Enhanced processivity and collective force production of kinesin-1 at low radial forces
- University of California, Berkeley, United States
Figures
Figure 1 with 1 supplement
The DNA-tethered bead assay to reduce the z-force in the optical trap.
(A) (Left) Conventional single-bead trapping assay where a truncated, biotinylated kinesin is attached to an 860-nm-diameter streptavidin-coated bead. (Right) The DNA-tethered bead assay, where full-length KIF5B is attached to a 510-nm-diameter bead via a 2800 bp DNA handle. (B) Characteristic force-generating behavior of kinesin against a stationary trap in both a high and low z-force regime. Stalls are marked with black arrows, while premature detachments are marked with red arrows. (C) Stall force histograms of kinesin (mean ± s.e.m.) in the high and low z-force regimes. (D) The inverse cumulative distribution function (1-CDF) of the peak forces (median ± s.e.m.) of every processive run that exceeded 1.5 pN hindering force in the high (N=264) and low (N=51) z-force regimes. (E) 1-CDF of motor stall times. Solid curves represent fits to a double exponential decay to calculate the amplitude (A) and mean lifetime (τ;±s.e.). The weighted averages of the two decays are 0.27±0.02 s and 1.49±0.08 s for high (N=85) and low (N=45) z-forces, respectively.
-
Figure 1—source data 1
Excel file containing datasets for plots shown in Figure 1C–E.
- https://cdn.elifesciences.org/articles/109012/elife-109012-fig1-data1-v1.xlsx
Figure 1—figure supplement 1
Purification of kinesin and the DNA handle with experimental controls.
(A) SDS-PAGE denaturing gel of constructs used. K560-GFP-SNAP (110 kDa) was labeled with biotin, and KIF5B-GFP-SNAP (156 kDa) was labeled with a BG-functionalized DNA oligo before eluting the motor from the IgG beads during purification. (B) The long DNA handle was run on a 0.8% TAE agarose gel. Left: handle incubated with a 20-fold excess of complementary Cy3 oligo and imaged in the Cy3 channel of a Typhoon FLA 9500 fluorescence imager. Right: The same gel imaged under UV after staining in 2x GelRed for 40 min. (C) Full-length KIF5B-GFP-SNAP was incubated with a 10-fold excess of complementary Cy5-labeled oligo and run in a motility assay. The assay was performed in the presence of 10 nM MAP7. (D) Kymographs of K560-GFP-biotin (top, N=89) and Qdot 655 streptavidin quantum dots being transported by oligo-labeled KIF5B attached to the long DNA handle (bottom, N=53). Histograms of the respective velocities are shown to the right. (E) Mechanical demonstration of a bead tethered to an axoneme by the long DNA handle. After tethering to an axoneme, the bead is pulled away from the axoneme by an optical trap. The bead moved freely for ~1 µm and stayed in that position, demonstrating the formation of a long tether between the bead and the axoneme through the DNA handle. (F) 1-CDF kinesin run time under unloaded conditions in single-molecule fluorescence imaging assays (N=160 for K560 and 88 for KIF5B). Solid curves represent a fit to a single exponential decay function to calculate the lifetime of processive runs (τ,±S.E.). (G) CDF of kinesin run length under unloaded conditions in single-molecule fluorescence imaging assays. Solid curves represent a fit to a single exponential decay function to calculate the mean run length (±S.E.). In (D, F, G), KIF5B assays were performed in the presence of 50 nM MAP7.
-
Figure 1—figure supplement 1—source data 1
PDF file containing original gels for Figure 1—figure supplement 1A, B, indicating the relevant bands and treatments.
- https://cdn.elifesciences.org/articles/109012/elife-109012-fig1-figsupp1-data1-v1.pdf
-
Figure 1—figure supplement 1—source data 2
ZIP file containing raw gels for Figure 1—figure supplement 1A, B.
- https://cdn.elifesciences.org/articles/109012/elife-109012-fig1-figsupp1-data2-v1.zip
-
Figure 1—figure supplement 1—source data 3
Excel file containing datasets for plots shown in Figure 1—figure supplement 1D, F and G.
- https://cdn.elifesciences.org/articles/109012/elife-109012-fig1-figsupp1-data3-v1.xlsx
Figure 2 with 2 supplements
Kinesin exhibits asymmetric slip bond behavior under force.
(A) Example traces of kinesin motility under a 2 pN hindering force in high and low z-forces. The trap position (magenta) is updated to remain 100 nm behind the bead position along the microtubule long axis (blue). The trap stiffness is fixed at 0.02 pN nm–1 so that this separation corresponds to 2 pN. (B) Run lengths (fit parameter from single-exponential CDFs, ±s.e.), velocities (mean ±s.e.), and detachment rates (defined as the ratio of run length to velocity of the motor) for forces ranging from –4 pN to +4 pN under high (from left to right, N=60, 69, 65, 50, 167, 100, 115 runs) and low (from left to right, N=89, 76, 44, 42, 65, 64, 39 runs) z-force conditions. For –10 pN and –6 pN hindering forces, detachment rates were calculated from the run time distributions under high (N=133, 167) and low (N=43, 73) z-force regimes (Figure 2—figure supplement 2), as these conditions yielded minimal displacement. Negative and positive forces correspond to hindering (minus-ended) and assisting (plus-ended) directions, respectively. Under hindering forces, kinesin runs several-fold longer distances and has a lower detachment rate in the low z-force regime compared to the high z-force regime.
-
Figure 2—source data 1
Excel file containing datasets and average values for plots shown in Figure 2B.
- https://cdn.elifesciences.org/articles/109012/elife-109012-fig2-data1-v1.xlsx
Figure 2—figure supplement 1
Example traces for force-feedback controlled trapping of kinesin with or without a DNA handle.
Example traces for force feedback measurements under the high z-force and low z-force conditions in hindering and assisting directions. Scale bars are 1 s.
Figure 2—figure supplement 2
Raw histograms and fits to force-feedback controlled trapping of kinesin with or without a DNA handle.
(A) CDFs of run length at each condition (blue) and the corresponding fit (red). Under the 4 pN hindering condition, a small number of events demonstrated net negative run lengths. A weighted average was used to calculate the run length shown in Figure 2. From left to right, N=3, 55, 69, 65, 50, 167, 100, 115 on the top row, and 11, 78, 76, 44, 42, 65, 32, 39 in the bottom row. (B) Histograms of velocities for each condition. From left to right, N=60, 69, 65, 50, 167, 100, 115 in the top row and 89, 76, 44, 42, 65, 64, 39 in the bottom row. (C) 1-CDFs of motor attachment time to the microtubule without net positive displacement under stall or superstall forces. Solid red curves represent a fit to a single exponential decay to calculate the detachment rate (from left to right, N=167, 133, 73, 43).
-
Figure 2—figure supplement 2—source data 1
Excel file containing datasets for plots shown in Figure 2—figure supplement 2.
- https://cdn.elifesciences.org/articles/109012/elife-109012-fig2-figsupp2-data1-v1.xlsx
Figure 3 with 3 supplements
Kinesin motors team up efficiently under low z-force conditions.
(A) Schematic of the high and low z-force assays with three K560 motors bound to a DNA chassis. Left: the three-motor DNA chassis binds directly to a streptavidin-coated bead. Right: the DNA chassis with a single-stranded DNA overhang hybridizes to the overhang on the long DNA handle attached to the bead. (B) Mass photometry measurements with a DNA chassis are performed with a threefold excess of kinesin. The Gaussian mixture model identifies the mass and percentage of unbound kinesin (blue curves), chassis with one (blue curves), two (green curves), and three (red curves) motors. Mass populations of unbound motor and chassis with one motor bound cannot be distinguished from each other. (C) Example trajectories of beads driven by two and three K560 motors in the high and low z-force regimes. These assays were performed with a 10 or 20-fold excess of kinesin for two- or three-motor DNA chassis, respectively. (D) Forces (mean ± s.d.) produced by single kinesins or kinesins bound to two- or three-motor chassis under high (from left to right, N=85, 66, 158) and low z-force conditions (from left to right, N=37, 65, 66). The solid line represents a fit to a power function to calculate the scaling factor (c,±s.e.). (E) Dwell times before slips are plotted as 1-CDF. Weighted average time constants (τ,±s.e.) are extracted from fitting to a double exponential decay.
-
Figure 3—source data 1
Excel file containing datasets for plots shown in Figure 3D and E.
- https://cdn.elifesciences.org/articles/109012/elife-109012-fig3-data1-v1.xlsx
Figure 3—figure supplement 1
Purification of oligo-labeled K560 and multi-motor chassis.
(A) SDS-PAGE denaturing gel to quantify oligo labeling of K560-GFP-SNAP. Left lane: molecular weight marker. Middle lane: K560-GFP-SNAP (110 kDa). Right lane: K560-GFP-SNAP labeled with DNA oligo. Arrows show that the oligo-labeled motor is discernible from the unlabeled motor on the gel. (B) Gel extraction of multi-motor chassis. The left two lanes show three- and two-motor chassis for high z-force measurements before gel extraction. The middle two lanes show three- and two-motor chassis for high z-force measurements after gel extraction. The right two lanes show three- and two-motor chassis for low z-force measurements after gel extraction.
-
Figure 3—figure supplement 1—source data 1
PDF file containing original gels for Figure 3—figure supplement 1A and B, indicating the relevant bands and treatments.
- https://cdn.elifesciences.org/articles/109012/elife-109012-fig3-figsupp1-data1-v1.pdf
-
Figure 3—figure supplement 1—source data 2
ZIP file containing raw gels for Figure 3—figure supplement 1A and B.
- https://cdn.elifesciences.org/articles/109012/elife-109012-fig3-figsupp1-data2-v1.zip
Figure 3—figure supplement 2
Model for estimating the percentage of DNA chassis bound to two- or three-motors in mass photometry.
Free kinesin is present in a threefold molar excess of the DNA chassis. p is the probability of binding of kinesin to the DNA chassis. The model assumes no cooperativity between the binding sites on the chassis. Motor bound to chassis was calculated from the probability of chassis multiplied by the number of motors bound to the chassis. Mass photometry could not distinguish an unbound motor from chassis with one motor bound, and could not reliably detect chassis with no motor bound. p-values were calculated from the ratios of the percentages of distinct mass populations detected by mass photometry.
Figure 3—figure supplement 3
Stall force histograms (mean ± s.e.) of K560, and two- or three-motor chassis under high and low z-force conditions.
-
Figure 3—figure supplement 3—source data 1
Excel file containing datasets for plots shown in Figure 3—figure supplement 3.
- https://cdn.elifesciences.org/articles/109012/elife-109012-fig3-figsupp3-data1-v1.xlsx
Figure 4
Kinesin resists microtubule detachment and backward processive movement under low z forces.
(A) High z-forces inherent to single-bead optical trapping assays result in rapid detachment of kinesin from microtubules, whereas the motor experiences lower z-forces when carrying intracellular cargos and more persistently binds to microtubules under those conditions. (B) (Top) The tug-of-war between kinesin and dynein results in pausing or stalling the cargo movement, as well as slow motility interspersed with frequent reversals, because either motor resists detachment or backward stepping under forces generated by its opponent. (Bottom) Coordination between the opposing motors, such as activation of one motor at a time (reciprocal activation) results in fast unidirectional transport in the direction of an active motor while the inactive motor is carried as a passive cargo.
Tables
Table 1
The list of DNA constructs used in this study.
| Oligo name | Sequence |
|---|---|
| Bio forward | /5BiosG/CTCGCGGGTTTTCGCTATTTATGA |
| Kinesin reverse | CGGTATTGTTCGGGTTGCTGAT |
| K24b bottom | GACTATCAGACTTCGACAGCAAGG |
| K45b top | /5Phos/GCTGTCGAAGTCTGATAGTCAGTTA ATCCACTTATGGTTGCTCAT |
| KIF5B_Oligo_Label | /5BG/GCAACCATAAGTGGATTAACT |
| MES2C6 | /5BG/ATGACGATCTCGCGCTGACCCTGCCTCCACTA TCTGTTCATCTGACTCCTGCCATCTCTGCTCCTAGTATTGAC |
| MES_LZ | /5BG/ACCCTGCCTCCACTATCTGTTCATCTGA CTCCTGCCATCTCTGCTCCTAGTATTGACCA |
| S1-Tag Splint | GATATGGCAGACGATCTC |
| S1-2 Splint | ACTGATGCAGCGTTCTC |
| S2-3 Splint | TGACTGTCCCTCCATCA |
| M1-S1 | /5Phos/TGCATCAGTTGGTCAATACTAGGAGCAGAGATG GCAGGAGTCAGATGAACAGATAGTGGAGGCAGGGTCAGCGCGAGATCGTC |
| M2-S1 | /5Phos/GACAGTCATGGTCAATACTAGGAGCAGAGATGGCA GGAGTCAGATGAACAGATAGTGGAGGCA GGGTCAGCGCGAGATCGTCGAGAACGC |
| M3-S1 | TGGTCAATACTAGGAGCAGAGATGGCAGGAGTCAGATGA ACAGATAGTGGAGGCAGGGTCAGCGCGAGATCGTCTGATGGAGG |
| M1-Tag-Bio | /5Phos/TGCCATATCTGAAATCCTGCT/3Bio/ |
| LowZ_2BS | TGGTCAATACTAGGAGCAGAGATGGCAGGAGTCAGATGAA CAGATAGTGGAGGCAGGGTTGGTCAATACTAGGAGCAGAG ATGGCAGGAGTCAGATGAACAGATAGTGGA GGCAGGGTGCAACCATAAGTGGATTAACT |
| LowZ_3BS | TGGTCAATACTAGGAGCAGAGATGGCAGGAGTCAGAT GAACAGATAGTGGAGGCAGGGTTGGTCAATACTAGGAG CAGAGATGGCAGGAGTCAGATGAACAGATAGTGGAGGCA GGGTTGGTCAATACTAGGAGCAGAGATGGCAGGAGTCAGAT GAACAGATAGTGGAGGCAGGGTGCAACCATAAGTGGATTAACT |
| KIF_Cy5_Control | /5Cy5/AGTTAATCCACTTATGGTTGC |
| Handle_Cy3_Control | /5Cy3/GCAACCATAAGTGGATTAACT |
Additional files
Download links
A two-part list of links to download the article, or parts of the article, in various formats.
Downloads (link to download the article as PDF)
Open citations (links to open the citations from this article in various online reference manager services)
Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)
Enhanced processivity and collective force production of kinesin-1 at low radial forces
eLife 14:RP109012.
https://doi.org/10.7554/eLife.109012.3
