ATAD2 mediates chromatin-bound histone chaperone turnover
- Université Grenoble Alpes, INSERM U1209, CNRS UMR 5309, Institute for Advanced Biosciences, France
- Aix-Marseille Université, France
Figures
Figure 1
Atad2 is highly expressed in post-meiotic male germ cells.
(A) The exon/intron organization of Atad2 gene and the two ATAD2-encoding transcriptional units (encoding for ATAD2-long and ATAD2-short) are indicated (Dyer et al., 2025). The red arrows indicate the position of insertion of the Lac-Z-Lox-Neo-Lox cassette. (B) Gene targeting strategy for the generation of the Atad2 KO allele is represented. Exon number and relative position, selection gene cassettes, LoxP sites, and Frt sites are indicated. Crossing mice bearing this construct with CMV-Cre mice resulted in the generation of the Atad2 Lac ZΔNeo-Exon12 allele, which can be verified through PCR amplification of the genomic DNA (shown on the ethidium bromide-stained gel). The expected amplified bands for each genotype allowing the detection of both wild-type and KO alleles of Atad2 are indicated. E=Exon. (C) Total protein extracts from wild-type (WT), heterozygous (HET) and Atad2 homozygous knockout (KO) mice testes were probed with anti-ATAD2 and anti-H3 antibodies as indicated. Four different mice were used for this experiment. (D) Seminiferous tubule sections from wild-type and Atad2 KO mice were stained with X-gal to visualize lacZ gene expression and β -galactosidase activity under the endogenous Atad2 gene promoter. Testes from three different wild-type and Atad2 KO mice were used to generate the represented sections. Scale bar: 200 μm.
-
Figure 1—source data 1
PDF file containing original western blots for Figure 1C, indicating the relevant bands.
- https://cdn.elifesciences.org/articles/107582/elife-107582-fig1-data1-v1.zip
-
Figure 1—source data 2
Original files for western blot analysis displayed in Figure 1C.
- https://cdn.elifesciences.org/articles/107582/elife-107582-fig1-data2-v1.zip
Figure 2
Atad2 gene inactivation leads to the accumulation of HIRA.
(A) Total protein extracts from the testes of five wild-type (WT) and five Atad2 KO mice were used to detect HIRA and H3 by immunoblotting. The panel shows a representative immunoblotting after HIRA detection. The histogram in the right panel shows the quantification of HIRA immunoblotting signal normalized to H3. The mean ± standard deviation was 0.86±0.21 for wild type and 1.15±0.06 for Atad2 KO samples. The P value was 0.02 for unpaired Student t-test. (B) Protein extracts from fractionated spermatogenic cells from wild-type (Atad2 WT) and knockout (Atad2 KO) mice (pool of testes from three individuals per genotype) were used to detect HIRA and H3 by immunoblotting.
-
Figure 2—source data 1
PDF file containing original western blots for Figure 2A, indicating the relevant bands.
- https://cdn.elifesciences.org/articles/107582/elife-107582-fig2-data1-v1.zip
-
Figure 2—source data 2
Original files for western blot analysis displayed in Figure 2A.
- https://cdn.elifesciences.org/articles/107582/elife-107582-fig2-data2-v1.zip
-
Figure 2—source data 3
PDF file containing original western blots for Figure 2B, indicating the relevant bands.
- https://cdn.elifesciences.org/articles/107582/elife-107582-fig2-data3-v1.zip
-
Figure 2—source data 4
Original files for western blot analysis displayed in Figure 2B.
- https://cdn.elifesciences.org/articles/107582/elife-107582-fig2-data4-v1.zip
Figure 3
Enhanced H3.3 detection in Atad2 KO post-meiotic cells.
A specific antibody against H3.3 was used to detect H3.3 in round spermatid cells from wild-type (Atad2 WT) and knockout (Atad2 KO) mice. Round spermatids are recognizable by their distinctive Hoechst-bright chromocenter (upper panels). The lower panels represent a higher magnification of selected cells that are displayed at lower magnification in the upper panels. The images show H3.3 labeling and Hoechst staining alone or the merged images of these staining as indicated. The nuclear boundaries defined by Hoechst staining are outlined by white lines.
Figure 4
ATAD2 controls active gene TSS accessibility.
(A) Gene selection according to expression in wild-type round spermatids. The plot displays the mean expression levels (y-axis, labeled as "mean expression level") versus the corresponding standard deviations (x-axis), both calculated from three independent biological replicates of isolated round spermatids. The standard deviation reflects the variability of gene expression across biological replicates. Genes were grouped into four categories (Group 1: blue, Group 2: cyan, Group 3: green, Group 4: orange) according to the quartile of their mean expression. For Group 4, all genes have no detectable expression, resulting in a mean expression of zero and a standard deviation of zero; consequently, the 5611 genes in this group are represented by a single overlapping point (red open circle) at the origin. (B) Heatmap on ATAC-seq signal. The heatmap shows the ATAC-seq signal of each group (Group 1 in blue, Group 2 in cyan, Group 3 in green, and Group 4 in orange) in rows, for 4 Atad2 WT and 4 Atad2 KO samples in columns. (C) Profiles according to selected genes. The mean profiles are displayed together with their variability (±2 s.e.m.) across the four replicates for both Atad2 WT (blue) and Atad2 KO (red). For groups 1, 2, and 3, the envelopes of the curves remain clearly separated around the peak, indicating a consistent difference in signal between the two conditions. In contrast, group 4 does not present a strong signal and, accordingly, no marked difference is observed between Atad2 WT and KO in this group.
Figure 5 with 1 supplement
ATAD2 enhances H3.3 gene regulatory functions.
(A) Expression profiles of post-meiotic H3.3-activated genes. The heatmap (left panel) displays the normalized expression levels of genes identified by Fontaine and colleagues as upregulated in the absence of histone H3.3 (Fontaine et al., 2022) for Atad2 WT (WT) and Atad2 KO (KO) samples at days 20, 22, 24, and 26 PP (D20 to D26). The color scale represents the z-score of log-transformed DESeq2-normalized counts. The middle panel box plots display pooled, normalized expression levels, aggregated across replicates and genes, for each condition (WT and KO) and each time point (D20 to D26). Statistical significance between WT and KO conditions was determined using a two-sided t-test, with p-values indicated as follows: * for P-value <0.05, ** for P-value <0.01 and *** for P-value <0.001. The right panel shows the results of gene set enrichment analysis (GSEA), which assesses whether predefined groups of genes show statistically significant differences between conditions. Here, the post-meiotic H3.3-activated genes set, identified by Fontaine et al., 2022, is significantly enriched in Atad2 KO compared with WT samples at day 26 (P<0.05, FDR <0.25). Colored vertical bars indicate the “leading edge” genes (i.e., those contributing most to the enrichment signal), located before the point of maximum enrichment score. (B) As shown in (A) but for the "post-meiotic H3.3-repressed genes" gene set. (C) As shown in (A) but for the " sex chromosome-linked genes " gene set.
Figure 5—figure supplement 1
Venn diagrams showing the overlap of significantly differentially expressed genes between Atad2 KO and Atad2 WT samples at day 26 post-partum (PP), compared with three gene sets reported by Fontaine et al., 2022.
(A) Genes upregulated in the absence of histone H3.3 in both Atad2 WT and Atad2 KO samples at day 26 PP. (B) Genes repressed under the same conditions, and (C) sex chromosome–linked genes. In the differential expression analysis, a fold change greater than 1.2 between Atad2 KO and Atad2 WT samples was considered significant.
Figure 6 with 2 supplements
ATAD2 is required for efficient histone-to-protamine replacement.
(A) Spermatogenic cell preparations from wild-type and Atad2 KO mice were stained with antibodies against TH2B (in green) and transition protein 1 (TP1) or protamine 1 (PRM1) (in red). A yellow signal indicates the co-detection of TH2B along with TP1 or PRM1. The indicated fields are shown at higher magnification in panel “B”. Scale bar: 10 μm. (B) Fields shown in panel “A” are ordered to illustrate the transition from the histone-associated genome to its packaging by protamines, considering both wild-type and Atad2 KO spermatogenic cells.
Figure 6—figure supplement 1
Atad2 gene inactivation does not disrupt testis morphology, acetylation of H4K5, or the cell-specific accumulation of H2A.L.2, TP2, PRM1, and PRM2.
Paraffin-embedded sections from wild-type or Atad2 KO testes were used to visualize the accumulation of H4K5ac or expression of H2A.L.2, TP2, PRM1, and PRM2.
Figure 6—figure supplement 2
Atad2 depletion affects testis weight and mature sperm counts.
(A) Testes from six 21- to 27-week-old wild-type and Atad2 KO mice were collected, weighted (mg), and their weights normalized to body weight and only same-age mice were compared pairwise. Histograms represent the mean of the measured weights and error bars the Standard Deviation (upper panel). The p-value of pairwise Student t-test=0.004. The lower panel shows representative testes from wild-type and Atad2 KO mice. (B) Spermatozoa count (Cells/mL) was performed for pairs of wild type and Atad2 KO (n=6). The average numbers of spermatozoa counts are respectively 21.6±5.8 and 13.7±4, and the P-value of paired Student t-test=0.001.
Figure 7 with 1 supplement
ATAD2 is required for proper pre-protamine 2 processing and protamine assembly.
(A) A specific antibody raised against the processed part of pre-PRM2 (Rezaei-Gazik et al., 2022) was used to detect pre-PRM2 expression and localization in tubular elongating spermatid cells. The lower panels represent the magnification of selected cells. (B) The amount of pre-PRM2 was detected using soluble extracts from testis of wild-type and Atad2 KO mice using ELISA. Histograms show the normalized values (pre-PRM2/tubulin) of 4 measurements of independent sedimentation samples of Elongating/Condensing fractions. Mean ± Standard Deviation is 1.6±0.2 and 2.1±0.1 for wild type and Atad2 KO samples, respectively. The p-value obtained using an unpaired Student’s t-test was 0.0158.
Figure 7—figure supplement 1
ATAD2 is required for proper pre-protamine 2 processing.
Extracts from representative samples shown in Figure 7B, derived from wild-type or Atad2 knockout cells, were analyzed by SDS–PAGE followed by immunoblotting with anti-prePRM2 and anti-histone H3 antibodies (both probed on the same blot). The developed film was aligned with the corresponding blot and photographed. M, molecular weight marker.
-
Figure 7—figure supplement 1—source data 1
PDF file containing original western blots for Figure 7—figure supplement 1, indicating the relevant bands.
- https://cdn.elifesciences.org/articles/107582/elife-107582-fig7-figsupp1-data1-v1.zip
-
Figure 7—figure supplement 1—source data 2
Original files for western blot analysis displayed in Figure 7—figure supplement 1.
- https://cdn.elifesciences.org/articles/107582/elife-107582-fig7-figsupp1-data2-v1.zip
Figure 8 with 1 supplement
ATAD2s’ function in sperm genome compaction and fertility parameters.
(A) Epididymal sperm cells were isolated by the swim-up method from wild-type or Atad2 KO mice and underwent a decompaction test and the sizes of the sperm heads were measured and represented as box plots (n=75 sperm heads / box plot). The value ranges (mean) were 10.4~19.3 (16.0) for wild type sperms without decompaction; 11.4~20.1 (16.4) for Atad2 KO sperms without decompaction; 33.4~61.8 (48.5) for wild type sperms after decompaction; 45.0~78.9 (62.6) Atad2 KO sperms after decompaction. Tukey’s HSD post two-way ANOVA test was used. ****P<0.001. (B) Pools of oocytes from C57BL6 females were obtained and used for in vitro fertilization (IVF) with spermatozoa from WT or Atad2 KO males (the experiment was repeated 4 times independently). The fertilization success rate is indicated as a percentage of oocytes giving rise to stage 2 embryos. Mean ± Standard Deviation is 25.5±14 and 12±5.2 for wild type and Atad2 KO experiments, respectively, and the P=0.002 for ratio paired Student t-test. (C) Five wild-type and five Atad2 KO male mice were each mated with two C57BL6 females, the resulting litter sizes were recorded and represented as box plots (n=28 and 30, respectively). The average numbers of pups are respectively 8.0±2.1 and 7.1±2.5 and the P-value of Student t-test=0.1.
Figure 8—figure supplement 1
Sperm head decompaction after DTT and heparin treatment in wild-type and Atad2 KO males.
Epididymal sperm were treated with a DTT/heparin/Triton mixture, fixed, and stained with DAPI. Fluorescent images were acquired using a 63×oil-immersion objective, and sperm head size was quantified with ImageJ. Scale bars represent 5 μm.
Figure 9
A model summarizing the role of ATAD2 in regulating chromatin-bound HIRA dynamics (along with other histone and non-histone protein chaperones) during the post-meiotic stages of mouse spermatogenesis.
Following the deposition of H3.3 by HIRA onto chromatin, ATAD2 facilitates the release of HIRA. In the absence of ATAD2, both HIRA and the newly incorporated H3.3 persist longer in nucleosomes. The scheme was created using BioRender (https://BioRender.com/Cmcjckk).
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Genetic reagent (Mus musculus) | Atad2 knockout-first’ allele | Skarnes et al., 2011 | KO mice | International KO Mouse Consortium; RRID:MGI:4432934 |
| Genetic reagent (Mus musculus) | Atad2LacZΔNeo-Exon12 | This paper | KO mice | Atad2 ko-first’ allele mice were crossed with CMV-Cre mice; RRID:MGI:4432934 |
| Sequence-based reagent | Atad2_84231_F | Eurogentec | Forward primer | TATCCAACAAGCCTGAGCCC |
| Sequence-based reagent | Atad2_84231_R | Eurogentec | Reverse primer | CAACTGGAGCTGGGTCTTCC |
| Sequence-based reagent | Cas-R | Eurogentec | Reverse primer | TCGTGGTATCGTTATGCGCC |
| Chemical compound, drug | Bovine Serum Albumin | Euromedex | Cat# 04-100-812-C | |
| Commercial assay or kit | Clarity Western ECL Substrate | Bio-Rad | Cat # 170-5061 | |
| Commercial assay or kit | Clarity Max Western ECL Substrate | Bio-Rad | Cat # 170-5062 | |
| Chemical compound, drug | Complete Protease inhibitor EDTA-free | Sigma-Aldrich | Cat# 4693159001 | |
| Other | Dako Fluorescent Mounting Medium | Dako | Cat# S3023 | |
| Chemical compound, drug | DL-Dithiothreitol | Euromedex | Cat# EU0006 | |
| Chemical compound, drug | DNase I recombinant | Roche | Cat# 4536282001 | |
| Chemical compound, drug | DPBS | Gibco | Cat# 14200-075 | |
| Chemical compound, drug | EDTA | Sigma-Aldrich | Cat# E6635 | |
| Chemical compound, drug | EGTA | Sigma-Aldrich | Cat# E3889 | |
| Chemical compound, drug | Formalin solution, neutral buffered, 10% | Sigma-Aldrich | Cat# HT5012 | |
| Chemical compound, drug | Glutaraldehyde solution | Sigma-Aldrich | Cat# G5882 | |
| Chemical compound, drug | Heparin sodium salt | Sigma-Aldrich | Cat# H3149 | |
| Other | Hoechst | Invitrogen | Cat# 33342 | |
| Chemical compound, drug | Human Chorionic Gonadotropin | MED-VET | Cat# Chorulon | 1500 UI |
| Chemical compound, drug | Laemmli Sample Buffer | BioRad | Cat# 1610747 | |
| Chemical compound, drug | Magnesium Chloride | Euromedex | Cat# 2189 | |
| Chemical compound, drug | Mayer’s Hematoxylin Solution | Sigma-Aldrich | Cat# MHS16 | |
| Chemical compound, drug | M2 medium | Sigma-Aldrich | Cat# M7167 | |
| Chemical compound, drug | M16 medium | Sigma-Aldrich | Cat# M7292 | |
| Other | Nitrocellulose Blotting membrane | Amersham Protran | Cat# 10600015 | |
| Other | Nonidet P 40 Substitute | Sigma-Aldrich | Cat# 74385 | |
| Other | NuPAGE 4–12% Bis-Tris Gel | Invitrogen | Cat# NP0335BOX | |
| Chemical compound, drug | Potassium Ferricyanide | Sigma-Aldrich | Cat# P-8131 | |
| Chemical compound, drug | Potassium Ferrocyanide | Sigma-Aldrich | Cat# P-9387 | |
| Chemical compound, drug | Pregnant Mare Serum Gonadotropin (PMSG) | MED-VET | Cat# Syncro-part PMSG 600 UI | |
| Chemical compound, drug | Saccharose | Sigma-Aldrich | Cat# S7903 | |
| Chemical compound, drug | Saponin from quillaja bark | Sigma-Aldrich | Cat# S7900 | |
| Chemical compound, drug | Sodium deoxycholate | Sigma-Aldrich | Cat# D6750 | |
| Other | Superfrostslides | Thermo Scientific | Cat# LCSF05 | |
| Commercial assay or kit | TMB ELISA Substrate (High Sensitivity) | Abcam | Cat# AB171523 | |
| Chemical compound, drug | Trans-Blot Turbo 5X Transfer Buffer | BioRad | Cat# 10026938 | |
| Chemical compound, drug | Triton X-100 | Sigma-Aldrich | Cat# T9284 | |
| Chemical compound, drug | TRIzol | Thermo Scientific | Cat# 15596026 | |
| Chemical compound, drug | TWEEN 20 | Sigma-Aldrich | Cat# P7949 | |
| Chemical compound, drug | Urea | Sigma-Aldrich | Cat# U5378 | |
| Chemical compound, drug | X-Gal | Invitrogen | Cat# B1690 | |
| Other | 96 Well Round (U) Bottom Plate | Thermo Scientific | Cat# 163320 | |
| Chemical compound, drug | 450 nm Stop Solution for TMB Substrate | Abcam | Cat# AB171529 | |
| Antibody | Anti-H2B testis specific (rabbit polyclonal) | Abcam | Cat# ab178426 | IF (1:100); RRID:AB_3720329 |
| Antibody | Anti-ATAD2 (rabbit polyclonal) | Homemade | This paper | WB (1:1000) generated by Covalab, France |
| Antibody | Anti-H2A.L1/L2 (rabbit polyclonal) | Homemade | SAB771 | IHC (1:200) generated by Covalab, France |
| Antibody | Anti-Histone H3 (rabbit polyclonal) | Abcam | Cat#: Ab1791 | WB (1:5000); RRID:AB_302613 |
| Antibody | Anti-H3F3B (mouse monoclonal) | Abnova | Cat#: H00003021-M01 | IF (1:200); RRID:AB_425473 |
| Antibody | Anti-H4K5Ac (mouse monoclonal) | PTM Biolabs | Cat#: PTM-163 | IHC (1:200); RRID:AB_3717383 |
| Antibody | Anti-Hira (D6O8L) (rabbit monoclonal) | Cell Signaling Technology | Cat#: 12463 | WB (1:1000); RRID:AB_2797927 |
| Antibody | Anti-Pre-PRM2 (rabbit polyclonal) | Homemade | No reference | IF (1:100); generated by Covalab, France |
| Antibody | Anti-PRM1 (mouse monoclonal) | BRIAR Patch Biosciences | Cat#: HUP1N | IHC (1:200); RRID:AB_2651186 |
| Antibody | Anti-PRM2 (mouse monoclonal) | BRIAR Patch Biosciences | Cat#: HUP2B | IHC (1:200); RRID:AB_2687949 |
| Antibody | Anti-TNP2 (B-2, mouse monoclonal) | Santa Cruz Biotechnology | Cat#: sc-393843 | IHC (1:200); RRID:AB_3720327 |
| Antibody | Goat anti-rabbit IgG (H+L)-HRP | Bio-Rad | Cat# 170–6515 | WB (1:5000); RRID:AB_11125142 |
| Antibody | Goat anti-mouse IgG (H+L)-HRP | Bio-Rad | Cat# 170–6516 | WB (1:5000); RRID:AB_11125547 |
| Antibody | Alexa Fluor 568 Goat anti-mouse IgG (H+L) | Invitrogen | Cat# A-11004 | IF (1:500); RRID:AB_2534072 |
| Antibody | Alexa Fluor 488 Goat anti-rabbit IgG (H+L) | Invitrogen | Cat# A-11034 | IF (1:500); RRID:AB_2576217 |
Additional files
-
Supplementary file 1
Source data for Figure 2A, Figure 7B, Figure 8 and Figure 6—figure supplement 2.
- https://cdn.elifesciences.org/articles/107582/elife-107582-supp1-v1.xlsx
-
MDAR checklist
- https://cdn.elifesciences.org/articles/107582/elife-107582-mdarchecklist1-v1.docx
Download links
A two-part list of links to download the article, or parts of the article, in various formats.
Downloads (link to download the article as PDF)
Open citations (links to open the citations from this article in various online reference manager services)
Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)
ATAD2 mediates chromatin-bound histone chaperone turnover
eLife 14:RP107582.
https://doi.org/10.7554/eLife.107582.3
