismsAnnual Review of Nutrition 1:27–46.https://doi.org/10.1146/annurev.nu.01.070181.000331
-
Biotic control of harmful algal blooms (HABs): A brief reviewJournal of Environmental Management 268:110687.https://doi.org/10.1016/j.jenvman.2020.110687
-
Quorum sensing signal-response systems in Gram-negative bacteriaNature Reviews. Microbiology 14:576–588.https://doi.org/10.1038/nrmicro.2016.89
-
Bacterial predation: 75 years and counting!Environmental Microbiology 18:766–779.https://doi.org/10.1111/1462-2920.13171
-
A new mathematical model for relative quantification in real-time RT-PCRNucleic Acids Research 29:e45.https://doi.org/10.1093/nar/29.9.e45
-
Role of predatory bacteria in the termination of a cyanobacterial bloomMicrobial Ecology 41:97–105.https://doi.org/10.1007/s002480000074
-
SoftwareR: a language and environment for statistical computingR Foundation for Statistical Computing, Vienna, Austria.
-
Straightforward N-Acyl homoserine lactone discovery and annotation by LC-MS/MS-based molecular networkingJournal of Proteome Research 21:635–642.https://doi.org/10.1021/acs.jproteome.1c00849
-
Vibrio tasmaniensis sp. nov., isolated from Atlantic salmon (Salmo salar L.)Systematic and Applied Microbiology 26:65–69.https://doi.org/10.1078/072320203322337326
-
Bacterial-fungal interactions in the kelp endomicrobiota drive autoinducer-2 quorum sensingFrontiers in Microbiology 10:1693.https://doi.org/10.3389/fmicb.2019.01693
-
Copper homeostasis at the host vibrio interface: lessons from intracellular vibrio transcriptomicsEnvironmental Microbiology 18:875–888.https://doi.org/10.1111/1462-2920.13083
-
Borate as a synergistic anion for Marinobacter algicola ferric binding protein, FbpA: a role for boron in iron transport in marine lifeJournal of the American Chemical Society 135:14504–14507.https://doi.org/10.1021/ja406609s
-
Size‐fractionated iron concentrations in the water column of the western North Atlantic OceanLimnology and Oceanography 39:1119–1129.https://doi.org/10.4319/lo.1994.39.5.1119
-
Co-occurrence of chromophytic phytoplankton and the Vibrio community during Phaeocystis globosa blooms in the Beibu GulfScience of The Total Environment 805:150303.https://doi.org/10.1016/j.scitotenv.2021.150303
-
Dynamics of solitary predation by Myxococcus xanthus on Escherichia coli observed at the single-cell levelApplied and Environmental Microbiology 86:e02286-19.https://doi.org/10.1128/AEM.02286-19
Article and author information
Author details
Funding
Horizon 2020 Framework Programme (European VIVALDI grant 678589)
- Jean-Luc Rolland
Institut National des Sciences de l'Univers (French EC2CO ROSEOCOM)
- Jean-Luc Rolland
Institut Français de Recherche pour l'Exploitation de la Mer (ALGOVIR)
- Jean-Luc Rolland
The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.
Acknowledgements
The authors thank F Le Roux and Y Labreuche for their gift of Vibrio mutants; E Garcés, S Turki, H Frehi, A Bouquet, and W Medhioub for their contribution in obtaining Mediterranean phytoplankton strains; K Escoubeyrou and D Stien for advice on HRMS/MS data; V Diakou-Verdin and E Jublanc from the Montpellier RIO Imaging Platform for access to microscope facilities (www.mri.cnrs.fr); P Clair from the Montpellier qPHD platform and the Technoviv platform of the UPVD for access to PCR facilities; Luc Markiw, N Brunet, A Lang, A Payelleville, T Milhau, and M Leroy for their technical assistance; The IFREMER LER-LR laboratory for access to the Thau Lagoon; the BIO2MAR platform at the Observatoire Océanologique de Banyuls for providing access to UHPLC-HRMS/MS facilities. European VIVALDI grant 678589, French EC2CO ROSEOCOM grant and IFREMER ALGOVIR grant.
Version history
- Preprint posted:
- Sent for peer review:
- Reviewed Preprint version 1:
- Reviewed Preprint version 2:
- Reviewed Preprint version 3:
- Version of Record published:
Cite all versions
You can cite all versions using the DOI https://doi.org/10.7554/eLife.107221. This DOI represents all versions, and will always resolve to the latest one.
Copyright
© 2025, Rolland et al.
This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.
Metrics
-
- 949
- views
-
- 66
- downloads
-
- 0
- citations
Views, downloads and citations are aggregated across all versions of this paper published by eLife.