Translational reading frame predicts the pathogenicity of C-terminal frameshift deletions in MeCP2
- University of Edinburgh, Institute of Cell Biology, Michael Swann Building, Max Born Crescent, United Kingdom
- Center for Genomic Medicine and Department of Pathology, Massachusetts General Hospital, United States
- Department of Pathology, Harvard Medical School, United States
- Department of Molecular and Human Genetics and Neuroscience, Baylor College of Medicine, United States
- Jan and Dan Duncan Neurological Research Institute at Texas Children’s Hospital, United States
- Howard Hughes Medical Institute, United States
Figures
Figure 1
Frameshifting deletions in the C-terminal domain of MeCP2 cause Rett syndrome in humans and RTT-like phenotypes in mice.
(A) A schematic representation of human MeCP2 protein showing hemizygous missense mutations found in gnomAD v4.1.0; de novo classical RTT mutations found in RettBASE; AlphaMissense pathogenicity score; regions found in an MeCP2 ‘minigene’ (ΔNIC) and domains described in the literature: methyl-binding domain (MBD), AT-hooks (AT-1 and AT-2), nuclear localisation signal (NLS), NCoR interacting domain (NID), and the C-terminal deletion-prone region (CT-DPR). (B) DNA and amino acid sequence found in the CT-DPR, numbered according to transcript ENST00000303391.11, e2 isoform. The two most common RTT deletions are shown, referred to as CTD1 and 2 for brevity. Microhomologies believed to recombine to cause the deletions are marked on the DNA sequence as orange and green boxes, respectively, and the deleted sequences as corresponding lines below. The C-terminal amino acid sequences of CTD1 and CTD2 are shown, with the points of frameshift marked with arrows. (C) Summary of CTD1 and CTD2 knock-in mouse models.
Figure 2 with 4 supplements
Genomic deletions in the C-terminal deletion-prone region (CT-DPR) of MECP2 (high confidence sets).
(A) All hemizygous in-frame deletions in the region found in gnomAD v4.1.0 are indicated with green lines above the DNA sequence. The deletion co-ordinates (numbered according to ENST00000303391.11) and number of individuals with each deletion are shown alongside. (B) Frameshifting deletions in the CT-DPR. Above the genomic sequence, hemizygous deletions from gnomAD v4.1.0 are shown in blue. Deletions from RettBASE are shown below in red, with each deletion found in at least one individual with a de novo mutation and a diagnosis of classical RTT. Co-ordinates and number of individuals with each mutation are shown, with the two most common RTT mutations, CTD1 and CTD2, indicated.
Figure 2—figure supplement 1
GnomAD v4.1.0 missense mutations.
A comparison of mouse and human amino acid sequence in the C-terminal deletion-prone region (CT-DPR), followed by a plot of the number of individuals in gnomAD with missense mutations present (filled circles) or absent (open circles) at each position. All amino acid changes found are listed below, colour-coded according to frequency. Hemizygous, heterozygous, and homozygous mutations are included (Figure 2—figure supplement 1—source data 1).
-
Figure 2—figure supplement 1—source data 1
GnomAD C-terminal deletion-prone region (CT-DPR) missense mutations.
- https://cdn.elifesciences.org/articles/109170/elife-109170-fig2-figsupp1-data1-v1.xlsx
Figure 2—figure supplement 2
Plot of the total number of individuals in gnomAD alleles with in-frame deletions at each amino acid position in the C-terminal deletion-prone region (CT-DPR) (hemizygous and heterozygous individuals) (Figure 2—figure supplement 2—source data 1).
-
Figure 2—figure supplement 2—source data 1
GnomAD C-terminal deletion-prone region (CT-DPR) in-frame deletions.
- https://cdn.elifesciences.org/articles/109170/elife-109170-fig2-figsupp2-data1-v1.xlsx
Figure 2—figure supplement 3
Plot of the gnomAD missense mutation count in the methyl-binding domain (MBD) for comparison with Figure 2—figure supplement 1.
Mutations present (filled diamonds), no gnomAD changes (empty diamonds) (Figure 2—figure supplement 3—source data 1).
-
Figure 2—figure supplement 3—source data 1
GnomAD methyl-binding domain (MBD) missense mutations.
- https://cdn.elifesciences.org/articles/109170/elife-109170-fig2-figsupp3-data1-v1.xlsx
Figure 2—figure supplement 4
Summary of CTD C-terminal amino acid sequences and experimental MeCP2 protein levels for each.
Figure 3 with 2 supplements
C-terminal amino acid sequences of pathogenic and benign MeCP2 CTDs (high confidence sets).
(A) The three possible reading frames after frameshifts in the C-terminal deletion-prone region (CT-DPR). WT genomic sequence is shown, with all possible stop codons in red. The amino acid sequence of the WT reading frame (0) is shown in black, with +1 frame in blue and +2 in red. (B) C-terminal amino acid sequences of frameshifting deletions shown in Figure 2. Sequence after frameshift is shown in blue (+1 frame) or red (+2 frame). (C) Family pedigree showing three generations from a family with a c.1159_1210 del MECP2 mutation (black filled symbols). Asterisks indicate individuals that have not been genetically tested but are obligate heterozygotes for the mutation. (D) Genomic DNA sequence and amino acid sequence showing c.1159_1210 deletion site and molecular consequences.
Figure 3—figure supplement 1
All MECP2 C-terminal frameshifting deletion alleles in gnomAD v4.1.0 (hemi- and heterozygous).
Upper: number of individuals with each type of frameshift and number of different CTD alleles. Lower: gnomAD entries shown in (A) classified by C-terminal amino acid sequence for individuals and CTD alleles.
Figure 3—figure supplement 2
All MECP2 C-terminal frameshifting deletion alleles in RettBASE.
Number of individuals with each type of frameshift and number of different CTD alleles and the same entries grouped by clinical diagnosis displayed in RettBASE.
Figure 4
A CTD3 mouse knock-in allele shows that c.1158_1167del is a benign mutation.
(A) Human genomic and amino acid sequence showing location of CTD3 deletion (1158_1167del). Mouse WT genomic and amino acid sequences. Differences from human sequence are shown in red. The protospacer sequence (blue) and PAM sequence (pink) used to cut the WT allele for CRISPR editing are shown, with the cut site marked with an arrow. The mouse CTD3 knock-in allele is shown with nucleotide additions and deletions to the WT allele shown in green. Changes made to the mouse sequence to reproduce the human missense tail are in blue and two silent changes which introduce a diagnostic SacII site are underlined. (B) Phenotypic scoring of hemizygous male mice with CTD1 (n = 14) and CTD3 (n = 15) knock-in alleles, and WT male littermates of CTD3 animals (n = 11). Mean ± SD (Figure 4—source data 1). (C) Body weights of animals shown in (B). Mean ± SD (Figure 4—source data 2). (D) Western blot of whole brain protein from 6-week-old male mice hemizygous for Mecp2-null, CTD1, CTD3, and WT alleles. Full-length (FL) and C-terminally deleted (CTD) MeCP2 proteins are indicated. Histone H3 is used as a loading control (Figure 4—source data 3 and 4). (E) Quantification of (D). The MeCP2 signal for each lane is divided by the histone H3 signal which acts as a loading control. This normalised MeCP2 value is expressed as a percentage of the mean WT. N = 3 animals per genotype, mean ± SD. Unpaired two-tailed t-test: CTD3 vs WT p = 0.079 (ns), CTD1 vs WT p < 0.0001 (****) (Figure 4—source data 5). (F) Quantification of Mecp2 primary transcript and mRNA in whole brain of 6-week-old male mice as in (D). N = 3 brains per genotype. Mean ± SD. Unpaired two-tailed t-test: Primary transcript CTD3 vs WT littermates p = 0.6687 (ns), CTD1 vs WT p = 0.2585 (ns), mRNA CTD3 vs WT p = 0.1055 (ns), CTD1 vs WT p = 0.0008 (***) (Figure 4—source data 6).
-
Figure 4—source data 1
CTD3 phenotypic scoring (Figure 4B).
- https://cdn.elifesciences.org/articles/109170/elife-109170-fig4-data1-v1.xlsx
-
Figure 4—source data 2
CTD3 body weights (Figure 4C).
- https://cdn.elifesciences.org/articles/109170/elife-109170-fig4-data2-v1.xlsx
-
Figure 4—source data 3
CTD3 brain raw uncropped western blots (Figure 4D).
- https://cdn.elifesciences.org/articles/109170/elife-109170-fig4-data3-v1.zip
-
Figure 4—source data 4
CTD3 brain labelled uncropped western blots (Figure 4D).
- https://cdn.elifesciences.org/articles/109170/elife-109170-fig4-data4-v1.zip
-
Figure 4—source data 5
CTD3 brain western blot quantification (Figure 4E).
- https://cdn.elifesciences.org/articles/109170/elife-109170-fig4-data5-v1.xlsx
-
Figure 4—source data 6
CTD3 RNA quantification (Figure 4F).
- https://cdn.elifesciences.org/articles/109170/elife-109170-fig4-data6-v1.xlsx
Figure 5 with 5 supplements
A CTD1 X>W knock-in mouse models adenine base editing of the CTD1 stop codon.
(A) The genomic sequence of mouse CTD1 and CTD1 X>W alleles. The mutated adenine is shown in orange, and the sequence common to all mouse CTD alleles is shaded in turquoise. (B) The amino acid consequences of alleles in (A). (C) Phenotypic scoring of hemizygous male mice with CTD1 (n = 14) and CTD1 X>W (n = 9) knock-in alleles, and WT male littermates of CTD1 X>W animals (n = 10). Mean ± SD (Figure 5—source data 1). (D) Kaplan–Meier plot of survival of animals shown in (C) (Figure 5—source data 2). (E) Western blot of whole brain protein from 6-week-old male mice hemizygous for Mecp2-null, CTD1, CTD1 X>W, and WT alleles. Full-length (FL) and C-terminally deleted (CTD) MeCP2 proteins are indicated. Histone H3 is used as a loading control (Figure 5—source data 3 and 4). (F) Quantification of (E). N = 3 animals per genotype, mean ± SD. Unpaired two-tailed t-test: CTD1 X>W vs CTD1 p < 0.0001 (****), CTD1 X>W vs WT p = 0.0021 (**) (Figure 5—source data 5).
-
Figure 5—source data 1
CTD1 X>W phenotypic scoring (Figure 5C).
- https://cdn.elifesciences.org/articles/109170/elife-109170-fig5-data1-v1.xlsx
-
Figure 5—source data 2
CTD1 X>W survival (Figure 5D).
- https://cdn.elifesciences.org/articles/109170/elife-109170-fig5-data2-v1.xlsx
-
Figure 5—source data 3
CTD1 X>W brain raw uncropped western blots (Figure 5E).
- https://cdn.elifesciences.org/articles/109170/elife-109170-fig5-data3-v1.zip
-
Figure 5—source data 4
CTD1 X>W brain labelled uncropped western blots (Figure 5E).
- https://cdn.elifesciences.org/articles/109170/elife-109170-fig5-data4-v1.zip
-
Figure 5—source data 5
CTD1 X>W brain western blot quantification (Figure 5F).
- https://cdn.elifesciences.org/articles/109170/elife-109170-fig5-data5-v1.xlsx
Figure 5—figure supplement 1
Human and mouse C-terminal deletion-prone region (CT-DPR) genomic and amino acid sequences and the structure of the mouse CTD1 X>W allele.
Differences between mouse and human sequence are shown in red. The protospacer sequence (blue) and PAM sequence (pink) used to cut the WT allele for CRISPR editing are shown, with the cut site marked with an arrow. A comparison of the mouse CTD1 and CTD1 X>W knock-in alleles. The single-nucleotide A–G change is shown in red.
Figure 5—figure supplement 2
CTD1 mouse knock-in alleles in mouse embryonic stem cell (mESC)-derived neurons.
The genomic and amino acid sequences of three CTD1 mouse knock-in alleles and western blot of MeCP2 protein from mESC-derived neurons 7 days after plating neuronal progenitors. Two independent clones per genotype, histone H3 loading control, NeuN control for differentiation status (Figure 5—figure supplement 2—source data 1 and 2).
-
Figure 5—figure supplement 2—source data 1
CTD1 allele neurons raw uncropped western blot.
- https://cdn.elifesciences.org/articles/109170/elife-109170-fig5-figsupp2-data1-v1.zip
-
Figure 5—figure supplement 2—source data 2
CTD1 allele neurons labelled uncropped western blot.
- https://cdn.elifesciences.org/articles/109170/elife-109170-fig5-figsupp2-data2-v1.zip
Figure 5—figure supplement 3
CTD2 mouse knock-in alleles in mouse embryonic stem cell (mESC)-derived neurons.
The genomic and amino acid sequences of three CTD2 mouse knock-in alleles and western blot of MeCP2 protein from mESC-derived neurons 7 days after plating neuronal progenitors. Histone H3 loading control, NeuN control for differentiation status (Figure 5—figure supplement 3—source data 1 and 2).
-
Figure 5—figure supplement 3—source data 1
CTD2 allele neurons raw uncropped western blot.
- https://cdn.elifesciences.org/articles/109170/elife-109170-fig5-figsupp3-data1-v1.zip
-
Figure 5—figure supplement 3—source data 2
CTD2 allele neurons labelled uncropped western blot.
- https://cdn.elifesciences.org/articles/109170/elife-109170-fig5-figsupp3-data2-v1.zip
Figure 5—figure supplement 4
CTD1 X>W knock-in mice: body weights of animals shown in Figure 5C, D.
Mean ± SD. CTD1 (n = 14) and CTD1 X>W (n = 9), WT male littermates of CTD1 X>W animals (n = 10) (Figure 5—figure supplement 4—source data 1).
-
Figure 5—figure supplement 4—source data 1
CTD1 X>W weights.
- https://cdn.elifesciences.org/articles/109170/elife-109170-fig5-figsupp4-data1-v1.xlsx
Figure 5—figure supplement 5
CTD1 X>W knock-in mice: quantification of Mecp2 primary transcript and mRNA in whole brain of 6-week-old male mice.
N = 3 brains per genotype. Mean ± SD. Unpaired two-tailed t-test: Primary transcript CTD1 X>W vs WT littermates p > 0.9999 (ns), CTD1 vs WT p = 0.2585 (ns), mRNA CTD1 X>W vs WT p = 0.1419 (ns), CTD1 vs WT p = 0.0008 (***) (Figure 5—figure supplement 5—source data 1).
-
Figure 5—figure supplement 5—source data 1
CTD1 X>W RNA quantification.
- https://cdn.elifesciences.org/articles/109170/elife-109170-fig5-figsupp5-data1-v1.xlsx
Figure 6 with 2 supplements
Flp-In T-REx cell lines reproduce the reduction in MeCP2 protein and mRNA seen with CTD knock-in mouse alleles.
(A) Schematic of Mecp2 transgenes in Flp-In T-REx cell lines. Deletions are introduced into a full-length e1 Mecp2 cDNA, with a bovine growth hormone (BGH) polyadenylation signal and tetracycline-inducible CMV promoter. (B) Western blot with whole cell lysates from independent Flp-In T-REx clones carrying mouse cDNA transgenes (24 hr tetracycline induction). Sin3a loading control (Figure 6—source data 1 and 2). (C) Quantification of MeCP2 protein expression from (B). N = 2 clones per genotype, mean ± SD. Unpaired two-tailed t-test: WT vs CTD1 p = 0.0035 (**), WT vs CTD2hu p = 0.0099 (**), WT vs CTD2mo p = 0.2101 (ns) (Figure 6—source data 3). (D) Quantification of Mecp2 transgene mRNA from the same experiment as (B) and (C). N = 2 clones per genotype, mean ± SD. Unpaired two-tailed t-test: WT vs CTD1 p = 0.0057 (**), WT vs CTD2hu p = 0.0208 (*), WT vs CTD2mo p = 0.0171 (*) (Figure 6—source data 4).
-
Figure 6—source data 1
Mouse T-REx raw uncropped western blot (Figure 6B).
- https://cdn.elifesciences.org/articles/109170/elife-109170-fig6-data1-v1.zip
-
Figure 6—source data 2
Mouse T-REx labelled uncropped western blot (Figure 6B).
- https://cdn.elifesciences.org/articles/109170/elife-109170-fig6-data2-v1.zip
-
Figure 6—source data 3
Mouse T-REx western blot quantification (Figure 6C).
- https://cdn.elifesciences.org/articles/109170/elife-109170-fig6-data3-v1.xlsx
-
Figure 6—source data 4
Mouse T-REx RNA quantification (Figure 6D).
- https://cdn.elifesciences.org/articles/109170/elife-109170-fig6-data4-v1.xlsx
Figure 6—figure supplement 1
Flp-In T-REx cell lines with human MECP2 transgenes.
Schematic of human MECP2 transgenes in Flp-In T-REx cell lines and western blot with whole cell lysates from independent Flp-In T-REx clones carrying human cDNA transgenes (24 hr tetracycline induction). Two clones per construct, Sin3a loading control (Figure 6—figure supplement 1—source data 1 and 2).
-
Figure 6—figure supplement 1—source data 1
Human T-REx raw uncropped western blot.
- https://cdn.elifesciences.org/articles/109170/elife-109170-fig6-figsupp1-data1-v1.zip
-
Figure 6—figure supplement 1—source data 2
Human T-REx labelled uncropped western blot.
- https://cdn.elifesciences.org/articles/109170/elife-109170-fig6-figsupp1-data2-v1.zip
Figure 6—figure supplement 2
Quantification of human MeCP2 protein and mRNA expression from Flp-In T-REx cell lines.
Protein: N = 2 independent clones per genotype, with three technical replicates per clone, mean ± SD. Unpaired two-tailed t-test: WT vs CTD1 p = 0.0042 (**), WT vs CTD2 p = 0.0060 (**) (Figure 6—figure supplement 2—source data 1). mRNA: N = 2 independent clones per genotype, three technical replicates per clone mean ± SD. Unpaired two-tailed t-test: WT vs CTD1 p = 0.0126 (*), WT vs CTD2 p = 0.0099 (**) (Figure 6—figure supplement 2—source data 2).
-
Figure 6—figure supplement 2—source data 1
Human T-REx western blot quantification.
- https://cdn.elifesciences.org/articles/109170/elife-109170-fig6-figsupp2-data1-v1.xlsx
-
Figure 6—figure supplement 2—source data 2
Human T-REx RNA quantification.
- https://cdn.elifesciences.org/articles/109170/elife-109170-fig6-figsupp2-data2-v1.xlsx
Figure 7 with 5 supplements
Base editing of mouse CTD transgenes in Flp-In T-REx cell lines.
(A) Target genomic sequence and sgRNAs. The target A (position 0) is shown in green, with two bystander As within the guide sequence shown in blue (positions +6 and+9). Target site protospacer sequences are shown along with the PAM; the gRNA spacers are preceded by an additional G added to promote RNA polIII transcription. (B) ABE and gRNA constructs used for transfection experiments. (C) Editing efficiency following transfection of mouse CTD1 Flp-In T-REx cells with ABE8e-SpG or ABE8e-SpRY base editors and gRNA expression plasmids. Editing efficiency at the target and bystander As is quantified by amplicon sequencing (N=3 transfections per ABE/guide combination) (Figure 7—source data 1). (D) Western blot showing MeCP2 protein levels from the experiment in (C) after 24-hr induction of transgene expression. The red arrow indicates MeCP2 CTD1 protein after editing (CTD1 X>W) (Figure 7—source data 2–4).
-
Figure 7—source data 1
Mouse CTD1 T-REx editing quantification (Figure 7C).
- https://cdn.elifesciences.org/articles/109170/elife-109170-fig7-data1-v1.xlsx
-
Figure 7—source data 2
Mouse CTD1 T-REx editing raw uncropped western blots (Figure 7D).
- https://cdn.elifesciences.org/articles/109170/elife-109170-fig7-data2-v1.zip
-
Figure 7—source data 3
Mouse CTD1 T-REx editing labelled uncropped western blots – green channel (Figure 7D).
- https://cdn.elifesciences.org/articles/109170/elife-109170-fig7-data3-v1.zip
-
Figure 7—source data 4
Mouse CTD1 T-REx editing labelled uncropped western blots – red channel (Figure 7D).
- https://cdn.elifesciences.org/articles/109170/elife-109170-fig7-data4-v1.zip
Figure 7—figure supplement 1
Base editing of CTD transgenes in Flp-In T-REx cell lines.
Mouse CTD1 Flp-In T-REx cells treated with ABE/guide RNAs as shown in Figure 7C. Percentage of mapped reads with indels. Background indel rate is indicated based on the % indels found in amplicons from mock- or untransfected cells (Figure 7—figure supplement 1—source data 1).
-
Figure 7—figure supplement 1—source data 1
Mouse CTD1 T-REx editing indel quantification.
- https://cdn.elifesciences.org/articles/109170/elife-109170-fig7-figsupp1-data1-v1.xlsx
Figure 7—figure supplement 2
Quantification of total CTD MeCP2 protein levels from western blots in Figure 7D, SpG ABE8e.
N = 3 independent transfections, mean ± SD. MeCP2 protein levels are normalised to the mean no guide (g0) level for each ABE (Figure 7—figure supplement 2—source data 1).
-
Figure 7—figure supplement 2—source data 1
Mouse CTD1 T-REx editing protein quantification.
- https://cdn.elifesciences.org/articles/109170/elife-109170-fig7-figsupp2-data1-v1.xlsx
Figure 7—figure supplement 3
Editing efficiency of SpG ABE8e/mouse guide 1 at target and bystander As in mouse CTD1 and CTD2hu Flp-In T-REx cells.
Mean ± SD, N = 3 independent transfections per ABE/guide combination (Figure 7—figure supplement 3—source data 1). Western blot showing MeCP2 protein levels from the same transfections after 24-hr induction of transgene expression. The red arrow indicates MeCP2 CTD2hu protein after editing (CTD2hu X>W) (Figure 7—figure supplement 3—source data 2 and 3).
-
Figure 7—figure supplement 3—source data 1
Mouse CTD2hu T-REx editing quantification.
- https://cdn.elifesciences.org/articles/109170/elife-109170-fig7-figsupp3-data1-v1.xlsx
-
Figure 7—figure supplement 3—source data 2
Mouse CTD2hu T-REx editing raw uncropped western blot.
- https://cdn.elifesciences.org/articles/109170/elife-109170-fig7-figsupp3-data2-v1.zip
-
Figure 7—figure supplement 3—source data 3
Mouse CTD2hu T-REx editing labelled uncropped western blot.
- https://cdn.elifesciences.org/articles/109170/elife-109170-fig7-figsupp3-data3-v1.zip
Figure 7—figure supplement 4
Editing of human MECP2 CTD1 transgenes in Flp-In T-REx cells.
Target genomic sequence and sgRNAs. Target A (position 0) is shown in green, with two bystander As within the guide sequence shown in blue (positions +6 and +9). The difference between human (red) and mouse (underlined) sequences is indicated. Editing efficiency following transfection of human CTD1 Flp-In T-REx cells with ABE8e-SpG or SpRY base editors and guide RNA plasmids shown above. Editing efficiency at the target and bystander As is quantified by amplicon sequencing (n = 3 independent transfections per ABE/guide combination) (Figure 7—figure supplement 4—source data 1).
-
Figure 7—figure supplement 4—source data 1
Human CTD1 T-REx editing quantification.
- https://cdn.elifesciences.org/articles/109170/elife-109170-fig7-figsupp4-data1-v1.xlsx
Figure 7—figure supplement 5
Editing of human MECP2 CTD1 transgenes in Flp-In T-REx cells.
Western blot showing MeCP2 protein levels after 24-hr induction of transgene expression. The red arrow indicates MeCP2 CTD1 protein after editing (CTD1 X>W). Sin3a loading control. Two independent transfections are shown for each ABE/guide combination (Figure 7—figure supplement 5—source data 1–4).
-
Figure 7—figure supplement 5—source data 1
Human CTD1 T-REx SpG editing raw uncropped western blots.
- https://cdn.elifesciences.org/articles/109170/elife-109170-fig7-figsupp5-data1-v1.zip
-
Figure 7—figure supplement 5—source data 2
Human CTD1 T-REx SpG editing labelled uncropped western blots.
- https://cdn.elifesciences.org/articles/109170/elife-109170-fig7-figsupp5-data2-v1.zip
-
Figure 7—figure supplement 5—source data 3
Human CTD1 T-REx SpRY editing raw uncropped western blots.
- https://cdn.elifesciences.org/articles/109170/elife-109170-fig7-figsupp5-data3-v1.zip
-
Figure 7—figure supplement 5—source data 4
Human CTD1 T-REx SpRY editing labelled uncropped western blots.
- https://cdn.elifesciences.org/articles/109170/elife-109170-fig7-figsupp5-data4-v1.zip
Figure 8
Summary of CTD alleles used in this study.
(A) Human WT MeCP2 protein and the effect of the three possible reading frames remaining after deletions in the C-terminal deletion-prone region (CT-DPR). (B) Mecp2 knock-in mouse models. The phenotype of the hemizygous CTD1 mouse can be ameliorated by altering the C-terminal amino acid sequence in several ways. All of these lead to non-PPX endings. (C) Efficient X>W editing of CTD transgenes using ABEs and sgRNAs in transfected cells. This replicates the CTD1 X>W allele and demonstrates the potential for therapeutic use of adenine base editing for RTT patients with CTDs.
Figure 9
Flow chart for predicting the likely clinical prognosis of deletions in the C-terminal deletion-prone region (CT-DPR) of human MECP2 based on the findings in this study.
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Gene (Homo sapiens) | MECP2 | NCBI Gene | 4204 | |
| Gene (Mus musculus) | Mecp2 | NCBI Gene | 17257 | |
| Genetic reagent (Mus musculus) | Mecp2CTD1/y | PMID:29718204 | Knock in mouse line (male hemizygous) | |
| Genetic reagent (Mus musculus) | Mecp2CTD3/y | This paper | Knock in mouse line (male hemizygous) | |
| Genetic reagent (Mus musculus) | Mecp2CTD1 X>W/y | This paper | Knock in mouse line (male hemizygous) | |
| Cell line (Homo sapiens) | Flp-In T-REx 293 cells | Invitrogen | RRID:CVCL_U427 | |
| Cell line (Mus musculus) | JU09 | A gift from Joe Mee, University of Edinburgh, UK | Derived from 129/Ola E14Tg2a cells, RRID:CVCL_3505 | |
| Antibody | anti-MeCP2 (Mouse monoclonal) | Sigma-Aldrich | Men-8, RRID:AB_477235 | WB (1:2000) |
| Antibody | anti-NeuN (rabbit polyclonal) | Millipore | ABN78, RRID:AB_10807945 | WB (1:1000) |
| Antibody | anti-Histone H3 (rabbit polyclonal) | Abcam | ab1791, RRID:AB_302613 | WB (1:10,000) |
| Antibody | anti-mSin3a | Abcam | ab3479, RRID:AB_303922 | WB (1:2000) |
| Antibody | anti-mouse IgG-IRDye 800CW (donkey) | LI-COR Biosciences | RRID:AB_621847 | WB (1:10,000) |
| Antibody | anti-rabbit IgG-IRDye 680LT (donkey) | LI-COR Biosciences | RRID:AB_10956166 | WB (1:10,000) |
| Recombinant DNA reagent | ABE8e-SpG | Alves et al., 2024 | Addgene plasmid # 185911; http://n2t.net/addgene:185911; RRID:Addgene_185911 | Adenine base editor expression construct with SpG mutations |
| Recombinant DNA reagent | ABE8e-SpRY | Alves et al., 2024 | Addgene plasmid # 185912; http://n2t.net/addgene:185912; RRID:Addgene_185912 | Adenine base editor expression construct with SpRY mutations for |
| Recombinant DNA reagent | pGuide | Ding et al., 2013 | Addgene plasmid # 64711; http://n2t.net/addgene:64711; RRID:Addgene_64711 | Plasmid for expression of sgRNAs with a U6 promoter |
| Sequence-based reagent | Me2-F6 | This paper | PCR primer (amplicon for sequencing) | AGAAGGAGCACCATCATCACC |
| Sequence-based reagent | Me2-R2 | This paper | PCR primer (amplicon for sequencing) | CCATAGGCTGAGTCTTAGCTGG |
| Sequence-based reagent | Me2-Exon3 F | This paper | PCR primer (for real-time qPCR) | ACCTTGCCTGAAGGTTGGAC |
| Sequence-based reagent | Me2-Exon4 R | This paper | PCR primer (for real-time qPCR) | GCAATCAATTCTACTTTAGAGCGAAAA |
| Sequence-based reagent | Me2-Intron1 F | This paper | PCR primer (for real-time qPCR) | ACATGGCCGACAGAGTGC |
| Sequence-based reagent | Me2-Intron1 R | This paper | PCR primer (for real-time qPCR) | GCACCTGAGGAAGCAAACC |
| Sequence-based reagent | moMe2TREx F | This paper | PCR primer (for real-time qPCR) | GAGAGGAGCCTGTGGACAGC |
| Sequence-based reagent | BGHpA R | This paper | PCR primer (for real-time qPCR) | CACAGTCGAGGCTGATCAGC |
| Sequence-based reagent | CypA F | This paper | PCR primer (for real-time qPCR) | TCGAGCTCTGAGCACTGGAG |
| Sequence-based reagent | CypA R | This paper | PCR primer (for real-time qPCR) | CATTATGGCGTGTAAAGTCACCA |
| Commercial assay or kit | QuantiTect kit | QIAGEN | Cat #205311 | |
| Commercial assay or kit | SensiMIX SYBR and Fluoroscein Master Mix | Bioline | QT615-05 | |
| Commercial assay or kit | Puregene (cell) kit | QIAGEN | 158046 | |
| Commercial assay or kit | NEBNext Ultra II DNA library prep kit for Illumina | New England Biolabs | E7645L | |
| Commercial assay or kit | MiSeq Reagent Nano Kit v2 (300 cycles) | Illumina | MS-103-1001 | |
| Chemical compound, drug | Tetracycline hydrochloride | Sigma | T3383 | |
| Chemical compound, drug | Puromycin dihydrochloride | Sigma | P8833 | |
| Software, algorithm | Image Studio Lite | LI-COR Biosciences | Version 6.0.0.28 | |
| Software, algorithm | CRISPResso2 | Pinello Lab Clement et al., 2019 | RRID:SCR_021939 | |
| Software, algorithm | GraphPad Prism | GraphPad Software | Version 11.0.0 RRID:SCR_001066 |
Additional files
-
Supplementary file 1
All MECP2 mutations held in RettBASE listed by location of first nucleotide change (4664 entries).
Data downloaded 17/08/2017.
- https://cdn.elifesciences.org/articles/109170/elife-109170-supp1-v1.xlsx
-
Supplementary file 2
RettBASE frameshifting mutations in the C-terminal deletion-prone region (CT-DPR) (c.1110–1210).
All entries, listed by start of frameshift.
- https://cdn.elifesciences.org/articles/109170/elife-109170-supp2-v1.xlsx
-
Supplementary file 3
RettBASE frameshifting alleles in the C-terminal deletion-prone region (CT-DPR) (c.1110–1210) listed by start of frameshift.
The number of individuals with each allele is shown. Entries have been annotated with further details from RettBASE which were used to select a high confidence set of RTT CTD alleles (highlighted in pink): at least one individual with a diagnosis of classical Rett syndrome and at least one individual with evidence for a de novo MECP2 mutation. Frameshifts caused by insertions are also shown, with high confidence mutations highlighted in lilac. Alleles which are also found in gnomAD are indicated.
- https://cdn.elifesciences.org/articles/109170/elife-109170-supp3-v1.xlsx
-
Supplementary file 4
Set of 15 high confidence RTT CTD alleles selected from RettBASE.
- https://cdn.elifesciences.org/articles/109170/elife-109170-supp4-v1.xlsx
-
Supplementary file 5
gnomAD MECP2 missense mutations in the C-terminal deletion-prone region (CT-DPR) listed by location.
gnomAD release v4.1.0 downloaded 21/11/2024, nucleotide numbering according to transcript ENST00000303391.11.
- https://cdn.elifesciences.org/articles/109170/elife-109170-supp5-v1.xlsx
-
Supplementary file 6
gnomAD MECP2 in-frame deletions in the C-terminal deletion-prone region (CT-DPR).
High confidence mutations found in at least one hemizygous individual are highlighted in green.
- https://cdn.elifesciences.org/articles/109170/elife-109170-supp6-v1.xlsx
-
Supplementary file 7
gnomAD MECP2 missense mutations in the methyl-binding domain (MBD) listed by location (c.239–479).
- https://cdn.elifesciences.org/articles/109170/elife-109170-supp7-v1.xlsx
-
Supplementary file 8
gnomAD MECP2 frameshifting deletion alleles in the C-terminal deletion-prone region (CT-DPR).
Nine high confidence alleles which are present in at least one hemizygous individual are highlighted in blue. Two single mutations with a -PPX ending are highlighted in yellow.
- https://cdn.elifesciences.org/articles/109170/elife-109170-supp8-v1.xlsx
-
MDAR checklist
- https://cdn.elifesciences.org/articles/109170/elife-109170-mdarchecklist1-v1.docx
Download links
A two-part list of links to download the article, or parts of the article, in various formats.
Downloads (link to download the article as PDF)
Open citations (links to open the citations from this article in various online reference manager services)
Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)
Translational reading frame predicts the pathogenicity of C-terminal frameshift deletions in MeCP2
eLife 14:RP109170.
https://doi.org/10.7554/eLife.109170.3
