CROP2, a Retriever–PROPPIN complex mediating protein export from endosomes to the plasma membrane in human cells
eLife Assessment
The authors present important evidence for a WIPI2-Retriever complex (termed CROP2) that couples cargo selection to carrier fission at endosomes. CROP2 appears to function analogously to the previously described CROP1 complex, formed by WIPI1 and Retromer, with which it shares structural similarities. They provide compelling evidence that CROP1 and CROP2 regulate the trafficking of distinct subsets of cargoes; however, the cellular evidence for the existence of these distinct complexes is mostly inferred from immunoprecipitation analysis and would benefit from further validation.
https://doi.org/10.7554/eLife.109403.3.sa0Important: Findings that have theoretical or practical implications beyond a single subfield
- Landmark
- Fundamental
- Important
- Valuable
- Useful
Compelling: Evidence that features methods, data and analyses more rigorous than the current state-of-the-art
- Exceptional
- Compelling
- Convincing
- Solid
- Incomplete
- Inadequate
During the peer-review process the editor and reviewers write an eLife Assessment that summarises the significance of the findings reported in the article (on a scale ranging from landmark to useful) and the strength of the evidence (on a scale ranging from exceptional to inadequate). Learn more about eLife Assessments
Abstract
Endosomes generate tubulo-vesicular carriers to redistribute proteins between plasma membrane, Golgi, and lysosomes. These transport routes employ distinct combinations of sorting nexins with complexes such as Retromer or Retriever. We now show that, while Retromer associates with the PROPPIN WIPI1 to form the previously described CROP complex, Retriever associates with WIPI2, forming CROP2. WIPI2 integrates into Retriever-dependent coat complexes since it interacts both with the Commander subunit CCDC93 and its cognate sorting nexin SNX17. CROP and CROP2 are exclusive in their physical associations and pathway selective. Whereas CROP2 is required for endosomal exit of Integrin β1, it does not affect CROP-dependent cargos such as EGFR or GLUT1. Vice versa, CROP is not required for Integrin β1 trafficking. WIPI1 and WIPI2 rely on similar molecular features. Their activity depends on the same FSSS motif to integrate into Retromer and Retriever complexes, respectively, and on an amphipathic membrane-inserting α-helix, which conveys membrane fission activity to PROPPINs. This suggests that Retromer and Retriever coats integrate distinct PROPPIN isoforms to promote fission of the respective endosomal carriers formed by them.
Introduction
Endosomal membrane traffic regulates the abundance and activity of many receptors and transporters at the plasma membrane, which renders it critical for the development and homeostasis of cells and tissues (McNally and Cullen, 2018). In line with this, perturbations in endosomal trafficking contribute to a wide range of diseases, including cancer and some of the most common neurological disorders (Carosi et al., 2023; Mellman and Yarden, 2013; Schreij et al., 2016). Many plasma membrane proteins cycle between the cell envelope, endosomes, and the Golgi. They can move on to lysosomes for degradation unless they are retrieved before endosomes fuse with lysosomes (Cullen and Steinberg, 2018). Endosomes thus serve as sorting stations at an intersection between several compartments. To collect cargo proteins, endosomes employ a variety of coats that form tubulo-vesicular carriers. Many of them are based on sorting nexins, which scaffold the membrane into narrow tubules. Sorting nexins can act on their own, such as in the ESCPE-1 complex (Kvainickas et al., 2017; Lopez-Robles et al., 2023; Simonetti et al., 2019; Simonetti et al., 2017), or together with complexes interconnecting them, such as Retromer or Retriever and the Commander complex, into which Retriever can be integrated (Bartuzi et al., 2016; Boesch et al., 2023; Chandra et al., 2024; Healy et al., 2023; Mallam and Marcotte, 2017; McNally et al., 2017; Phillips-Krawczak et al., 2015; Seaman, 2021). Further coats, such as clathrin adapter complexes, VINE, and ACAP1-clathrin can also act on endosomes (Dai et al., 2004; Hooy et al., 2022; Li et al., 2007; Pang et al., 2014; Ren et al., 2013; Sachse et al., 2002; Shortill et al., 2022). These coat components organize a variety of endosomal protein exit routes with partially overlapping cargo specificity (Bean et al., 2017; Kvainickas et al., 2017; McGough et al., 2014; Steinberg et al., 2013), which may reflect their capacity to form hybrid carriers integrating different classes of sorting nexins (Gopaldass et al., 2026).
Retromer is part of a protein coat mediating protein exit from endosomes in association with sorting nexins, such as Vps5, Vps17, or Snx3/Grd19 in yeast, and SNX27, ESCPE-1, or SNX3 in human cells (Seaman, 2021). Retromer consists of a VPS26–VPS29–VPS35 heterotrimer, which can form higher order complexes through VPS35 and VPS26 dimerization (Collins et al., 2008; Deatherage et al., 2020; Hierro et al., 2007; Kendall et al., 2022; Kendall et al., 2020; Kovtun et al., 2018; Leneva et al., 2021; Lucas et al., 2016; Purushothaman et al., 2017). While sorting nexins themselves change the spontaneous curvature of membranes and can tubulate them (Kovtun et al., 2018; Leneva et al., 2021; van Weering et al., 2012; Zhang et al., 2021), this activity can be enhanced by the association with Retromer, which may provide additional driving force for scaffolding the membrane (Gopaldass et al., 2023).
In human cells, numerous cargos recycle back to the cell surface in a Retromer-independent manner (Steinberg et al., 2013). Many of these depend on Retriever, an evolutionarily conserved complex of VPS26C/DSCR3, VPS29, and VPS35L/C16orf62, proteins that show distant homology to the Retromer subunits (McNally et al., 2017). Whereas the overall organization and shape of Retriever resemble those of Retromer, Retriever shows different cargo specificity and distinct features. Retriever forms part of a much larger complex, Commander, which integrates Retriever with the 12-subunit CCC complex and DENND10 and cooperates with the sorting nexin SNX17 to form coats (Boesch et al., 2023; Butkovič et al., 2024; Healy et al., 2023; Martín-González et al., 2025; Singla et al., 2024; Steinberg et al., 2012). Like Retromer, also Commander can interact with WASH and thereby link to actin (Derivery et al., 2009; Gomez and Billadeau, 2009; Guo et al., 2024; Harbour et al., 2012; Jia et al., 2012; Phillips-Krawczak et al., 2015; Seaman et al., 2009).
Cargo carriers detach from endosomes by membrane fission (Gopaldass et al., 2024; Naslavsky and Caplan, 2023). Several factors have been implicated in this detachment, among them actin and the actin-controlling WASH complex (Derivery et al., 2009; Frisby et al., 2024; Gomez and Billadeau, 2009; Harbour et al., 2012; Jia et al., 2012; Seaman et al., 2009), dynamin-like GTPases and ATPases such as Vps1 and EHD1 (Arlt et al., 2015; Chi et al., 2014; Daumke et al., 2007; Deo et al., 2018; Gokool et al., 2007; Grant et al., 2001; Solinger et al., 2020), the ESCRT-III subunit IST1 (Clippinger et al., 2024) and the PROPPIN (β-propeller that binds phosphoinositides) WIPI1 and its yeast homolog Atg18 (De Leo et al., 2021; Gopaldass et al., 2024; Gopaldass et al., 2017). Coats and actin can exert forces on the underlying lipid bilayer, which not only allow the tubule to grow but may also produce friction between lipids and protein coats that contributes to fission (Johannes et al., 2014; Simunovic et al., 2018; Simunovic et al., 2017). In addition, dynamin-like proteins actively deform the bilayer to compress and destabilize it (Antonny et al., 2016). The lipid phosphatidylinositol-(3,5)-bisphosphate (PI(3,5)P2) and/or phosphatidylinositol 5-phosphate (PI5P) is also required for fission (De Leo et al., 2021; Giridharan et al., 2022; Gopaldass et al., 2017; Rivero-Ríos and Weisman, 2022; Zieger and Mayer, 2012). PROPPINs are bona-fide effectors of PI(3,5)P2 (Courtellemont et al., 2022; De Leo et al., 2021). They associate with membranes through two phosphoinositide-binding sites (Baskaran et al., 2012; Krick et al., 2012; Liang et al., 2019; Proikas-Cezanne et al., 2004; Vicinanza et al., 2015; Watanabe et al., 2012). Upon membrane binding, a hydrophobic loop, which is located between the two lipid binding sites, folds into an amphipathic α-helix that inserts into the bilayer. Thereby, PROPPINs can tubulate lipid bilayers and drive their fission (Courtellemont et al., 2022; De Leo et al., 2021; Gopaldass et al., 2017; Gopaldass and Mayer, 2024).
PROPPINs are a protein family that binds phosphatidylinositol 3-phosphate (PI3P), PI5P, and phosphatidylinositol 3,5-bisphosphate (PI(3,5)P2) (Baskaran et al., 2012; Busse et al., 2015; Dove et al., 2004; Gopaldass and Mayer, 2024; Jeffries et al., 2004; Vicinanza et al., 2015). They are conserved from yeast (Atg18, Atg21, and Hsv2) to humans (WIPI1, WIPI2, WIPI3/WDR45B, and WIPI4/WDR45) and exist in most eukaryotes in several isoforms, which can be grouped into two evolutionary clades (Dove et al., 2004; Proikas-Cezanne et al., 2015). Atg18, Atg21, WIPI1, and WIPI2 belong to one clade, Hsv2, WIPI3, and WIPI4 to the second (Cong et al., 2021; Polson et al., 2010; Strong et al., 2021). WIPI1 and WIPI2 concentrate on phagophores when autophagy is induced and they are necessary for efficient formation of autophagosomes (Dooley et al., 2014; Polson et al., 2010; Proikas-Cezanne et al., 2004). WIPI2, which has a stronger impact on autophagy, interacts with key factors for autophagosome formation.
WIPI1 and Atg18 also support membrane fission and protein sorting on endosomes and lysosomes, but for these functions they rely on molecular features that are distinct from those important to autophagy (Courtellemont et al., 2022; De Leo et al., 2021; Gopaldass et al., 2017; Gopaldass and Mayer, 2024). WIPI1 localizes to endo-lysosomal compartments, where it affects the size of endosomes and the exit of proteins from endosomes to lysosomes (EGF receptor), to the Golgi (Shiga toxin), or to the cell surface (Transferrin receptor, GLUT1) (De Leo et al., 2021; Jeffries et al., 2004). Based on the differential effects of substitutions in the two phosphoinositide-binding sites of WIPI1 it was suggested that binding of PI3P allows WIPI1 to support the formation of endosomal transport carriers while PI(3,5)P2 and lipid binding site two are needed for membrane fission at endosomes (De Leo et al., 2021). WIPI1 as well as its yeast homolog Atg18 associate with Retromer to form the CROP complex, which amplifies the fission activity of the PROPPIN and makes its binding to membrane PI(3,5)P2 dependent (Courtellemont et al., 2022; Marquardt et al., 2023). This interaction depends on a conserved FSSS motif, which can be phosphorylated (Courtellemont et al., 2022; De Leo et al., 2021; Feng et al., 2015; Gubas et al., 2024; Strong et al., 2021). This phosphorylatable FSSS motif exists also in WIPI2, where it forms also part of the binding site for ATG16L1, a core component of the autophagic machinery (Gubas et al., 2024; Strong et al., 2021).
We have recently identified the Retromer- and WIPI1-containing CROP complex as an agent supporting the export of multiple cargos from endosomes, comprising both Retromer-dependent and Retromer-independent exit routes (Courtellemont et al., 2022; De Leo et al., 2021). Since not all cargo exit from endosomes depends on WIPI1 and CROP we analysed alternative PROPPINs that might be involved in WIPI1-independent exit from endosomes. This led us to uncover a novel role for a WIPI2–Retriever complex in trafficking of Integrin β1, which we present below.
Results
WIPI1 promotes the exit of diverse cargos from endosomes, for example for transporting Transferrin to the plasma membrane, GLUT1 to the plasma membrane, EGF receptor (EGFR) to lysosomes, and Shiga toxin to the Golgi (De Leo et al., 2021). Integrin β1 provides an exception, its delivery to the cell surface being unaffected by knockout of WIPI1 (Courtellemont et al., 2022). We investigated whether the endosomal exit of Integrin β1 might depend on another PROPPIN. Since WIPI1 and WIPI2 belong to the same evolutionary clade (Bakula et al., 2013; Gopaldass and Mayer, 2024), share two predicted lipid binding sites as well as the potential to form an amphipathic helix on their CD loop 6 (Cong et al., 2021; Gopaldass et al., 2017; Polson et al., 2010), we focused our attention on WIPI2.
WIPI1 and WIPI2 are specific for distinct trafficking pathways
We tested the impact of WIPI2B knockdown (WIPI2KD) on the afore-mentioned trafficking pathways (Figure 1). siRNA against WIPI2 reduced the protein in whole cell extracts by 94% when compared to cells transfected with control siRNA (Control) (Figure 1—figure supplement 1). We analysed trafficking of EGFR from early endosomes to degradative, LAMP1-containing compartments. After 24 hr of serum starvation, cells were stimulated with EGF and analysed for EGFR localization by immunofluorescence. Fifteen minutes after EGF addition, EGFR-positive structures colocalized with the early endosomal marker EEA1 to more than 75% in both WIPI2KD and control cells, indicating that EGF had induced efficient internalization of EGFR in both cases (Figure 1A, B). After 30 and 60 min of EGF stimulation, EGFR increasingly shifted from EEA1- towards LAMP1-positive lysosomal structures in control as well as in WIPI2-silenced cells. EGFR signals declined after 60 min in the immunofluorescence images as well as in western blot analyses of the both cells (Figure 1C–E). Thus, WIPI2 knockdown does not impair EGFR trafficking from EEA1 endosomes to LAMP1-positive compartments and leaves lysosomal degradation of EGFR functional.
Effect of WIPI2 knockdown on EGFR degradation.
(A, B) Control and WIPI2KD cells were serum-starved for 24 hr and then supplemented with EGF (100 ng/ml). After the indicated periods of time, cells were fixed, permeabilized, DAPI-labelled (blue) and decorated with antibodies to EGFR (magenta), EEA1 or LAMP1 (green). Scale bars: 10 μm. (C) Colocalization of EGFR with EEA1 or LAMP1 (white) was quantified over time using the images from A and B and Manders’ correlation coefficients were calculated. M1 indicates the fraction of magenta pixels overlapping with green pixels. Values are the mean ± s.d. (n = 3). 150 cells, stemming from 3 independent biological experiments, were quantified per sample. (D) EGFR degradation. Control and WIPI2KD cells were stimulated with EGF for the indicated periods of time, lysed and subjected to SDS–PAGE and western blot analysis for EGFR. α-Tubulin served as a loading control. (E) Quantification of EGFR from (D), using the value of control cells at time 0 (cells starved for 24 hr) as 100% reference. Data are means ± s.d., from three independent experiments. Data points from these three experiments are indicated for each time point.
-
Figure 1—source data 1
Uncropped western blot images with the bands used in Figure 1 indicated by a rectangle.
- https://cdn.elifesciences.org/articles/109403/elife-109403-fig1-data1-v1.zip
-
Figure 1—source data 2
Original uncropped western blot images used to generate Figure 1.
- https://cdn.elifesciences.org/articles/109403/elife-109403-fig1-data2-v1.zip
To test the role of WIPI2 in Retromer-dependent trafficking we assayed the localization of the glucose importer GLUT1 because this protein accumulates on endosomes if its recycling to the plasma membrane through Retromer is impaired (Steinberg et al., 2013). To capture the surface fluorescence, we acquired z-stacks of non-permeabilized, immuno-stained cells, generated maximum intensity projections and integrated the fluorescence signal over the entire cell, normalized for its area as described in Materials and methods section. Non-permeabilized WIPI2KD cells showed similar cell surface staining of GLUT1 as control cells (Figure 2A, B), suggesting that also Retromer-mediated recycling of GLUT1 occurs independently of WIPI2.
GLUT1 expression and localization upon WIPI2 knockdown.
(A) GLUT1 cell surface exposure. Control and WIPI2KD cells were fixed and stained with antibody against GLUT1 and with DAPI. Where indicated, cells had been permeabilized with 0.05% saponin before staining to reduce plasma membrane staining and provide better access to GLUT1 inside the cell. Scale bars: 10 μm. (B) Quantification of GLUT1 immunofluorescence in cells from A. Regions of interest (ROIs) corresponding to each cell and in some regions outside the cells (background) were manually defined using ImageJ software. Total cell fluorescence was integrated, and the background fluorescence was subtracted. The resulting total cell fluorescence was divided by the area of the cell. This value is shown in the graph. 150 cells per condition, stemming from three independent biological experiments, were quantified. Values of individual cells and the means are presented by smaller and larger circles, respectively, coloured according to the independent experiment that generated them. p values were calculated applying an unpaired Student’s t-test with unequal variances. The analysis was performed with 99% confidence. NS: not significant (p > 0.05).
Next, we tested the requirement of WIPI2 for trafficking of Integrin β1. Surface accumulation of this Integrin subunit is unperturbed by loss of SNX27 or Retromer but depends on the SNX17–Retriever pathway (McNally et al., 2017; Steinberg et al., 2013). Knockdown of WIPI2 induced a loss of Integrin β1 immunofluorescence from the surface of HK2 cells (Figure 3A, B) and phenocopied the previously published knockdown of SNX17 (McNally et al., 2017; Steinberg et al., 2013). When the cells were detergent-permeabilized to partially remove the plasma membrane and improve accessibility of internal structures for immuno-staining, cells depleted of WIPI2 showed an accumulation of Integrin β1 on intracellular structures that colocalized with the early endosomal marker EEA1 and, to a lesser degree, with the late endosomal/lysosomal marker LAMP1 (Figure 3C–E, G). WIPI2 knockdown had no impact on the total EEA1 and LAMP1 fluorescence level per cell, suggesting that the abundance of these compartments remained the same (Figure 3F, H). In accord with previous observations (De Leo et al., 2021), Integrin β1 surface labelling in non-permeabilized cells was not affected by knockdown of WIPI1 (Figure 3—figure supplement 1). Thus, Integrin β1 recycling to the plasma membrane selectively requires WIPI2.
Impact of WIPI2 knockdown on Integrin β1 localization.
(A) Integrin β1 cell surface expression. Control and WIPI2KD cells were fixed and stained with antibody to Integrin β1 (green) and with DAPI (blue), without detergent permeabilization. Scale bars: 10 μm. (B) Quantification of Integrin β1 immunofluorescence in cells from A. Regions of interest (ROIs) corresponding to each cell and to areas outside the cells (background) were manually defined using ImageJ software. Total cell fluorescence was integrated, and the background fluorescence was subtracted. The resulting total cell fluorescence was divided by the area of the cell. This value is shown in the graph. 150 cells per condition, stemming from three independent biological experiments, were quantified. Individual cells and means are presented by smaller and larger circles, respectively, coloured according to the independent experiment that they stem from. p values were calculated through an unpaired Student’s t-test with unequal variances. The analysis was performed with 99% confidence. ***p < 0.001. (C, D) Immunofluorescence staining of intracellular Integrin β1 (green) and EEA1 (magenta) or LAMP1 (magenta) in control and WIPI2KD cells. Overlaps are marked in white. Cells had been fixed, permeabilized with 0.05% saponin and stained with antibodies to the indicated proteins. Scale bars: 10 μm. (E, G) Colocalization of Integrin β1 with LAMP1 or EEA1 was measured in cells from D, using Manders’ colocalization coefficient M2, calculated in ImageJ software. It indicates the fraction of green pixels overlapping with the magenta pixels. Colocalization was quantified from three independent biological experiments with a total of 150 cells per condition. Values of individual cells and means are presented by smaller and larger circles, respectively, coloured according to the independent experiment that they stem from. An unpaired Student’s t-test with unequal variances was used to calculate p values. The analysis was performed with 99% confidence. ***p < 0.001; ****p < 0.0001. (F, H) Quantification of LAMP1- or EEA1-immunofluorescence in cells from C or D, respectively, was performed as in B. 120 cells per condition, stemming from three independent biological experiments, were quantified. Individual cells and means are presented by smaller and larger circles, respectively, coloured according to the independent experiment that they stem from. Data are means ± s.d. p values were calculated applying an unpaired Student’s t-test with unequal variances. The analysis was performed with 99% confidence. NS: not significant (p > 0.05).
The conserved amphipathic α-helical and FSSS motifs of WIPI2 promote Integrin β1 recycling
WIPI2 shares two critical features with other PROPPINs (Gopaldass and Mayer, 2024). These include an FSSS motif and the CD loop on blade 6 of the β-propeller structure. The CD loop promotes membrane fission activity of Atg18 during the fragmentation of yeast vacuoles (Gopaldass et al., 2017) and in the detachment of endosomal carriers (De Leo et al., 2021). Upon contact with the bilayer, the loop folds into an amphipathic α-helix that is conserved among PROPPINs and necessary for membrane fission activity. To test whether the amphipathic nature of this helix also contributes to the function of WIPI2 in Integrin β1 retrieval to the cell surface, we swapped two pairs of amino acids on opposite sides of this α-helix in WIPI2 (Figure 4A). This manipulation preserves the amino acid composition of the helix but abolishes its amphipathic character. The resulting EGFPWIPI2SLoop (scrambled loop) variant and the wildtype version EGFPWIPI2WT were expressed in control and WIPI2KD cells at comparable levels, as shown by western blot (Figure 4—figure supplement 1). Whereas permeabilized WIPI2KD cells displayed Integrin β1 concentrated on perinuclear endosomes, expression of EGFPWIPI2WT rescued this phenotype (Figure 4B). EGFPWIPI2SLoop failed to induce such recovery in WIPI2KD cells. It even exerted a dominant-negative effect when expressed in control cells. (Figure 4C, D). Cells expressing EGFPWIPI2SLoop also showed conspicuous long tubules, which were more readily detectable in live cell imaging (Figure 4—figure supplement 2) than in fixed cells (Figure 4).
Role of the amphipathic α-helix of WIPI2 in Integrin β1 sorting.
(A) The amphipathic α-helix. Helical wheel projections showing the CD-loop on blade 6 of the wildtype sequence, WIPI2WT, and WIPI2SLoop. Coloured arrows indicate the two pairs of amino acids that have been swapped in WIPI2SLoop. The magnitude and direction of the hydrophobic moment of the helices was predicted using the online tool Heliquest (Gautier et al., 2008). It is indicated by the vector in the centre of the wheels. Sequences of the hydrophobic loop region of WIPI2WT and WIPI2SLoop are shown, and predicted α-helices are plotted in magenta. The two pairs of hydrophobic/hydrophilic amino acids that are swapped in WIPI2SLoop are highlighted by rectangles in the sequences. Integrin β1 localization. WIPI2KD (B) and control (C) cells were transfected with a plasmid carrying siRNA-resistant EGFPWIPI2WT or EGFPWIPI2SLoop. After 18 hr of viral transfection, cells were fixed, permeabilized with 0.05% saponin and stained with DAPI and antibodies to Integrin β1. Dashed lines indicate the circumference of untransfected cells, while transfected cells are indicated by asterisks. Scale bars: 10 μm. (D) Quantification of Integrin β1 immunofluorescence in cells from B and C. Regions of interest (ROIs) corresponding to cells expressing the indicated WIPI2 variants, and some regions outside the cells (background), were manually defined using ImageJ software. Total cell fluorescence was integrated and the background fluorescence was subtracted. The resulting total cell fluorescence was divided by the area of the cell. This value is shown in the graph. 105 cells per condition, stemming from three independent biological experiments, were quantified. Values of individual cells and means are presented by smaller and larger circles, respectively, coloured according to the independent experiment that generated them. p values were calculated applying an unpaired Student’s t-test with unequal variances. The analysis was performed with 99% confidence: ***p < 0.001; ****p < 0.0001; NS: not significant (p > 0.05).
Alignments of Atg18 and WIPI1/2 orthologs have revealed a conserved FSS/TS motif in blade 2 (Courtellemont et al., 2022; Gopaldass et al., 2017; Gopaldass and Mayer, 2024; Strong et al., 2021). On the β-propeller structure of these PROPPINS, this motif is located at the membrane-distal side. It is a potential phosphorylation site and required for the interaction of Retromer with WIPI1 and Atg18 (Courtellemont et al., 2022; Feng et al., 2015). Since the overall structural arrangement of Retriever resembles that of Retromer (Bartuzi et al., 2016; Boesch et al., 2023; Healy et al., 2023; McNally et al., 2017), we tested whether WIPI2 requires its FSSS motif to bind Retriever. To this end, we generated WIPI2S67E and WIPI2S67A to substitute the central serine in the FSSS motif and mimic effects of potential phosphorylation at this site.
The functionality of these WIPI2 variants was tested by rescuing WIPI2KD cells through expression of siRNA-resistant variants of EGFPWIPI2. Both EGFPWIPI2S67E and EGFPWIPI2S67A were expressed to similar levels as an EGFPWIPI2 wildtype allele (Figure 4—figure supplement 1). Immunofluorescence staining of non-permeabilized WIPI2KD cells showed that the expression of EGFPWIPI2WT re-established the exposure of Integrin β1 at the cell surface, while EGFPWIPI2S67A and EGFPWIPI2S67E were ineffective (Figure 5A–C). Expression of the two variants also impaired surface exposure of Integrin β1 in control cells (Figure 5B–D). This dominant-negative effect is significant because it implies that the two variants compete with the endogenous protein. To be able to do so they should be folded, suggesting that the S67 substitutions do not grossly perturb WIPI2 structure. A conspicuous consequence of both FSSS substitutions was the accumulation of EGFPWIPI2S67A and EGFPWIPI2S67E in long tubules. These tubules were very extensive in live cell imaging and easily decayed upon fixation. Co-expression of RFPRAB4 or mCherryRab5 revealed that these tubules often connected larger dot-like structures, which were positive for mCherryRab5 and/or mRFPRAB4 (Figure 4—figure supplement 2A). The tubules themselves preferentially accumulated RFPRAB4 (70% colocalization) and only little mCherryRab5 (21%) (Figure 4—figure supplement 2B). These results are consistent with the view that WIPI2-associated tubules originate mainly from early and recycling endosomes and that WIPI2 contributes fission activity to Retriever-mediated trafficking through its amphipathic helix and its FSSS motif.
Effects of the WIPI2 FSSS motif on Integrin β1 recycling.
Influence of WIPI2 variants on Integrin β1. WIPI2-knockdown (WIPI2KD, A) and control (B) HK2 cells were transfected with a plasmid expressing siRNA-resistant wildtype or the indicated FSSS variants of EGFPWIPI2. After 18 hr of viral transfection, cells were fixed (without detergent permeabilization) and stained with DAPI and antibodies to Integrin β1 (red). Dashed lines indicate the circumference of untransfected cells, while transfected cells are indicated by asterisks. Scale bars: 10 μm. (C, D) Quantification of Integrin β1 immunofluorescence in cells from A and B was performed as in Figure 4D. 105 cells per condition, stemming from three independent biological experiments, were quantified. Individual cells and means are presented by smaller and larger circles, respectively, coloured according to the independent experiment that they stem from. p values were calculated applying an unpaired Student’s t-test with unequal variances. The analysis was performed with 99% confidence: **p < 0.01; ****p < 0.0001.
WIPI2 interacts with Retriever, Commander, and SNX17
Next, we tested whether WIPI2 and WIPI1 interact with Retriever or Retromer and could become part of their respective coats. In that case, WIPI2 should interact not only with Retriever itself, but also with the sorting nexin SNX17, which binds Retriever, and perhaps the CCC subunits, which integrate Retriever into the Commander complex (Butkovič et al., 2024; Martín-González et al., 2025; Singla et al., 2024). We assayed this by co-immunoadsorption. An HA-tagged allele (WIPI2HA) was expressed in HK2 cells using lentiviruses. Extracted proteins were adsorbed to anti-HA beads and analysed by western blotting (Figure 6). Whereas the Commander subunit CCDC93 and the Retriever subunit VPS26C co-adsorbed to the beads in extracts from cells expressing WIPI2HA (Figure 6A, C), these signals were absent from cells expressing only non-tagged WIPI2. SNX17 also co-adsorbed with WIPI2HA. This interaction was abolished by knockdown of the Retriever subunit VPS26C (Figure 6B), suggesting that Retriever links WIPI2 to SNX17. WIPI2 differentiated strongly between Retromer and Retriever. Although VPS26C is quite similar to the Retromer subunit VPS26, only VPS26C co-adsorbed with WIPI2HA whereas VPS26 was not detectable (Figure 6C, D).
Integration of WIPI2 with coat subunits.
(A) Interaction of WIPI2HA with the CCC complex subunit CCDC93. Parental HK2 cells and HK2 cells stably expressing WIPI2HA were detergent solubilized, the total cell extracts were incubated with anti-HA beads and washed. Adsorbed protein was analysed by SDS–PAGE and western blotting using the indicated antibodies. The intensity of the interacting CCDC93 was quantified with a LICOR Odyssey fluorescence imager. The background from the corresponding position in the sample from cells without HA tag was subtracted. The resulting intensity is shown relative to the intensity of WIPI2HA signal on the beads. N = 3 independent biological experiments. Red bars show the means. Error bars represent the SEM. p values were calculated applying an unpaired Student’s t-test with unequal variances. **p < 0.01. (B) Retriever-dependent interaction of WIPI2HA and SNX17. HK2 cells stably expressing WIPI2HA were treated with siRNA to VPS26C (VPS26CKD), or with non-specific siRNA (VPS26CCT), and lysed. The total cell extracts were incubated with anti-HA beads and adsorbed proteins were analysed using the indicated antibodies as in A. Red bars show the means; error bars represent the SEM. N = 3 independent biological experiments. **p < 0.01. (C, D). Selectivity for Retriever versus Retromer. The co-immunoadsorption experiments were performed as in A and analysed for co-adsorbed (C) VPS26C (Retriever) or (D) VPS26 (Retromer). Red bars show the means; error bars represent the SEM. N = 3 independent experiments. **p < 0.01. NS: not significant (p > 0.05).
-
Figure 6—source data 1
Uncropped western blot images with the bands, used in Figure 6, indicated by a rectangle.
- https://cdn.elifesciences.org/articles/109403/elife-109403-fig6-data1-v1.zip
-
Figure 6—source data 2
Original uncropped western blot images used to generate Figure 6.
- https://cdn.elifesciences.org/articles/109403/elife-109403-fig6-data2-v1.zip
The situation was inversed when the HA tag was attached to WIPI1. In this case, VPS26 was recovered on the beads but VPS26C was not (Figure 7A, B). SNX27, a sorting nexin that interacts with Retromer (Simonetti et al., 2022; Temkin et al., 2011), was also co-adsorbed with WIPI1HA (Figure 7C). The immunoprecipitation results were supported by parallel immunofluorescence studies. WIPI2 colocalized preferentially with Retriever and SNX17 (Figure 7—figure supplement 1) while WIPI1 colocalized preferentially with SNX27 and Retromer (Figure 7—figure supplement 2). Moreover, WIPI2 colocalized with Integrin-β1 on early endosomal compartments positive also for SNX17, but not on late endosomal LAMP1 containing compartments (Figure 7—figure supplement 3). These results suggest that Retriever bridges WIPI2 and SNX17 and that Retromer bridges WIPI1 with SNX27, integrating these PROPPINs into their cognate Retriever or Retromer coats.
Interaction of WIPI1 with VPS26 and SNX27, but not with VPS26C.
(A) Interaction of WIPI1HA with VPS26. Parental HK2 cells and HK2 cells stably expressing WIPI1HA were detergent-solubilized, the total cell extracts were incubated with anti-HA beads and washed. Adsorbed protein was analysed by SDS–PAGE and western blotting using the indicated antibodies. The intensity of the interacting VPS26 was quantified with a LICOR Odyssey fluorescence imager. The background from the corresponding position in the sample from cells without HA-tag was subtracted. The resulting intensity is shown relative to the intensity of the WIPI1HA signal on the beads. N = 3 independent biological experiments. Red bars show the means and error bars represent the SEM. p values were calculated applying an unpaired Student’s t-test with unequal variances. **p < 0.01. (B) Lack of interaction of WIPI1HA with VPS26C. HK2 cells stably expressing WIPI1HA were used for co-immunoadsorption experiments as in A and decorated with the indicated antibodies. Red bars show the means; error bars represent the SEM. N = 3 independent biological experiments. NS: not significant (p > 0.05). (C). Interaction of WIPI1HA with SNX27. HK2 cells stably expressing WIPI1HA were used for co-immunoadsorption experiments as in A and decorated with the indicated antibodies. Red bars show the means; error bars represent the SEMN = 3 independent biological experiments. **p < 0.01.
-
Figure 7—source data 1
Uncropped western blot images with the bands used in Figure 7 indicated by a rectangle.
- https://cdn.elifesciences.org/articles/109403/elife-109403-fig7-data1-v1.zip
-
Figure 7—source data 2
Original uncropped western blot images used to generate Figure 7.
- https://cdn.elifesciences.org/articles/109403/elife-109403-fig7-data2-v1.zip
Since the FSSS motif of WIPI2 is necessary for its transport functions, we tested whether this motif affects the interactions of WIPI2 with Retriever. To this end, wildtype and the two FSSS variants of WIPI2HA were stably expressed and cell extracts were probed by the same co-adsorption approach as above (Figure 8). Whereas the Retriever subunit VPS26C was efficiently co-adsorbed with WIPI2WT-HA, WIPI2S67A-HA, and WIPI2S67E-HA labilized this interaction. Cells carrying only the non-tagged, endogenous WIPI2 yielded no VPS26C signal. Thus, the FSSS motif is required for the interaction between WIPI2 and Retriever. These results were also confirmed by immunofluorescence analysis (Figure 8—figure supplement 1), where VPS26C colocalized less with WIPI2S67A and WIPI2S67E (16%) than with the wildtype form (56%).
Impact of the FSSS motif on the WIPI2–Retriever interaction.
(A) Parental HK2 cells and HK2 cells stably expressing the indicated WIPI2HA variants were detergent solubilized. Anti-HA beads were incubated with the total cell extracts, washed, and adsorbed proteins were analysed by SDS–PAGE and western blotting using the indicated antibodies. (B) Band intensities from the blots in A were quantified with a LICOR Odyssey infrared fluorescence imager and plotted as the ratio of VPS26C over WIPI2HA. N = 3 independent biological experiments were quantified. Red bars show the means and error bars represent the SEM. p values were calculated applying an unpaired Student’s t-test with unequal variances. **p < 0.01.
-
Figure 8—source data 1
Uncropped western blot images with the bands, used in Figure 8, indicated by a rectangle.
- https://cdn.elifesciences.org/articles/109403/elife-109403-fig8-data1-v1.zip
-
Figure 8—source data 2
Original uncropped western blot images used to generate Figure 8.
- https://cdn.elifesciences.org/articles/109403/elife-109403-fig8-data2-v1.zip
The interaction of WIPI2 and Retriever is necessary for their localization on recycling endosomes
To test for the in vivo consequences of the WIPI2–Retriever interaction, we analysed the effect of the FSSS motif on the colocalization of the respective WIPI2EGFP variants with different endosomal RAB-GTPases, which were N-terminally tagged with mCherry. In line with previous studies (Polson et al., 2010; Puri et al., 2018) EGFPWIPI2WT mostly co-localized with DsRedRAB11 (58%) and mCherryRAB5 (44%), and much less with mCherryRAB7 (6%) (Figure 9, Figure 9—figure supplements 1–3). By contrast, EGFPWIPI2S67A and EGFPWIPI2S67E co-localized mainly with mCherryRAB5 (60–63%) and mCherryRAB7 (36–38%), and much less with DsRedRAB11 (12–14%). The Retriever subunit VPS35L was detected by immuno-staining. In cells expressing WIPI2WT, it mainly co-localized with DsRedRAB11 (42%) and mCherryRAB5 (43%) and less with mCherryRAB7 (23%). In EGFPWIPI2S67E and EGFPWIPI2S67A expressing cells, VPS35L distribution shifted, similarly as for EGFPWIPI2, indicating reduced presence on DsRedRAB11 compartments (12–13%), whereas co-localization with mCherryRAB5 (42–44%) was maintained and that with mCherryRAB7 (26–27%) slightly increased. Collectively, these results suggest that the FSSS motif in blade 2 of WIPI2 allows this PROPPIN to associate with Retriever, and that this association is necessary for localizing WIPI2 and Retriever on Rab11-containing recycling endosomes.
Role of the WIPI2 FSSS motif for recruiting WIPI2 and Retriever to Rab11 endosomes.
WIPI2-knockdown HK2 cells were transfected with plasmids expressing the indicated siRNA-resistant EGFPWIPI2 variants and mCherry-RAB5, mCherry-RAB7, or DsRed-Rab11. Cells were fixed, permeabilized, immuno-stained for VPS35L and analysed by confocal microscopy. Examples of the quantified images are presented in Figure 9—figure supplements 1–3. Colocalization with EGFPWIPI2 and VPS35L was assessed for: (A) RAB11, (B) RAB5, and (C) RAB7. Colocalization was quantified using Manders’ colocalization coefficient M2, calculated in ImageJ. M2 refers to the fraction of VPS35L colocalizing with the different RAB-proteins. For the triple colocalizations WIPI2/VPS35L/RAB, M2 indicates the fraction of green pixels (WIPI2) overlapping with the pixels positive for the VPS35L/RAB colocalization. Colocalization was quantified from three independent biological experiments in a total of 120 cells. Individual cells and means are presented by smaller and larger circles, respectively, coloured according to the independent experiment that they stem from. p values were calculated by an unpaired Student’s t-test with unequal variances. The analysis was performed with 99% confidence. **p < 0.01; ***p < 0.001; ****p < 0.0001; NS: not significant (p > 0.05).
Discussion
Our experiments reveal pathway specificity for WIPI1 and WIPI2 (Figure 10). The two proteins support distinct cargoes and transport routes and interact with different partners. This isoform selectivity contrasts with the roles of these proteins in their second functional domain, autophagy, which strongly depends on WIPI2 but is also significantly reduced by ablation of WIPI1 (De Leo et al., 2021; Dooley et al., 2014; Guan et al., 2001; Obara et al., 2008; Polson et al., 2010; Proikas-Cezanne et al., 2015; Proikas-Cezanne et al., 2004). Furthermore, the autophagic function of the PROPPINs also exploits other molecular features than endosomal protein exit. For autophagy, WIPI1 and its yeast orthologue Atg18 do not require the amphipathic helix in CD loop 6, which is essential for endosomal transport. It was hence proposed that WIPI1 and Atg18 perform distinct functions in autophagy and in endosomal protein exit (Courtellemont et al., 2022; De Leo et al., 2021; Gopaldass et al., 2017).
Membrane trafficking pathways supported by CROP and CROP2.
The figure summarizes the endosomal exit pathways for a variety of model cargos used here and in our previous study and their dependence on CROP or CROP2, respectively.
In endosomal transport, WIPI1 and WIPI2 display selectivity in their partners (Figure 10). WIPI1 interacts with Retromer and WIPI2 with Retriever, mirroring the impact of the two PROPPINs on the respective transport routes and cargos. WIPI1 and WIPI2 utilize the same molecular features to support these transport routes. Their FSSS motif is necessary for both isoforms to integrate with Retromer and Retriever, respectively. This, together with the similarity in the overall organization of Retromer and Retriever, suggest that they might form complexes in a similar manner. In analogy to the WIPI1–Retromer complex, which was termed CROP (Courtellemont et al., 2022), we hence refer to the WIPI2–Retriever complex as CROP2.
WIPI2-dependent transport of Integrin β1 depends on the amphipathic character of the α-helix in CD loop 6. In Atg18 and WIPI1, this helix is necessary to convey membrane fission activity, which is used both for division of the lysosome-like vacuoles of yeast and for detachment of endosomal carriers (De Leo et al., 2021; Gopaldass et al., 2017; Zieger and Mayer, 2012). This fission activity is potentiated by integrating Atg18 and WIPI1 with Retromer into the CROP complex (Courtellemont et al., 2022). Our observations suggest that WIPI2 contributes pathway-specific membrane fission activity by integrating with Retriever. In line with this, ablating the amphipathic character of its helix on CD loop 6 disrupts Integrin β1 recycling to the cell surface and leads to its accumulation in endosomal compartments. Disrupting the interaction of WIPI2 with Retriever by substituting the FSSS motif has the same effect. It also leads to the accumulation of long tubular structures, which we presume to be exaggerated endosomal carriers that continue to grow but fail to detach. This phenotype is consistent with a block in the membrane fission step that is necessary to allow the endosomal carrier to depart.
Retriever couples to other proteins that are required for endosomal protein transport. These include the CCC complex, which associates with Retriever to yield the very large Commander complex (Boesch et al., 2024; Healy et al., 2023; Laulumaa et al., 2024). How Commander is placed on the membrane is currently unknown, but the interaction between SNX17 and Retriever contributes to its recruitment (Butkovič et al., 2024; Healy et al., 2022; Singla et al., 2024; Steinberg et al., 2012) and presumably to the formation of a coat. Our pull-downs of WIPI2 detected not only the Retriever subunit VPS26C as an interactor, but also SNX17 and the CCC subunit CCDC93. This co-fractionation could be due to a direct interaction of WIPI2 with Retriever or reflect an interaction via another component of Commander. Our immunoprecipitation assays cannot distinguish and more detailed structural and interaction studies with pure compounds will be necessary to elucidate the nature of this interaction. Since Retriever is structurally similar to Retromer, WIPI2 is structurally similar to WIPI1 and Atg18, and a Retromer–Atg18 interaction could be reconstituted from pure proteins (Courtellemont et al., 2022), we consider a direct WIPI2–Retriever interaction as the more likely scenario. But in both cases our observations suggest that WIPI2 integrates into the Retriever coat and might thus bring membrane fission activity to the place where it is required for carrier formation. Here, it could synergize with other factors that support membrane fission in endosomal transport, such as EHD1, which interacts with SNX17, and the actin-regulating WASH complex, which binds to Commander (Bartuzi et al., 2016; Dhawan et al., 2022; Dhawan et al., 2020; Phillips-Krawczak et al., 2015).
The requirement of two distinct WIPI proteins, using the same molecular features, in Retromer- and Retriever-dependent transport uncovers a novel conserved element between these two pathways. In combination with the similar overall organization of Retromer and Retriever and their common interactions with EHD proteins (Arlt et al., 2015; Chi et al., 2014; Daumke et al., 2007; Deo et al., 2018; Gokool et al., 2007; Grant et al., 2001; Solinger et al., 2020) and WASH (Derivery et al., 2009; Gomez and Billadeau, 2009; Guo et al., 2024; Harbour et al., 2012; Jia et al., 2012; Phillips-Krawczak et al., 2015; Seaman et al., 2009), this supports the notion that these two membrane coats share similar mechanistic principles for their formation and/or detachment.
Materials and methods
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Cell line (Homo sapiens) | HK2 (HK-2) | ATCC | CRL-2190 RRID:CVCL_0302 | Human renal proximal tubule epithelial line; tested for mycoplasma. |
| Cell line (H. sapiens) | HEK293T (293T) | ATCC | CRL-3216 RRID:CVCL_0063 | Used for lentivirus production. |
| Transfected construct (human) | siRNA: ON-TARGETplus Human WIPI2 | Dharmacon | Cat#:J-020521 | siRNA targeting WIPI2; used at 20 nM (Materials and methods, RNA interference). |
| Transfected construct (human) | siRNA: siGENOME Non-Targeting Control Pool | Dharmacon | Cat#:D-001206-13-05 | Non-targeting control; used at 20 nM. |
| Transfected construct (human) | siRNA: VPS26C | Dharmacon | Cat#:J-012163 | siRNA targeting VPS26C used at 20 nM (Materials and methods, RNA interference). |
| Transfected construct (human) | siRNA: WIPI1 | Dharmacon | Cat#:D-018205 | siRNA targeting WIPI1 used at 20 nM (Materials and methods, RNA interference). |
| Recombinant DNA reagent | RFP-RAB4 (plasmid) | Addgene | RRID:Addgene_79800 | Deposited by J.D. Johnson. |
| Recombinant DNA reagent | DsRed-RAB11 (plasmid) | Addgene | RRID:Addgene_12679 | Deposited by R. Pagano. |
| Recombinant DNA reagent | mCherry-RAB7 (plasmid) | Addgene | RRID:Addgene_61804 | Deposited by G. Voeltz. |
| Recombinant DNA reagent | mCherry-RAB5 (plasmid) | Addgene | RRID:Addgene_49201 | Deposited by G. Voeltz. |
| Recombinant DNA reagent | EGFP-WIPI2 (pAR31CD vector) | Other | Gift from T. Proikas-Cezanne (University of Tübingen, Germany). | |
| Recombinant DNA reagent | EGFP-WIPI1 (pAR31CD vector) | Other | Gift from T. Proikas-Cezanne (University of Tübingen, Germany). | |
| Recombinant DNA reagent | Modified pLKO.1 lentiviral vector | Sigma-Aldrich | Backbone for WIPI2-HA/WIPI1-HA; modified with a 3Gly-Ser-3Gly-Ser-HA-HA tag (GeneScript). | |
| Recombinant DNA reagent | WIPI2-HA (WT, S67A, S67E) | This paper | C-terminal HA-tagged, lentiviral (modified pLKO.1); see Materials and methods. | |
| Recombinant DNA reagent | WIPI1-HA | This paper | C-terminal HA-tagged; see Materials and methods. | |
| Recombinant DNA reagent | EGFP-WIPI2 S67A; EGFP-WIPI2 S67E (siRNA-resistant) | This paper | FSSS-motif variants; QuikChange mutagenesis (Materials and methods). | |
| Recombinant DNA reagent | EGFP-WIPI2 SLoop (siRNA-resistant) | This paper | Scrambled CD-loop amphipathic-helix variant; see Materials and methods. | |
| Sequence-based reagent | WIPI2 S67E mutagenesis primers (Fw/Rv) | This paper | PCR primers | Fw: AGATTGTTCTCCGAGAGCCTAGTGGCC; Rv: GGCCACTAGGCTCTCGGAGAACAATCT (Microsynth). |
| Sequence-based reagent | WIPI2 S67A mutagenesis primers (Fw/Rv) | This paper | PCR primers | Fw: AGATTGTTCTCCGCTAGCCTAGTGGCC; Rv: GGCCACTAGGCTAGCGGAGAACAATCT (Microsynth). |
| Sequence-based reagent | WIPI2 siRNA-resistance mutagenesis primers (Fw/Rv) | This paper | PCR primers | Fw: CGATAGTCCTTTAGCCGCA; Rv: TGCGGCTAAAGGACTATCG (Microsynth). |
| Sequence-based reagent | WIPI2 SLoop mutagenesis primers | This paper | PCR primers | Four consecutive primer pairs; sequences in Materials and methods (site-directed mutagenesis). |
| Antibody | anti-CCDC93 (rabbit polyclonal) | Proteintech | Cat#:20861-1AP RRID:AB_10696446 | (WB 1:1000) |
| Antibody | anti-EEA1 (rabbit polyclonal) | Cell Signaling Technology | Cat#:2411 RRID:AB_2096814 | (IF 1:500; WB 1:1000) |
| Antibody | anti-EGFR (rabbit polyclonal) | Thermo Fisher Scientific | Cat#:PA5-85089 RRID:AB_2792237 | (IF 1:250) |
| Antibody | anti-EGFR (mouse monoclonal, clone A-10) | Santa Cruz Biotechnology | Cat#:sc-373746 RRID:AB_10920395 | (WB 1:500) |
| Antibody | anti-GLUT1 (rabbit polyclonal) | Abcam | Cat#:ab15309 RRID:AB_301844 | (IF 1:200) |
| Antibody | anti-Integrin β1 (rabbit polyclonal) | Abcam | Cat#:ab 183666 RRID:AB_3698195 | (IF 1:200) |
| Antibody | anti-LAMP1 (mouse monoclonal, clone H4A3) | US Biological Life Sciences | Cat#:H4A3 RRID:AB_2296838 | (IF; WB) |
| Antibody | anti-SNX17 (rabbit polyclonal) | Atlas Antibodies | Cat#:HPA043867 RRID:AB_10961129 | (WB 1:500) |
| Antibody | anti-α-Tubulin (mouse monoclonal) | Sigma-Aldrich | Cat#:T9026 RRID:AB_477593 | (WB 1:5000) |
| Antibody | anti-VPS35L/C16orf62 (rabbit polyclonal) | Thermo Fisher Scientific | Cat#:PA5-28553 RRID:AB_2546029 | (IF 1:500) |
| Antibody | anti-VPS26 (rabbit monoclonal) | Abcam | Cat#:ab181352 RRID:AB_2665924 | (WB 1:3000) |
| Antibody | anti-VPS26C/DSCR3 (rabbit polyclonal) | Merck Millipore | Cat#:ABN87 RRID:AB_10916489 | (WB 1:1000) |
| Antibody | anti-WIPI1 (rabbit polyclonal) | Sigma-Aldrich | Cat#:W2394 RRID:AB_1841265 | (WB 1:1000) |
| Antibody | anti-WIPI2 (rabbit polyclonal) | Sigma-Aldrich | Cat#:HPA019852 RRID:AB_1846589 | (WB 1:1000) |
| Antibody | anti-HA.11, mouse monoclonal, clone 16B12 | Covance | Cat#:MMS-101P RRID:AB_2314672 | (IP 1:1000) |
| Antibody | Cy3 AffiniPure donkey anti-mouse IgG (H+L) (donkey polyclonal) | Jackson ImmunoResearch | Cat#:715-165-151 RRID:AB_2315777 | (IF 1:400) |
| Antibody | Cy3 AffiniPure donkey anti-rabbit IgG (H+L) (donkey polyclonal) | Jackson ImmunoResearch | Cat#:711-165-152 RRID:AB_2307443 | (IF 1:400) |
| Antibody | Alexa Fluor 488 AffiniPure donkey anti-mouse IgG (H+L) (donkey polyclonal) | Jackson ImmunoResearch | Cat#:715-545-151 RRID:AB_2341099 | (IF 1:400) |
| Antibody | Alexa Fluor 488 AffiniPure donkey anti-rabbit IgG (H+L) (donkey polyclonal) | Jackson ImmunoResearch | Cat#:711-545-152 RRID:AB_2313584 | (IF 1:400) |
| Antibody | IRDye 800CW goat anti-mouse IgG (H+L) (goat polyclonal) | LI-COR | Cat#:926-32210 RRID:AB_621842 | (WB 1:10,000) |
| Antibody | IRDye 800CW goat anti-rabbit IgG (H+L) (goat polyclonal) | LI-COR | Cat#:926–32211 RRID:AB_621843 | (WB 1:10,000) |
| Antibody | IRDye 680RD goat anti-mouse IgG (H+L) (goat polyclonal) | LI-COR | Cat#:926-68070 RRID:AB_10956588 | (WB 1:10,000) |
| Antibody | IRDye 680RD goat anti-rabbit IgG (H+L) (goat polyclonal) | LI-COR | Cat#:926-68071 RRID:AB_10956166 | (WB 1:10,000) |
| Chemical compound, drug | Recombinant human EGF | Sigma-Aldrich | Cat#:E9644 | Used at 100 ng/ml in EGFR trafficking/degradation assays. |
| Chemical compound, drug | Polybrene | Sigma-Aldrich | Cat#:AL-118 | Lentiviral transduction (10 µg/ml). |
| Chemical compound, drug | Puromycin | InvivoGen | Selection of stable lines (1 µg/ml). | |
| Chemical compound, drug | Saponin | Sigma-Aldrich | Cat#:558255 | Permeabilization (0.05%, wt/vol). |
| Chemical compound, drug | X-tremeGENE HP DNA transfection reagent | Sigma-Aldrich | Cat#:6366546001 | Plasmid transfection. |
| Chemical compound, drug | Lipofectamine RNAiMAX | Thermo Fisher Scientific | Cat#:13778150 | siRNA transfection. |
| Commercial assay or kit | QuikChange site-directed mutagenesis system | Agilent Technologies | Cat#:200524 | Generation of WIPI2 point mutants. |
| Commercial assay or kit | NucleoSpin PCR Clean-up | Macherey-Nagel | Cat#:740609.50S | PCR product purification. |
| Software, algorithm | ImageJ | NIH | RRID:SCR_003070 | Image processing; intensity quantification (CTCF) and colocalization analysis. |
| Software, algorithm | JACoP (Just Another Colocalization Plugin) | Bolte and Cordelières, 2006 | RRID:SCR_025164 | ImageJ plugin; Manders’ M1/M2 colocalization coefficients. |
| Software, algorithm | HELIQUEST | Gautier et al., 2008 | Helical-wheel projections and hydrophobic-moment prediction (Figure 4A). | |
| Software, algorithm | Adobe Photoshop | Adobe | RRID:SCR_014199 | Western blot image processing. |
| Software, algorithm | Auto Local Threshold (ImageJ plugin) | ImageJ | ‘Default’ method; grayscale segmentation/background subtraction. | |
| Software, algorithm | Canny–Sobel edge detection (ImageJ plugin) | Canny, 1986 | Tubule masking for colocalization (Figure 4—figure supplement 2). |
Antibodies and reagents
Request a detailed protocolChemical reagents were from Sigma-Aldrich unless specified otherwise. Key chemicals from other sources are as follows: Opti-MEM (Thermo Fisher, 11058021); Trypsin (Thermo Fisher, 27250018), Recombinant human EGF (E9644, Sigma), and Puromycin (ant-pr-1, InvivoGen). Protease inhibitor cocktail final concentrations in samples: 100 μM pefablock SC (Merck, 11429876001), 2 μM leupeptin (Merck, 11529048001), 50 μM o-phenanthroline (Merck,131377), and 0.7 μM pepstatin A (Merck, 11524488001) dissolved in methanol. Phosphatase inhibitor cocktail final concentrations: 10 mM NaF (S-7920, Sigma); 1 mM Na Orthovanadate (S6508, Sigma); 2 mM β-glycerophosphate (A2253, AppliChem) all dissolved in water. Antibodies used are summarized in the key resources table.
Complementary DNA (cDNA) constructs
Request a detailed protocolVectors expressing tagged RAB proteins were purchased from Addgene: RFP-RAB4 (79,800; deposited by J.D. Johnson); DsRed-RAB11 (12679; deposited by R. Pagano); mCherry-RAB7 (61804; deposited by G. Voeltz); mCherry-RAB5 (49201; deposited by G. Voeltz). The following vectors were kindly provided by colleagues: EGFP-WIPI1 (pAR31CD vector) and EGFP-WIPI2 (pAR31CD vector) (Tassula Proikas-Cezanne, Tübingen, Germany). The sequences of WIPI1 and WIPI2 that have been used are given in Supplementary file 1.
Site-directed mutagenesis
Request a detailed protocolAll constructs were verified by DNA sequencing. EGFPWIPI2 or WIPI2HA was used as DNA template for site-directed mutagenesis (QuikChange mutagenesis system, Agilent Technologies, 200524) to generate point mutations in the FSSS motif (S67A and S67E) following the manufacturer’s protocol.
To get WIPI2S67E we used the following primers: Fw: AGATTGTTCTCCGAGAGCCTAGTGGCC and Rv: GGC CAC TAG GCT CTC GGA GAA CAA TCT; while for WIPI2S67A we used
Fw: AGATTGTTCTCCGCTAGCCTAGTGGCC
Rv: GGCCACTAGGCTAGCGGAGAACAATCT (Microsynth).
WIPI2SLoop was generated by four consecutive amplifications using the following primers:
(1) Fw: TGGACC GGGTACAAAGGGAAAGTG CTC
Rv: GAGCACTTTCCCTTTGTACCCGGTCCA;
(2) Fw: GGGTACAAAGGGTTCGTGCTCATGGCC
Rv: GGCCATGAGCACGAACCCTTTGTACCC;
(3) Fw: CTC ATG GCC TCC TAC AGC TAC CTG CCT
Rv: AGGCAGGTAGCTGTAGGAGGCCATGAG;
(4) Fw: GCC TCC TAC AGC ACC CTG CCT TCC CAA
Rv: TTGGGAAGGCAGGGTGCTGTAGGAGGC
Non-mutated template vector was removed from the PCR mixture through digestion by the enzyme Dpn1 for 1 hr at 37°C. The product was purified using NucleoSpin PCR Clean-up (Macherey-Nagel, 740609.50S) and transformed into Escherichia coli. Plasmid DNA was purified and sequenced. The site-directed mutagenesis system was also used to generate the siRNA-resistant cDNA for WIPI2 with primers Fw: CGATAGTCCTTTAGCCGCA and Rv: TGCGGCTAAAGGACTATCG. All oligonucleotides were synthesized by Microsynth.
Cell culture, transfection, and treatments
Request a detailed protocolHK2 cells were obtained from ATCC (CRL-2190). HK2 cells were grown in DMEM-HAM’s F12 (Thermo Fisher, 11765054) supplemented with 5% foetal calf serum (Gibco, 10270106), 50 U/ml penicillin/50 mg/ml streptomycin (Thermo Fisher, 15140148), ITS (5 μg/ml insulin, 5 μg/ml TF, 5 ng/ml selenium; LuBio Science, 00-101-100ML). Cells were grown at 37°C in 5% CO2 and at 98% humidity.
HK2 cells were transfected with plasmids using the X-tremeGENE HP DNA transfection reagent (Sigma-Aldrich, 6366546001), unless otherwise specified, according to the manufacturer’s instructions, and incubated for 18–24 hr before fixation or live cell imaging. The HK2 cell line was checked for mycoplasma contamination by a PCR-based method. All cell-based experiments were independently repeated at least three times.
Generation of HK2 cells expressing WIPI2HA
Request a detailed protocolHK2 cell lines stably expressing the three forms (WT, S67A, S67E) of C-terminal HA-tagged WIPI2 were generated by lentiviral transduction. WIPI2 was cloned into modified pLKO.1 lentiviral vector (available from Sigma) between Xba1 and EcoR1 restriction sites. To obtain WIPI2HA a sequence of 3Gly–1Ser–3Gly–1Ser–HA–HA (designed and purchased from GeneScript) was added using Gibson assembly according to the manufacturer’s protocol. Finally, the lentiviral plasmid DNA was purified and sequenced. Lentiviral transfer vector together with third generation envelope and packaging plasmids were transfected into 293T cells to generate lentivirus. Packaged lentivirus containing supernatant was added to recipient HK2 cells in the presence of 10 μg/ml Polybrene (AL-118, Sigma-Aldrich). HK2 cells were stably infected with a lentiviral vector for constitutive WIPI2HA expression for 6 hr. Two days after infection, cells were selected with 1 μg/ml of puromycin for 3 days. Protein samples were collected and used for IP experiments 7 days after infection.
RNA interference
Request a detailed protocolHK2 cells were transfected with siRNA for 72 hr using Lipofectamine RNAiMax (Thermo Fisher Scientific, 13778150) according to the manufacturer’s instructions. Control cells were treated with identical concentrations of siGENOME Control Pool Non-Targeting from Dharmacon (D-001206-13-05). siRNAs targeting WIPI2 were from Dharmacon (ON-TARGETplus Human WIPI2 J-020521). siRNAs were used at a final concentration of 20 nM.
Endocytosis assays
EGFR degradation
Request a detailed protocolHK2 cells were seeded in DMEM-HAM’s F12 supplemented with 5% foetal calf serum, 50 U/ml penicillin/50 mg/ml streptomycin and ITS 5 μg/ml insulin, 5 μg/ml TF, and 5 ng/ml selenium. The day after the growth medium was replaced with the same but without serum for 24 hr and HK2 cells were stimulated with 100 ng/ml EGF for the indicated periods of time. The cells were fixed for 10 min in 4% paraformaldehyde in phosphate-buffered saline (PBS) at different time points after stimulation for IF studies (Figure 1A, B) or washed and lysed for immunoblotting analysis (Figure 1D).
Immunofluorescence
Request a detailed protocolCells were fixed for 10 min in 4% paraformaldehyde in PBS. After fixation, cells were permeabilized in 0.05% (wt/vol) saponin (Sigma-Aldrich, 558255), 0.5% (wt/vol) BSA, and 50 mM NH4Cl in PBS (blocking buffer) for 30 min at room temperature. The cells were incubated for 1 hr with primary antibodies in blocking buffer, washed three times in PBS, incubated for 1 hr with the secondary antibodies (Alexa Fluor-conjugated), washed three times in PBS, mounted with fluorescence mounting medium (Dako, S3023) on slides and analysed by confocal microscopy.
Confocal fluorescence microscopy, image processing, and colocalization analysis
Request a detailed protocolHK2 cells were grown to 70% confluence on glass coverslips and immunofluorescence microscopy was performed as described above. The experiments were repeated at least three times and representative images are shown. Colocalization was analysed by acquiring serial sections from about 100 cells per sample. Images were exported in TIFF format and processed as previously described (Vicinanza et al., 2011). Images of samples to be compared were acquired using the same settings (i.e., laser power, photomultiplier gain, and pinhole size), avoiding pixel saturation. The images were processed in the same way using ImageJ software. Channels from each image were converted into 8-bit format and the ‘Auto Local Threshold’ Plug-in with the ‘Default’ method was used to segment grayscale images, identify the structures of interest and subtract background.
GLUT1, Integrin β1, EEA1, and LAMP1 fluorescence levels were quantified using ImageJ. z-stack images were acquired and compressed into a single plane using the ‘maximum intensity Z-projection’ function in ImageJ. Individual cells were selected using the freeform drawing tool to create a region of interest (ROI). The ‘Measure’ function provided the area, the mean gray value and integrated intensity of the ROI. The mean background level was obtained by measuring the intensity in three different regions outside the cells, dividing them by the area of the regions measured, and averaging the values obtained. The background was subtracted from each cell to obtain the CTCF (corrected total cell fluorescence). It was calculated using the formula: CTCF = integrated intensity of cell ROI − (area of ROI × mean fluorescence of background).
To quantify the degree of colocalization, confocal z-stacks were acquired, but a single panel was used for the measurement. Single channels from each image in 8-bit format were thresholded to subtract background and then the ‘Just Another Colocalization Plug-in’ (JACoP) plugin for ImageJ software (Bolte and Cordelières, 2006) was used to measure the overlap coefficient according to Manders (Manders et al., 1993). Colocalization was quantified using Manders' colocalization coefficients M1 and M2, where M1 = Σᵢ S1ᵢ,coloc/Σᵢ S1ᵢ (with S1ᵢ,coloc = S1ᵢ if the corresponding channel-2 pixel is above threshold, and 0 otherwise) and M2 is defined reciprocally for channel 2. S1ᵢ and S2ᵢ denote the intensities of pixel i in channels 1 and 2. M1 and M2 report the fraction of intensity in one channel that coincides with signal in the other; being intensity-based, they are independent of the absolute intensity of overlapping pixels but sensitive to background, so a threshold was applied to each channel.
For the triple colocalization analysis (Figure 9—figure supplements 1–3) we first performed colocalization between two single channels (i.e., red and blue) and then took that subset of overlapping spots (either a binary image or a list of spots) to measure how many colocalized with green signals.
To measure colocalization of RAB proteins on tubules in cells overexpressing EGFPWIPI2 variants (Figure 4—figure supplement 2) we used an approach based on the detection of signal edges through the ‘Canny or Sobel filters’ Plug-in for ImageJ (Canny, 1986). The surrounded fields were filled to generate binary mask images. In this way, we were able to select tubules in order to separate signal from background, but also to determine a common region for analysing both channels (i.e., red for Rabs and green for WIPI2). These mask images were then subjected to thresholding as described above and colocalization was evaluated with the ImageJ JACOP Plug-in by calculating Manders’ coefficient. Confocal microscopy was performed on an inverted confocal laser microscope (Zeiss LSM 880 with airyscan) with a 63x 1.4 NA oil immersion lens unless stated otherwise.
Gel electrophoresis and western blot
Request a detailed protocolControl cells were plated into 12-well tissue culture test plates (TPP) until they reached around 80–90% confluency, except for knockdown cells, which were cultured until 72 hr after transfection with the siRNAs by reaching a confluence of 80%. Cells were then washed three times with ice-cold PBS, scraped, and proteins were extracted in ice-cold lysis buffer 150 mM NaCl, 2 mM EDTA, 40 mM HEPES-NaOH pH 7.4, and 1% Triton X-100 supplemented with phosphatases and protease inhibitor cocktail (see details in Reagent section). Protein extracts were supplemented with 1/4 volume of 5x reducing sample buffer (250 mM Tris‐Cl, pH 6.8, 5% β-mercaptoethanol, 10% SDS, 30% glycerol, and 0.02% bromophenol blue) and heated to 95 °C for 5 min. The samples were run on either 8%, 10%, or 12.5% SDS–polyacrylamide gels (W × L × H: 8.6 × 6.8 × 0.15 cm). The stacking gels were prepared as follows: 6% acrylamide, 0.16% bis-acrylamide, 0.1 M Tris, pH 6.8, 0.1% SDS, 0.1% TEMED, and 0.05% ammonium persulfate. Running gels were: 10% or 12.5% acrylamide, 0.27% or 0.34% bis-acrylamide, 0.38 M Tris, pH 8.8, 0.1% SDS (Applichem, 475904-M), 0.06% TEMED (Applichem, A1148), and 0.06% APS (Applichem, A2941). The gels were run at constant current (20–30 mA). Proteins were blotted onto nitrocellulose membrane by the semi-dry method for 80 min at 400 mA (Trans-Blot SD Semi-Dry Electrophoretic Transfer Cell, Bio-Rad). After incubation with the primary antibody, signals were detected by secondary antibodies coupled to infrared dyes (LI-COR) and detected on a LI-COR Odyssey infrared fluorescence imager. Images were exported as TIFF files and processed in Adobe Photoshop. Band intensity was quantified using ImageJ band analysis.
Immunoprecipitation of retriever
Request a detailed protocolHK2 cells expressing the three variants (WT, S67E, S67A) of WIPI2 tagged with HA were grown to 80% confluence in 15 cm dishes. After rinsing the cells three times with phosphate buffered saline (PBS 1X), they were detached and lysed by incubating 15 min at 4°C with lysis buffer: 150 mM NaCl, 2 mM EDTA, 40 mM HEPES-NaOH pH 7.4, 1% Triton X-100, supplemented with phosphatases and proteases inhibitor cocktails (details in Reagent section) and 1 mM PMSF out of a 200 mM solution in ethanol, which was freshly prepared immediately before use. The lysate was spun for 10 min at 10,000 × g on a cold bench-top centrifuge. 2.5% of the clarified extracts was reserved as ‘input’. Each clarified extract was incubated for 2 hr at 4°C with 20 μl of Anti-HA High Affinity antibody (clone 3F10) (Roche #118150116001). Then, samples were washed three times with lysis buffer and, after discarding the last wash, the beads were resuspended in 50 μl of pre-warmed elution buffer (2% SDS, 1 mM EDTA, 10 mM DTT, 20 mM Tris HCl pH 7.4, and 100 µM PMSF) and shaken at 55°C for 10 min. Samples were centrifuged, the supernatants were transferred to new Eppendorf tubes, and 5x sample buffer containing 100 mM of fresh DTT was added. Samples were kept at 95°C for 5 min and centrifuged in a tabletop centrifuge. All supernatants were transferred to a new Eppendorf tube yielding the ‘IP’ samples. Inputs and IP were loaded on 8% or 10% SDS–polyacrylamide gels.
Statistical analysis
Request a detailed protocolDifferences between the means have been evaluated by an unpaired Student’s t-test assuming unequal variances unless otherwise specified.
For all quantitative analyses, n refers to the number of independent biological experiments (typically n = 3). Individual cells are shown as data points in the graphs to illustrate the distribution of measurements within each experiment; however, cells were not considered independent biological replicates for statistical testing. Instead, measurements from individual cells were averaged within each biological replicate, and statistical analyses were performed using these experiment-level means. Statistical significance was defined as p < 0.01. The levels of significance are indicated in the figures as follows: *p < 0.05, **p < 0.01, ***p < 0.001, and ****p < 0.0001.
Experiments were independently repeated at least three times. For fluorescence microscopy at least 30 cells were quantified from each experiment. Representative images are shown. Western blotting experiments were independently repeated at least three times and representative blots are shown. Means ± s.d. are shown unless specified otherwise.
Data availability
Source data files are provided. All cell lines and constructs produced for this study are available from the corresponding author upon request.
References
-
Membrane fission by dynamin: what we know and what we need to knowThe EMBO Journal 35:2270–2284.https://doi.org/10.15252/embj.201694613
-
Retromer and the dynamin Vps1 cooperate in the retrieval of transmembrane proteins from vacuolesJournal of Cell Science 128:645–655.https://doi.org/10.1242/jcs.132720
-
WIPI β-propellers in autophagy-related diseases and longevityBiochemical Society Transactions 41:962–967.https://doi.org/10.1042/BST20130039
-
Structural organization of the retriever–CCC endosomal recycling complexNature Structural & Molecular Biology 31:910–924.https://doi.org/10.1038/s41594-023-01184-4
-
A guided tour into subcellular colocalization analysis in light microscopyJournal of Microscopy 224:213–232.https://doi.org/10.1111/j.1365-2818.2006.01706.x
-
A computational approach to edge detectionIEEE Transactions on Pattern Analysis and Machine Intelligence 8:679–698.https://doi.org/10.1109/TPAMI.1986.4767851
-
Receptor recycling by retromerMolecular and Cellular Biology 43:317–334.https://doi.org/10.1080/10985549.2023.2222053
-
Fission of SNX-BAR-coated endosomal retrograde transport carriers is promoted by the dynamin-related protein Vps1The Journal of Cell Biology 204:793–806.https://doi.org/10.1083/jcb.201309084
-
To degrade or not to degrade: mechanisms and significance of endocytic recyclingNature Reviews. Molecular Cell Biology 19:679–696.https://doi.org/10.1038/s41580-018-0053-7
-
Retromer forms low order oligomers on supported lipid bilayersThe Journal of Biological Chemistry 295:12305–12316.https://doi.org/10.1074/jbc.RA120.013672
-
Sorting nexin 17 (SNX17) links endosomal sorting to Eps15 homology domain protein 1 (EHD1)-mediated fission machineryThe Journal of Biological Chemistry 295:3837–3850.https://doi.org/10.1074/jbc.RA119.011368
-
Coronin2A links actin-based endosomal processes to the EHD1 fission machineryMolecular Biology of the Cell 33:ar107.https://doi.org/10.1091/mbc.E21-12-0624
-
Svp1p defines a family of phosphatidylinositol 3,5-bisphosphate effectorsThe EMBO Journal 23:1922–1933.https://doi.org/10.1038/sj.emboj.7600203
-
Analysis of phosphorylation sites on autophagy proteinsProtein & Cell 6:698–701.https://doi.org/10.1007/s13238-015-0166-0
-
Endosomal actin branching, fission, and receptor recycling require FCHSD2 recruitment by MICAL-L1Molecular Biology of the Cell 35:ar144.https://doi.org/10.1091/mbc.E24-07-0324
-
A FAM21-containing WASH complex regulates retromer-dependent sortingDevelopmental Cell 17:699–711.https://doi.org/10.1016/j.devcel.2009.09.009
-
Membrane scission driven by the PROPPIN Atg18The EMBO Journal 36:3274–3291.https://doi.org/10.15252/embj.201796859
-
Assembly and fission of tubular carriers mediating protein sorting in endosomesNature Reviews. Molecular Cell Biology 25:765–783.https://doi.org/10.1038/s41580-024-00746-8
-
PROPPINs and membrane fission in the endo-lysosomal systemBiochemical Society Transactions 52:1233–1241.https://doi.org/10.1042/BST20230897
-
Hybrid endosomal coats contain different classes of sorting nexinsThe EMBO Journal 45:2278–2305.https://doi.org/10.1038/s44318-026-00716-0
-
PtdIns-specific MPR pathway association of a novel WD40 repeat protein, WIPI49Molecular Biology of the Cell 15:2652–2663.https://doi.org/10.1091/mbc.e03-10-0732
-
Multiple repeat elements within the FAM21 tail link the WASH actin regulatory complex to the retromerMolecular Biology of the Cell 23:2352–2361.https://doi.org/10.1091/mbc.E11-12-1059
-
Bending “on the rocks”--a cocktail of biophysical modules to build endocytic pathwaysCold Spring Harbor Perspectives in Biology 6:a016741.https://doi.org/10.1101/cshperspect.a016741
-
Improved mammalian retromer cryo-EM structures reveal a new assembly interfaceThe Journal of Biological Chemistry 298:102523.https://doi.org/10.1016/j.jbc.2022.102523
-
Cargo-selective SNX-BAR proteins mediate retromer trimer independent retrograde transportThe Journal of Cell Biology 216:3677–3693.https://doi.org/10.1083/jcb.201702137
-
Structure and interactions of the endogenous human Commander complexNature Structural & Molecular Biology 31:925–938.https://doi.org/10.1038/s41594-024-01246-1
-
An ACAP1-containing clathrin coat complex for endocytic recyclingThe Journal of Cell Biology 178:453–464.https://doi.org/10.1083/jcb.200608033
-
Structural conservation of the two phosphoinositide-binding sites in WIPI proteinsJournal of Molecular Biology 431:1494–1505.https://doi.org/10.1016/j.jmb.2019.02.019
-
Architecture of the ESCPE-1 membrane coatNature Structural & Molecular Biology 30:958–969.https://doi.org/10.1038/s41594-023-01014-7
-
Measurement of co-localization of objects in dual-colour confocal imagesJournal of Microscopy 169:375–382.https://doi.org/10.1111/j.1365-2818.1993.tb03313.x
-
Identification of molecular heterogeneity in SNX27-retromer-mediated endosome-to-plasma-membrane recyclingJournal of Cell Science 127:4940–4953.https://doi.org/10.1242/jcs.156299
-
Retriever is a multiprotein complex for retromer-independent endosomal cargo recyclingNature Cell Biology 19:1214–1225.https://doi.org/10.1038/ncb3610
-
Endosomal retrieval of cargo: retromer is not aloneTrends in Cell Biology 28:807–822.https://doi.org/10.1016/j.tcb.2018.06.005
-
Endocytosis and cancerCold Spring Harbor Perspectives in Biology 5:a016949.https://doi.org/10.1101/cshperspect.a016949
-
Advances and challenges in understanding endosomal sorting and fissionThe FEBS Journal 290:4187–4195.https://doi.org/10.1111/febs.16687
-
The Atg18-Atg2 complex is recruited to autophagic membranes via phosphatidylinositol 3-phosphate and exerts an essential functionThe Journal of Biological Chemistry 283:23972–23980.https://doi.org/10.1074/jbc.M803180200
-
COMMD1 is linked to the WASH complex and regulates endosomal trafficking of the copper transporter ATP7AMolecular Biology of the Cell 26:91–103.https://doi.org/10.1091/mbc.E14-06-1073
-
WIPI proteins: essential PtdIns3P effectors at the nascent autophagosomeJournal of Cell Science 128:207–217.https://doi.org/10.1242/jcs.146258
-
Retromer-driven membrane tubulation separates endosomal recycling from Rab7/Ypt7-dependent fusionMolecular Biology of the Cell 28:783–791.https://doi.org/10.1091/mbc.E16-08-0582
-
Roles of PIKfyve in multiple cellular pathwaysCurrent Opinion in Cell Biology 76:102086.https://doi.org/10.1016/j.ceb.2022.102086
-
Bilayered clathrin coats on endosomal vacuoles are involved in protein sorting toward lysosomesMolecular Biology of the Cell 13:1313–1328.https://doi.org/10.1091/mbc.01-10-0525
-
Endocytic membrane trafficking and neurodegenerative diseaseCellular and Molecular Life Sciences 73:1529–1545.https://doi.org/10.1007/s00018-015-2105-x
-
The retromer complex: from genesis to revelationsTrends in Biochemical Sciences 46:608–620.https://doi.org/10.1016/j.tibs.2020.12.009
-
Sequence-dependent cargo recognition by SNX-BARs mediates retromer-independent transport of CI-MPRThe Journal of Cell Biology 216:3695–3712.https://doi.org/10.1083/jcb.201703015
-
Organizing membrane-curving proteins: the emerging dynamical pictureCurrent Opinion in Structural Biology 51:99–105.https://doi.org/10.1016/j.sbi.2018.03.018
-
Structural basis for Retriever-SNX17 assembly and endosomal sortingNature Communications 15:10193.https://doi.org/10.1038/s41467-024-54583-6
-
FERARI is required for Rab11-dependent endocytic recyclingNature Cell Biology 22:213–224.https://doi.org/10.1038/s41556-019-0456-5
-
SNX17 protects integrins from degradation by sorting between lysosomal and recycling pathwaysThe Journal of Cell Biology 197:219–230.https://doi.org/10.1083/jcb.201111121
-
PI(5)P regulates autophagosome biogenesisMolecular Cell 57:219–234.https://doi.org/10.1016/j.molcel.2014.12.007
-
Structure-based analyses reveal distinct binding sites for Atg2 and phosphoinositides in Atg18The Journal of Biological Chemistry 287:31681–31690.https://doi.org/10.1074/jbc.M112.397570
-
Yeast vacuoles fragment in an asymmetrical two-phase process with distinct protein requirementsMolecular Biology of the Cell 23:3438–3449.https://doi.org/10.1091/mbc.E12-05-0347
Article and author information
Author details
Funding
Schweizerischer Nationalfonds zur Förderung der Wissenschaftlichen Forschung (31003A_179306)
- Andreas Mayer
European Research Council
https://doi.org/10.3030/788442- Andreas Mayer
Schweizerischer Nationalfonds zur Förderung der Wissenschaftlichen Forschung (310030_204713)
- Andreas Mayer
Schweizerischer Nationalfonds zur Förderung der Wissenschaftlichen Forschung (10.006.083)
- Andreas Mayer
The funders had no role in study design, data collection, and interpretation, or the decision to submit the work for publication.
Acknowledgements
We thank Navin Gopaldass and Thibault Courtellemont for discussions. This work was supported by grants from the SNSF (31003A_179306, 310030_204713, and 10.006.083) and ERC (788442) to AM.
Version history
- Sent for peer review:
- Preprint posted:
- Reviewed Preprint version 1:
- Reviewed Preprint version 2:
- Version of Record published:
Cite all versions
You can cite all versions using the DOI https://doi.org/10.7554/eLife.109403. This DOI represents all versions, and will always resolve to the latest one.
Copyright
© 2025, De Leo and Mayer
This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.
Metrics
-
- 794
- views
-
- 67
- downloads
-
- 0
- citations
Views, downloads and citations are aggregated across all versions of this paper published by eLife.