CROP2, a Retriever–PROPPIN complex mediating protein export from endosomes to the plasma membrane in human cells
- Department of Immunobiology, University of Lausanne, Switzerland
Figures
Figure 1 with 1 supplement
Effect of WIPI2 knockdown on EGFR degradation.
(A, B) Control and WIPI2KD cells were serum-starved for 24 hr and then supplemented with EGF (100 ng/ml). After the indicated periods of time, cells were fixed, permeabilized, DAPI-labelled (blue) and decorated with antibodies to EGFR (magenta), EEA1 or LAMP1 (green). Scale bars: 10 μm. (C) Colocalization of EGFR with EEA1 or LAMP1 (white) was quantified over time using the images from A and B and Manders’ correlation coefficients were calculated. M1 indicates the fraction of magenta pixels overlapping with green pixels. Values are the mean ± s.d. (n = 3). 150 cells, stemming from 3 independent biological experiments, were quantified per sample. (D) EGFR degradation. Control and WIPI2KD cells were stimulated with EGF for the indicated periods of time, lysed and subjected to SDS–PAGE and western blot analysis for EGFR. α-Tubulin served as a loading control. (E) Quantification of EGFR from (D), using the value of control cells at time 0 (cells starved for 24 hr) as 100% reference. Data are means ± s.d., from three independent experiments. Data points from these three experiments are indicated for each time point.
-
Figure 1—source data 1
Uncropped western blot images with the bands used in Figure 1 indicated by a rectangle.
- https://cdn.elifesciences.org/articles/109403/elife-109403-fig1-data1-v1.zip
-
Figure 1—source data 2
Original uncropped western blot images used to generate Figure 1.
- https://cdn.elifesciences.org/articles/109403/elife-109403-fig1-data2-v1.zip
Figure 1—figure supplement 1
Efficiency of WIPI2 knockdown.
Lysates of HK2 cells (50 μg per sample) were treated with non-target siRNA (Control) or siRNA against WIPI2 (WIPI2KD). HK2 cells were analysed by SDS–PAGE and western blot against the indicated proteins. α-Tubulin was used as a loading control. A representative blot is shown. The signals were quantified on a LICOR Odyssey infrared fluorescence image WIPI2/α-Tubulin ratios were calculated. Red bars indicate the mean and error bars the SEM; n = 3 independent biological experiments. p‐values were calculated by an unpaired Student’s t-test with unequal variances. ***p < 0.001.
-
Figure 1—figure supplement 1—source data 1
Uncropped western blot images with the bands, used in Figure 1—figure supplement 1, indicated by a rectangle.
- https://cdn.elifesciences.org/articles/109403/elife-109403-fig1-figsupp1-data1-v1.zip
-
Figure 1—figure supplement 1—source data 2
Original uncropped western blot images used to generate Figure 1—figure supplement 1.
- https://cdn.elifesciences.org/articles/109403/elife-109403-fig1-figsupp1-data2-v1.zip
Figure 2
GLUT1 expression and localization upon WIPI2 knockdown.
(A) GLUT1 cell surface exposure. Control and WIPI2KD cells were fixed and stained with antibody against GLUT1 and with DAPI. Where indicated, cells had been permeabilized with 0.05% saponin before staining to reduce plasma membrane staining and provide better access to GLUT1 inside the cell. Scale bars: 10 μm. (B) Quantification of GLUT1 immunofluorescence in cells from A. Regions of interest (ROIs) corresponding to each cell and in some regions outside the cells (background) were manually defined using ImageJ software. Total cell fluorescence was integrated, and the background fluorescence was subtracted. The resulting total cell fluorescence was divided by the area of the cell. This value is shown in the graph. 150 cells per condition, stemming from three independent biological experiments, were quantified. Values of individual cells and the means are presented by smaller and larger circles, respectively, coloured according to the independent experiment that generated them. p values were calculated applying an unpaired Student’s t-test with unequal variances. The analysis was performed with 99% confidence. NS: not significant (p > 0.05).
Figure 3 with 1 supplement
Impact of WIPI2 knockdown on Integrin β1 localization.
(A) Integrin β1 cell surface expression. Control and WIPI2KD cells were fixed and stained with antibody to Integrin β1 (green) and with DAPI (blue), without detergent permeabilization. Scale bars: 10 μm. (B) Quantification of Integrin β1 immunofluorescence in cells from A. Regions of interest (ROIs) corresponding to each cell and to areas outside the cells (background) were manually defined using ImageJ software. Total cell fluorescence was integrated, and the background fluorescence was subtracted. The resulting total cell fluorescence was divided by the area of the cell. This value is shown in the graph. 150 cells per condition, stemming from three independent biological experiments, were quantified. Individual cells and means are presented by smaller and larger circles, respectively, coloured according to the independent experiment that they stem from. p values were calculated through an unpaired Student’s t-test with unequal variances. The analysis was performed with 99% confidence. ***p < 0.001. (C, D) Immunofluorescence staining of intracellular Integrin β1 (green) and EEA1 (magenta) or LAMP1 (magenta) in control and WIPI2KD cells. Overlaps are marked in white. Cells had been fixed, permeabilized with 0.05% saponin and stained with antibodies to the indicated proteins. Scale bars: 10 μm. (E, G) Colocalization of Integrin β1 with LAMP1 or EEA1 was measured in cells from D, using Manders’ colocalization coefficient M2, calculated in ImageJ software. It indicates the fraction of green pixels overlapping with the magenta pixels. Colocalization was quantified from three independent biological experiments with a total of 150 cells per condition. Values of individual cells and means are presented by smaller and larger circles, respectively, coloured according to the independent experiment that they stem from. An unpaired Student’s t-test with unequal variances was used to calculate p values. The analysis was performed with 99% confidence. ***p < 0.001; ****p < 0.0001. (F, H) Quantification of LAMP1- or EEA1-immunofluorescence in cells from C or D, respectively, was performed as in B. 120 cells per condition, stemming from three independent biological experiments, were quantified. Individual cells and means are presented by smaller and larger circles, respectively, coloured according to the independent experiment that they stem from. Data are means ± s.d. p values were calculated applying an unpaired Student’s t-test with unequal variances. The analysis was performed with 99% confidence. NS: not significant (p > 0.05).
Figure 3—figure supplement 1
Surface expression of Integrin β1 in cells depleted of WIPI1.
(A) Control and WIPI1KD cells were fixed and stained with DAPI and with antibody to Integrin β1. Scale bars: 10 μm. (B) Quantification of Integrin β1-immunofluorescence in cells from A. Regions of interest (ROIs) corresponding to each cell and in some regions outside the cells (background) were manually defined using ImageJ software. Total cell fluorescence was integrated, and the background fluorescence was subtracted. The resulting total cell fluorescence was divided by the area of the cell. This value is shown in the graph. 150 cells per condition, stemming from three independent biological experiments, were quantified. Individual cells and means are presented by smaller and larger circles, respectively, coloured according to the independent experiment that they stem from. p values were calculated applying an unpaired Student’s t-test with unequal variances. The analysis was performed with 99% confidence. NS: not significant (p > 0.05).
Figure 4 with 2 supplements
Role of the amphipathic α-helix of WIPI2 in Integrin β1 sorting.
(A) The amphipathic α-helix. Helical wheel projections showing the CD-loop on blade 6 of the wildtype sequence, WIPI2WT, and WIPI2SLoop. Coloured arrows indicate the two pairs of amino acids that have been swapped in WIPI2SLoop. The magnitude and direction of the hydrophobic moment of the helices was predicted using the online tool Heliquest (Gautier et al., 2008). It is indicated by the vector in the centre of the wheels. Sequences of the hydrophobic loop region of WIPI2WT and WIPI2SLoop are shown, and predicted α-helices are plotted in magenta. The two pairs of hydrophobic/hydrophilic amino acids that are swapped in WIPI2SLoop are highlighted by rectangles in the sequences. Integrin β1 localization. WIPI2KD (B) and control (C) cells were transfected with a plasmid carrying siRNA-resistant EGFPWIPI2WT or EGFPWIPI2SLoop. After 18 hr of viral transfection, cells were fixed, permeabilized with 0.05% saponin and stained with DAPI and antibodies to Integrin β1. Dashed lines indicate the circumference of untransfected cells, while transfected cells are indicated by asterisks. Scale bars: 10 μm. (D) Quantification of Integrin β1 immunofluorescence in cells from B and C. Regions of interest (ROIs) corresponding to cells expressing the indicated WIPI2 variants, and some regions outside the cells (background), were manually defined using ImageJ software. Total cell fluorescence was integrated and the background fluorescence was subtracted. The resulting total cell fluorescence was divided by the area of the cell. This value is shown in the graph. 105 cells per condition, stemming from three independent biological experiments, were quantified. Values of individual cells and means are presented by smaller and larger circles, respectively, coloured according to the independent experiment that generated them. p values were calculated applying an unpaired Student’s t-test with unequal variances. The analysis was performed with 99% confidence: ***p < 0.001; ****p < 0.0001; NS: not significant (p > 0.05).
Figure 4—figure supplement 1
Expression levels of WIPI2 variants.
(A) FSSS variants. Cell lysates from Control and WIPI2KD cells were transfected for 18 hr with siRNA-resistant constructs for EGFPWIPI2WT, EGFPWIPI2S67A, and EGFPWIPI2S67E. The cells were analysed by SDS–PAGE and western blotting with antibodies to WIPI2 and α-Tubulin. A representative blot is shown. (B) Quantification of the signals for transiently expressed EGFPWIPI2 variants from A and for endogenous WIPI2. Blots from three independent biological experiments were quantified on a Licor Odyssey infrared scanner. Graphs on the right side show the mean and SEM. p‐values were calculated using an unpaired Student’s t-test with unequal variances. NS: not significant (p > 0.05). (C) SLoop variant. EGFPWIPI2 and EGFPWIPI2SLoop were expressed and analysed by western blotting as in described in A. (D) Blots from C were quantified as in B. NS: not significant (p > 0.05).
-
Figure 4—figure supplement 1—source data 1
Uncropped western blot images with the bands used in Figure 4—figure supplement 1, indicated by a rectangle.
- https://cdn.elifesciences.org/articles/109403/elife-109403-fig4-figsupp1-data1-v1.zip
-
Figure 4—figure supplement 1—source data 2
Original uncropped western blot images used to generate Figure 4—figure supplement 1.
- https://cdn.elifesciences.org/articles/109403/elife-109403-fig4-figsupp1-data2-v1.zip
Figure 4—figure supplement 2
EGFPWIPI2 variants are preferentially associated with recycling endosomes.
(A, B) Colocalization with RAB proteins. HK2 cells were transiently transfected with plasmids carrying the indicated EGFPWIPI2 variants with mCherryRAB5 or RFPRAB4. Eighteen hours after transfection, cells were analysed by live cell confocal microscopy. Arrows point to tubular structures that are readily detectable in cells expressing the SLoop and S67 variants of WIPI2. Scale bars: 10 μm. Insets show enlargements of the outlined areas with a white dashed line. Scale bars: 2 μm. (C) Colocalization analysis of the images from (A, B). Quantification was carried out for the tubular structures and the entire cell using the Manders’ colocalization coefficient M2, indicating the fraction of green pixels overlapping with magenta pixels, calculated in ImageJ software. Colocalization was quantified from three independent biological experiments with a total of 90 cells per condition. Values of individual cells and means are presented by smaller and larger circles, respectively, coloured according to the independent experiment that they stem from. An unpaired Student’s t-test with unequal variances was used to calculate p values. The analysis was performed with 99% confidence. NS: not significant (p > 0.05).
Figure 5
Effects of the WIPI2 FSSS motif on Integrin β1 recycling.
Influence of WIPI2 variants on Integrin β1. WIPI2-knockdown (WIPI2KD, A) and control (B) HK2 cells were transfected with a plasmid expressing siRNA-resistant wildtype or the indicated FSSS variants of EGFPWIPI2. After 18 hr of viral transfection, cells were fixed (without detergent permeabilization) and stained with DAPI and antibodies to Integrin β1 (red). Dashed lines indicate the circumference of untransfected cells, while transfected cells are indicated by asterisks. Scale bars: 10 μm. (C, D) Quantification of Integrin β1 immunofluorescence in cells from A and B was performed as in Figure 4D. 105 cells per condition, stemming from three independent biological experiments, were quantified. Individual cells and means are presented by smaller and larger circles, respectively, coloured according to the independent experiment that they stem from. p values were calculated applying an unpaired Student’s t-test with unequal variances. The analysis was performed with 99% confidence: **p < 0.01; ****p < 0.0001.
Figure 6
Integration of WIPI2 with coat subunits.
(A) Interaction of WIPI2HA with the CCC complex subunit CCDC93. Parental HK2 cells and HK2 cells stably expressing WIPI2HA were detergent solubilized, the total cell extracts were incubated with anti-HA beads and washed. Adsorbed protein was analysed by SDS–PAGE and western blotting using the indicated antibodies. The intensity of the interacting CCDC93 was quantified with a LICOR Odyssey fluorescence imager. The background from the corresponding position in the sample from cells without HA tag was subtracted. The resulting intensity is shown relative to the intensity of WIPI2HA signal on the beads. N = 3 independent biological experiments. Red bars show the means. Error bars represent the SEM. p values were calculated applying an unpaired Student’s t-test with unequal variances. **p < 0.01. (B) Retriever-dependent interaction of WIPI2HA and SNX17. HK2 cells stably expressing WIPI2HA were treated with siRNA to VPS26C (VPS26CKD), or with non-specific siRNA (VPS26CCT), and lysed. The total cell extracts were incubated with anti-HA beads and adsorbed proteins were analysed using the indicated antibodies as in A. Red bars show the means; error bars represent the SEM. N = 3 independent biological experiments. **p < 0.01. (C, D). Selectivity for Retriever versus Retromer. The co-immunoadsorption experiments were performed as in A and analysed for co-adsorbed (C) VPS26C (Retriever) or (D) VPS26 (Retromer). Red bars show the means; error bars represent the SEM. N = 3 independent experiments. **p < 0.01. NS: not significant (p > 0.05).
-
Figure 6—source data 1
Uncropped western blot images with the bands, used in Figure 6, indicated by a rectangle.
- https://cdn.elifesciences.org/articles/109403/elife-109403-fig6-data1-v1.zip
-
Figure 6—source data 2
Original uncropped western blot images used to generate Figure 6.
- https://cdn.elifesciences.org/articles/109403/elife-109403-fig6-data2-v1.zip
Figure 7 with 3 supplements
Interaction of WIPI1 with VPS26 and SNX27, but not with VPS26C.
(A) Interaction of WIPI1HA with VPS26. Parental HK2 cells and HK2 cells stably expressing WIPI1HA were detergent-solubilized, the total cell extracts were incubated with anti-HA beads and washed. Adsorbed protein was analysed by SDS–PAGE and western blotting using the indicated antibodies. The intensity of the interacting VPS26 was quantified with a LICOR Odyssey fluorescence imager. The background from the corresponding position in the sample from cells without HA-tag was subtracted. The resulting intensity is shown relative to the intensity of the WIPI1HA signal on the beads. N = 3 independent biological experiments. Red bars show the means and error bars represent the SEM. p values were calculated applying an unpaired Student’s t-test with unequal variances. **p < 0.01. (B) Lack of interaction of WIPI1HA with VPS26C. HK2 cells stably expressing WIPI1HA were used for co-immunoadsorption experiments as in A and decorated with the indicated antibodies. Red bars show the means; error bars represent the SEM. N = 3 independent biological experiments. NS: not significant (p > 0.05). (C). Interaction of WIPI1HA with SNX27. HK2 cells stably expressing WIPI1HA were used for co-immunoadsorption experiments as in A and decorated with the indicated antibodies. Red bars show the means; error bars represent the SEMN = 3 independent biological experiments. **p < 0.01.
-
Figure 7—source data 1
Uncropped western blot images with the bands used in Figure 7 indicated by a rectangle.
- https://cdn.elifesciences.org/articles/109403/elife-109403-fig7-data1-v1.zip
-
Figure 7—source data 2
Original uncropped western blot images used to generate Figure 7.
- https://cdn.elifesciences.org/articles/109403/elife-109403-fig7-data2-v1.zip
Figure 7—figure supplement 1
WIPI2 colocalization with Retriever, CCC complex, and Retromer.
(A) WIPI2 colocalization with SNX17, CCDC93, VPS26C, and VPS26. HK2 cells were fixed 18 hr after transient transfection with EGFPWIPI2, stained with the indicated antibodies and imaged by confocal microscopy. Scale bars: 10 μm. Insets show enlargements of the outlined areas with a white dashed line. Scale bars: 2 μm. (B) Quantification. Using the images from (A), colocalization was assessed using Manders’ colocalization coefficient M2, calculating the fraction of green pixels overlapping with magenta pixels. 75 cells per condition, stemming from three independent biological experiments, were quantified. Values of individual cells and means are presented by smaller and larger circles, respectively, coloured according to the independent experiment that generated them. p values were calculated applying an unpaired Student’s t-test with unequal variances. The analysis was performed with 99% confidence. ****p < 0.0001.
Figure 7—figure supplement 2
WIPI1 colocalizes with VPS26, but not with VPS26C.
(A) WIPI1 colocalization with VPS26, SNX27, and VPS26C. HK2 cells were fixed 18 hr after transient transfection with EGFPWIPI1, stained with the indicated antibodies and imaged by confocal microscopy. Scale bars: 10 μm. Insets show enlargements of the outlined areas with a white dashed line. Scale bars: 2 μm. (B) Quantification. Using the images from (A), colocalization was assessed using Manders’ colocalization coefficient M2, indicating the fraction of green pixels overlapping with magenta pixels, calculated in ImageJ software. 75 cells per condition, stemming from three independent biological experiments, were quantified. Individual cells and means are presented by smaller and larger circles, respectively, coloured according to the independent experiment. p values were calculated applying an unpaired Student’s t-test with unequal variances. The analysis was performed with 99% confidence. ****p < 0.0001.
Figure 7—figure supplement 3
WIPI2 colocalizes with Integrin-β1 on early endosomal compartments.
(A) WIPI2 colocalization with Integrin-β1. HK2 cells were fixed 18 hr after transient transfection with EGFPWIPI2, stained with the indicated antibodies and imaged by confocal microscopy. Scale bars: 10 μm. Insets show enlargements of the outlined areas with a white dashed line. Scale bars for these are 2 μm. (B) Quantification. Using the images from (A), colocalization was assessed using Manders’ colocalization coefficient M2. 75 cells per condition, stemming from three independent biological experiments, were quantified. Individual cells and means are presented by smaller and larger circles, respectively, coloured according to the independent experiment. p values were calculated applying an unpaired Student’s t-test with unequal variances. The analysis was performed with 99% confidence. ****p < 0.0001.
Figure 8 with 1 supplement
Impact of the FSSS motif on the WIPI2–Retriever interaction.
(A) Parental HK2 cells and HK2 cells stably expressing the indicated WIPI2HA variants were detergent solubilized. Anti-HA beads were incubated with the total cell extracts, washed, and adsorbed proteins were analysed by SDS–PAGE and western blotting using the indicated antibodies. (B) Band intensities from the blots in A were quantified with a LICOR Odyssey infrared fluorescence imager and plotted as the ratio of VPS26C over WIPI2HA. N = 3 independent biological experiments were quantified. Red bars show the means and error bars represent the SEM. p values were calculated applying an unpaired Student’s t-test with unequal variances. **p < 0.01.
-
Figure 8—source data 1
Uncropped western blot images with the bands, used in Figure 8, indicated by a rectangle.
- https://cdn.elifesciences.org/articles/109403/elife-109403-fig8-data1-v1.zip
-
Figure 8—source data 2
Original uncropped western blot images used to generate Figure 8.
- https://cdn.elifesciences.org/articles/109403/elife-109403-fig8-data2-v1.zip
Figure 8—figure supplement 1
Impact of the FSSS motif on colocalization of WIPI2 and Retriever.
(A) HK2 cells were fixed 18 hr after transient transfection with the indicated EGFPWIPI2 variants, stained with antibodies to VPS26C and imaged by confocal microscopy. Scale bars: 10 μm. Insets show enlargements of the outlined areas with a white dashed line. Scale bars: 2 μm. (B) Quantitative colocalization analysis of the images from (A). Quantification was assessed using the Manders’ colocalization coefficient M2, indicating the fraction of green pixels overlapping with magenta pixels, calculated in ImageJ software. 75 cells per condition, stemming from three independent biological experiments, were quantified. Values of individual cells and means are presented by smaller and larger circles, respectively, coloured according to the independent experiment that generated them. p values were calculated applying an unpaired Student’s t-test with unequal variances. The analysis was performed with 99% confidence. ****p < 0.0001.
Figure 9 with 3 supplements
Role of the WIPI2 FSSS motif for recruiting WIPI2 and Retriever to Rab11 endosomes.
WIPI2-knockdown HK2 cells were transfected with plasmids expressing the indicated siRNA-resistant EGFPWIPI2 variants and mCherry-RAB5, mCherry-RAB7, or DsRed-Rab11. Cells were fixed, permeabilized, immuno-stained for VPS35L and analysed by confocal microscopy. Examples of the quantified images are presented in Figure 9—figure supplements 1–3. Colocalization with EGFPWIPI2 and VPS35L was assessed for: (A) RAB11, (B) RAB5, and (C) RAB7. Colocalization was quantified using Manders’ colocalization coefficient M2, calculated in ImageJ. M2 refers to the fraction of VPS35L colocalizing with the different RAB-proteins. For the triple colocalizations WIPI2/VPS35L/RAB, M2 indicates the fraction of green pixels (WIPI2) overlapping with the pixels positive for the VPS35L/RAB colocalization. Colocalization was quantified from three independent biological experiments in a total of 120 cells. Individual cells and means are presented by smaller and larger circles, respectively, coloured according to the independent experiment that they stem from. p values were calculated by an unpaired Student’s t-test with unequal variances. The analysis was performed with 99% confidence. **p < 0.01; ***p < 0.001; ****p < 0.0001; NS: not significant (p > 0.05).
Figure 9—figure supplement 1
WIPI2 colocalization with RAB5 and Retriever.
HK2 cells expressing mCherry-RAB5 and EGFPWIPI2 wildtype (A) or its indicated variants (B, C) were fixed, permeabilized and stained with antibodies to VPS35L (blue). Scale bars: 10 μm. Insets show enlargements of the outlined areas. Scale bars: 2 μm. Quantifications from multiple experiments are shown in Figure 9.
Figure 9—figure supplement 2
WIPI2 colocalization with RAB7 and Retriever.
HK2 cells expressing mCherry-RAB7 and wildtype EGFPWIPI2 (A) or its indicated variants (B, C) were fixed, permeabilized and stained with antibodies to VPS35L (blue). Scale bars: 10 μm. Insets show enlargements of the outlined areas. Scale bars: 2 μm. Quantifications from multiple experiments are shown in Figure 9.
Figure 9—figure supplement 3
WIPI2 colocalization with RAB11 and Retriever.
HK2 cells expressing mCherry-RAB11 and wildtype EGFPWIPI2 (A) or its indicated variants (B, C) were fixed, permeabilized and stained with antibodies to VPS35L (blue). Scale bars: 10 μm. Insets show enlargements of the outlined areas. Scale bars: 2 μm. Quantifications from multiple experiments are shown in Figure 9.
Figure 10
Membrane trafficking pathways supported by CROP and CROP2.
The figure summarizes the endosomal exit pathways for a variety of model cargos used here and in our previous study and their dependence on CROP or CROP2, respectively.
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Cell line (Homo sapiens) | HK2 (HK-2) | ATCC | CRL-2190 RRID:CVCL_0302 | Human renal proximal tubule epithelial line; tested for mycoplasma. |
| Cell line (H. sapiens) | HEK293T (293T) | ATCC | CRL-3216 RRID:CVCL_0063 | Used for lentivirus production. |
| Transfected construct (human) | siRNA: ON-TARGETplus Human WIPI2 | Dharmacon | Cat#:J-020521 | siRNA targeting WIPI2; used at 20 nM (Materials and methods, RNA interference). |
| Transfected construct (human) | siRNA: siGENOME Non-Targeting Control Pool | Dharmacon | Cat#:D-001206-13-05 | Non-targeting control; used at 20 nM. |
| Transfected construct (human) | siRNA: VPS26C | Dharmacon | Cat#:J-012163 | siRNA targeting VPS26C used at 20 nM (Materials and methods, RNA interference). |
| Transfected construct (human) | siRNA: WIPI1 | Dharmacon | Cat#:D-018205 | siRNA targeting WIPI1 used at 20 nM (Materials and methods, RNA interference). |
| Recombinant DNA reagent | RFP-RAB4 (plasmid) | Addgene | RRID:Addgene_79800 | Deposited by J.D. Johnson. |
| Recombinant DNA reagent | DsRed-RAB11 (plasmid) | Addgene | RRID:Addgene_12679 | Deposited by R. Pagano. |
| Recombinant DNA reagent | mCherry-RAB7 (plasmid) | Addgene | RRID:Addgene_61804 | Deposited by G. Voeltz. |
| Recombinant DNA reagent | mCherry-RAB5 (plasmid) | Addgene | RRID:Addgene_49201 | Deposited by G. Voeltz. |
| Recombinant DNA reagent | EGFP-WIPI2 (pAR31CD vector) | Other | Gift from T. Proikas-Cezanne (University of Tübingen, Germany). | |
| Recombinant DNA reagent | EGFP-WIPI1 (pAR31CD vector) | Other | Gift from T. Proikas-Cezanne (University of Tübingen, Germany). | |
| Recombinant DNA reagent | Modified pLKO.1 lentiviral vector | Sigma-Aldrich | Backbone for WIPI2-HA/WIPI1-HA; modified with a 3Gly-Ser-3Gly-Ser-HA-HA tag (GeneScript). | |
| Recombinant DNA reagent | WIPI2-HA (WT, S67A, S67E) | This paper | C-terminal HA-tagged, lentiviral (modified pLKO.1); see Materials and methods. | |
| Recombinant DNA reagent | WIPI1-HA | This paper | C-terminal HA-tagged; see Materials and methods. | |
| Recombinant DNA reagent | EGFP-WIPI2 S67A; EGFP-WIPI2 S67E (siRNA-resistant) | This paper | FSSS-motif variants; QuikChange mutagenesis (Materials and methods). | |
| Recombinant DNA reagent | EGFP-WIPI2 SLoop (siRNA-resistant) | This paper | Scrambled CD-loop amphipathic-helix variant; see Materials and methods. | |
| Sequence-based reagent | WIPI2 S67E mutagenesis primers (Fw/Rv) | This paper | PCR primers | Fw: AGATTGTTCTCCGAGAGCCTAGTGGCC; Rv: GGCCACTAGGCTCTCGGAGAACAATCT (Microsynth). |
| Sequence-based reagent | WIPI2 S67A mutagenesis primers (Fw/Rv) | This paper | PCR primers | Fw: AGATTGTTCTCCGCTAGCCTAGTGGCC; Rv: GGCCACTAGGCTAGCGGAGAACAATCT (Microsynth). |
| Sequence-based reagent | WIPI2 siRNA-resistance mutagenesis primers (Fw/Rv) | This paper | PCR primers | Fw: CGATAGTCCTTTAGCCGCA; Rv: TGCGGCTAAAGGACTATCG (Microsynth). |
| Sequence-based reagent | WIPI2 SLoop mutagenesis primers | This paper | PCR primers | Four consecutive primer pairs; sequences in Materials and methods (site-directed mutagenesis). |
| Antibody | anti-CCDC93 (rabbit polyclonal) | Proteintech | Cat#:20861-1AP RRID:AB_10696446 | (WB 1:1000) |
| Antibody | anti-EEA1 (rabbit polyclonal) | Cell Signaling Technology | Cat#:2411 RRID:AB_2096814 | (IF 1:500; WB 1:1000) |
| Antibody | anti-EGFR (rabbit polyclonal) | Thermo Fisher Scientific | Cat#:PA5-85089 RRID:AB_2792237 | (IF 1:250) |
| Antibody | anti-EGFR (mouse monoclonal, clone A-10) | Santa Cruz Biotechnology | Cat#:sc-373746 RRID:AB_10920395 | (WB 1:500) |
| Antibody | anti-GLUT1 (rabbit polyclonal) | Abcam | Cat#:ab15309 RRID:AB_301844 | (IF 1:200) |
| Antibody | anti-Integrin β1 (rabbit polyclonal) | Abcam | Cat#:ab 183666 RRID:AB_3698195 | (IF 1:200) |
| Antibody | anti-LAMP1 (mouse monoclonal, clone H4A3) | US Biological Life Sciences | Cat#:H4A3 RRID:AB_2296838 | (IF; WB) |
| Antibody | anti-SNX17 (rabbit polyclonal) | Atlas Antibodies | Cat#:HPA043867 RRID:AB_10961129 | (WB 1:500) |
| Antibody | anti-α-Tubulin (mouse monoclonal) | Sigma-Aldrich | Cat#:T9026 RRID:AB_477593 | (WB 1:5000) |
| Antibody | anti-VPS35L/C16orf62 (rabbit polyclonal) | Thermo Fisher Scientific | Cat#:PA5-28553 RRID:AB_2546029 | (IF 1:500) |
| Antibody | anti-VPS26 (rabbit monoclonal) | Abcam | Cat#:ab181352 RRID:AB_2665924 | (WB 1:3000) |
| Antibody | anti-VPS26C/DSCR3 (rabbit polyclonal) | Merck Millipore | Cat#:ABN87 RRID:AB_10916489 | (WB 1:1000) |
| Antibody | anti-WIPI1 (rabbit polyclonal) | Sigma-Aldrich | Cat#:W2394 RRID:AB_1841265 | (WB 1:1000) |
| Antibody | anti-WIPI2 (rabbit polyclonal) | Sigma-Aldrich | Cat#:HPA019852 RRID:AB_1846589 | (WB 1:1000) |
| Antibody | anti-HA.11, mouse monoclonal, clone 16B12 | Covance | Cat#:MMS-101P RRID:AB_2314672 | (IP 1:1000) |
| Antibody | Cy3 AffiniPure donkey anti-mouse IgG (H+L) (donkey polyclonal) | Jackson ImmunoResearch | Cat#:715-165-151 RRID:AB_2315777 | (IF 1:400) |
| Antibody | Cy3 AffiniPure donkey anti-rabbit IgG (H+L) (donkey polyclonal) | Jackson ImmunoResearch | Cat#:711-165-152 RRID:AB_2307443 | (IF 1:400) |
| Antibody | Alexa Fluor 488 AffiniPure donkey anti-mouse IgG (H+L) (donkey polyclonal) | Jackson ImmunoResearch | Cat#:715-545-151 RRID:AB_2341099 | (IF 1:400) |
| Antibody | Alexa Fluor 488 AffiniPure donkey anti-rabbit IgG (H+L) (donkey polyclonal) | Jackson ImmunoResearch | Cat#:711-545-152 RRID:AB_2313584 | (IF 1:400) |
| Antibody | IRDye 800CW goat anti-mouse IgG (H+L) (goat polyclonal) | LI-COR | Cat#:926-32210 RRID:AB_621842 | (WB 1:10,000) |
| Antibody | IRDye 800CW goat anti-rabbit IgG (H+L) (goat polyclonal) | LI-COR | Cat#:926–32211 RRID:AB_621843 | (WB 1:10,000) |
| Antibody | IRDye 680RD goat anti-mouse IgG (H+L) (goat polyclonal) | LI-COR | Cat#:926-68070 RRID:AB_10956588 | (WB 1:10,000) |
| Antibody | IRDye 680RD goat anti-rabbit IgG (H+L) (goat polyclonal) | LI-COR | Cat#:926-68071 RRID:AB_10956166 | (WB 1:10,000) |
| Chemical compound, drug | Recombinant human EGF | Sigma-Aldrich | Cat#:E9644 | Used at 100 ng/ml in EGFR trafficking/degradation assays. |
| Chemical compound, drug | Polybrene | Sigma-Aldrich | Cat#:AL-118 | Lentiviral transduction (10 µg/ml). |
| Chemical compound, drug | Puromycin | InvivoGen | Selection of stable lines (1 µg/ml). | |
| Chemical compound, drug | Saponin | Sigma-Aldrich | Cat#:558255 | Permeabilization (0.05%, wt/vol). |
| Chemical compound, drug | X-tremeGENE HP DNA transfection reagent | Sigma-Aldrich | Cat#:6366546001 | Plasmid transfection. |
| Chemical compound, drug | Lipofectamine RNAiMAX | Thermo Fisher Scientific | Cat#:13778150 | siRNA transfection. |
| Commercial assay or kit | QuikChange site-directed mutagenesis system | Agilent Technologies | Cat#:200524 | Generation of WIPI2 point mutants. |
| Commercial assay or kit | NucleoSpin PCR Clean-up | Macherey-Nagel | Cat#:740609.50S | PCR product purification. |
| Software, algorithm | ImageJ | NIH | RRID:SCR_003070 | Image processing; intensity quantification (CTCF) and colocalization analysis. |
| Software, algorithm | JACoP (Just Another Colocalization Plugin) | Bolte and Cordelières, 2006 | RRID:SCR_025164 | ImageJ plugin; Manders’ M1/M2 colocalization coefficients. |
| Software, algorithm | HELIQUEST | Gautier et al., 2008 | Helical-wheel projections and hydrophobic-moment prediction (Figure 4A). | |
| Software, algorithm | Adobe Photoshop | Adobe | RRID:SCR_014199 | Western blot image processing. |
| Software, algorithm | Auto Local Threshold (ImageJ plugin) | ImageJ | ‘Default’ method; grayscale segmentation/background subtraction. | |
| Software, algorithm | Canny–Sobel edge detection (ImageJ plugin) | Canny, 1986 | Tubule masking for colocalization (Figure 4—figure supplement 2). |
Additional files
-
MDAR checklist
- https://cdn.elifesciences.org/articles/109403/elife-109403-mdarchecklist1-v1.docx
-
Supplementary file 1
Sequences of WIPI1 and WIPI2 that had been used for mutagenesis and for generating tagged alleles.
- https://cdn.elifesciences.org/articles/109403/elife-109403-supp1-v1.docx
Download links
A two-part list of links to download the article, or parts of the article, in various formats.
Downloads (link to download the article as PDF)
Open citations (links to open the citations from this article in various online reference manager services)
Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)
CROP2, a Retriever–PROPPIN complex mediating protein export from endosomes to the plasma membrane in human cells
eLife 14:RP109403.
https://doi.org/10.7554/eLife.109403.3
