1. Cancer Biology
  2. Cell Biology

Molecular and functional analysis of calcium binding by a cancer-linked calreticulin mutant

  1. Ishmael Nii Ayibontey Tagoe
  2. Amanpreet Kaur
  3. Osbourne Quaye
  4. Emmanuel Ayitey Tagoe
  5. Nicole M Koropatkin
  6. Leslie S Satin
  7. Malini Raghavan  Is a corresponding author
  1. Department of Microbiology and Immunology, University of Michigan Medical School, United States
  2. West African Centre for Cell Biology of Infectious Pathogens, Departments of Biochemistry, Cell and Molecular Biology, University of Ghana, Ghana
  3. Medical Laboratory Sciences, University of Ghana, Ghana
  4. Department of Pharmacology, University of Michigan Medical School, United States
https://doi.org/10.7554/eLife.109647.3
Share this article
Cite this article
  1. Ishmael Nii Ayibontey Tagoe
  2. Amanpreet Kaur
  3. Osbourne Quaye
  4. Emmanuel Ayitey Tagoe
  5. Nicole M Koropatkin
  6. Leslie S Satin
  7. Malini Raghavan
(2026)
Molecular and functional analysis of calcium binding by a cancer-linked calreticulin mutant
eLife 15:RP109647.
https://doi.org/10.7554/eLife.109647.3
  2. Download BibTeX
  3. Download .RIS

eLife Assessment

This work makes an important contribution to understanding the role of calreticulin and the Del52 variant in calcium homeostasis in cells based on convincing evidence. There was some question as to whether the work in vitro fully recapitulated the physiological setting in which the Del52 variant has been reported to have defects in calcium homeostasis. Nonetheless, the studies are well performed using appropriate methods to address these questions and make a significant contribution to the understanding of calreticulin, and the Del52 variant, function in health and disease.

https://doi.org/10.7554/eLife.109647.3.sa0

Abstract

Calreticulin (CRT) is an endoplasmic reticulum (ER) chaperone with low-affinity calcium-binding sites in its C-terminal domain. This region is altered by somatic mutations in the CRT gene (CALR), which drive a subset of myeloproliferative neoplasms (MPNs). Perturbations in ER calcium storage and signaling are reported for the MPN type I mutant, CRTDel52, and are linked to disease pathogenesis. Using recombinant CRT proteins, we found similar low-affinity calcium-binding characteristics for wild-type CRT and CRTDel52, as determined by isothermal titration calorimetry (ITC). Residues 340–349, conserved in both wild-type CRT and CRTDel52, contribute to binding. Furthermore, ER and cytosolic calcium levels, and store-operated calcium entry (SOCE), were comparable in CRT knockout (CRT-KO) cells reconstituted with wild-type CRT or CRTDel52. Notably, the CRT-KO induces expression of multiple ER proteins known to contain low-affinity calcium-binding sites or regulate ER calcium levels. Overall, these findings indicate that CRTDel52 retains at least some low-affinity calcium-binding capacity and that CRT deficiency induces compensatory cellular changes that maintain ER calcium homeostasis.

Introduction

Calreticulin (CRT) is an endoplasmic reticulum (ER) luminal protein that plays key roles in the assembly and folding of N-linked glycoproteins. CRT has a single high-affinity calcium-binding site within a globular domain and a highly acidic C-terminal domain that contains multiple low-affinity calcium-binding sites (Baksh and Michalak, 1991; Wijeyesakere et al., 2011). As an ER chaperone, CRT is thought to play a critical role in maintaining cellular calcium homeostasis (Venkatesan et al., 2021b; Michalak, 2024). The ER has a relatively high free calcium concentration of 0.5–1 μM through the presence of various low-affinity calcium-binding proteins that buffer calcium, whereas cytosolic calcium levels are maintained within a narrow range of around 100 nM (Michalak, 2024). The maintenance of calcium homeostasis within cellular compartments is essential for cell function and survival (Bagur and Hajnóczky, 2017). Early studies have shown that the C-domain of CRT contributes to ER calcium storage, although free ER luminal concentrations are unchanged (Nakamura et al., 2001).

Somatic mutations of exon 9 of the CALR gene, including a 52-base pair deletion (Del52; type I mutation) and a 5-base pair insertion (Ins5; type II mutation), are driver mutations in some myeloproliferative neoplasms (MPNs), specifically in essential thrombocythemia and primary and secondary myelofibrosis (Klampfl et al., 2013; Nangalia et al., 2013). The MPN mutations change the CRT C-domain residues from being predominantly acidic to a high prevalence of basic amino acids and result in a loss of the ER-retention KDEL sequence (Klampfl et al., 2013; Nangalia et al., 2013; Figure 1). Although all MPN CRT mutants change the sequence and charge of the C-domain, a greater number of acidic residues are retained in MPN type II mutant (CRTIns5), compared to the type I mutant (CRTDel52) (Figure 1). The loss of more acidic residues from the C-terminal domain of CRTDel52 has been reported to impair its calcium binding and reduce ER calcium levels (Ibarra et al., 2022). Store-operated calcium entry (SOCE) is a physiological process that allows for the entry of extracellular calcium and ER calcium restoration following ER calcium depletion (Putney, 2011; Zhang et al., 2020). Altered calcium release from the ER and SOCE was reported for MPN type I but not type II mutants in cultured megakaryocytes from MPN patients (Pietra et al., 2016). In another study, spontaneous calcium spikes and increased SOCE activation were observed in cultured megakaryocytes from MPN type I and type II patients when compared to healthy donors (Di Buduo et al., 2020).

Figure 1
Download asset Open asset
Sequence alignments of the C-terminal residues of murine and human calreticulin (mCRT and hCRT), and the myeloproliferative neoplasm (MPN)-linked CRT mutants Ins5 and Del52.

Multiple sequence alignment using Clustal Omega was employed to compare C-domain sequences of mature mCRT, hCRT, Del52, and Ins5 proteins. Acidic residues (340–349) previously implicated in low-affinity calcium binding by mCRT that are shared between wild-type and both CRTDel52 and CRTIns5 are highlighted in green. Additional acidic residues shared just between wild-type CRT and CRTIns5 are shown in red. There are additional acidic residues unique to wild-type CRT. Mature protein numbering is used for the CRT sequences.

Although global calcium-binding defects were predicted or qualitatively measured for CRTDel52 (Shivarov et al., 2014; Ibarra et al., 2022), and altered cellular calcium signaling is also reported (Pietra et al., 2016; Di Buduo et al., 2020), it remains unclear whether MPN-linked CRTDel52 has any low-affinity calcium-binding capacity, given that a few conserved acidic residues are retained in its C-domain (Figure 1). In fact, our previous studies showed that a truncated version of murine wild-type CRT (mCRT) containing the non-mutated part of CRTDel52 and two additional C-terminal residues (mCRT1–351) showed similar low-affinity calcium-binding characteristics as the wild-type mCRT (Wijeyesakere et al., 2011). On the other hand, further truncation of mCRT (mCRT1–339) was needed to disrupt calcium binding (Wijeyesakere et al., 2011; Wijeyesakere et al., 2016). The goal of the current study was to quantitatively measure low-affinity calcium binding by CRTDel52 compared with wild-type human CRT and also quantify ER and cytosolic calcium levels and calcium responsiveness in cells expressing wild-type CRT or CRTDel52.

Results

MPN-linked CRTDel52 retained at least some low-affinity calcium-binding sites

Previous studies Wijeyesakere et al., 2011 have implicated residues 340–351 of murine CRT, which are identical in wild-type human CRT and fully conserved with the 340–349 residues of CRTDel52, to be involved in low-affinity calcium binding. Further truncation of the C-domain to the residue 339 (mCRT1-339) led to the loss of calcium binding measured by ITC (Wijeyesakere et al., 2011). Figure 1 shows a sequence alignment of murine CRT, human CRT, CRTIns5, and CRTDel52 proteins and indicates that the residues previously implicated in low-affinity calcium binding are also shared between wild-type CRT and CRTDel52. Recombinant his- and GB1-tagged purified proteins were used to compare calcium binding by human CRT and its variants. Chromatograms for human wild-type CRT, CRTDel52, CRT(1–339), and CRT(1–351) are shown in Figure 2A. SDS-PAGE gels corresponding to the purified proteins are shown in Figure 2B. Intact protein mass spectrometry for CRTDel52 indicated 35–42 amino acid truncations relative to the full protein sequence for different preparations, possibly from C-terminal protein degradation in Escherichia coli. The truncated proteins still include acidic residues 340–349 previously implicated in low-affinity calcium binding by murine CRT that are shared between wild-type and CRTDel52 (Figure 1).

Figure 2
Download asset Open asset
Purification of recombinant human wild-type CRT, CRTDel52, and C-domain truncation mutants.

(A) Representative chromatograms of recombinant GB1-and his-tagged human CRTWT (hCRTWT), CRTDel52, and the C-domain truncation mutants hCRT (1–351) and hCRT (1–339) purified by gel exclusion chromatography after expression in E. coli and initial purification using a nickel resin. (B) Representative Coomassie blue-stained SDS-PAGE gels of fractions corresponding to the monomer peak (those contained within the region indicated by the double-headed arrows on the chromatogram) of purified proteins that were used for calcium-binding measurements. This figure has Figure 2—source data 1, related to A, Figure 2—source data 2 and 3, related to B.

Figure 2—source data 1

Chromatograms of purified recombinant CRT proteins.

https://cdn.elifesciences.org/articles/109647/elife-109647-fig2-data1-v1.xlsx
Figure 2—source data 2

Coomassie-stained SDS-PAGE gels.

https://cdn.elifesciences.org/articles/109647/elife-109647-fig2-data2-v1.zip
Figure 2—source data 3

Coomassie-stained SDS-PAGE gels.

https://cdn.elifesciences.org/articles/109647/elife-109647-fig2-data3-v1.zip

CRTIns5 was not purified in sufficient quantities needed for ITC experiments and was not further investigated in this study.

For the ITC measurements, calcium titrations were performed after pre-blocking the high-affinity calcium-binding sites with 50–100 µM CaCl2. In a previous study (Wijeyesakere et al., 2011), we showed that at a starting calcium concentration of 0 mM and with CaCl2 injections to a final concentration of 70–80 μM, the measured KD value was 16.6 μM for calcium binding to wild-type murine CRT (which has ~95% sequence identity with human CRT), corresponding to the high-affinity site. On the other hand, at a starting calcium concentration of 50 μM and CaCl2 injections (at 33 μM each) to a final concentration of 700–850 μM, the measured KD value for calcium binding to wild-type murine CRT was 590 μM (corresponding to the low-affinity sites). We did not measure the high-affinity sites under the latter conditions (Wijeyesakere et al., 2011). In the present experiments, at starting CaCl2 concentrations of 50–100 μM and 25 sequential 10 µL injections of 76 μM CaCl2 to a final concentration of 1650–1700 μM, similar binding profiles and KD values in the 400–1000 μM range were measured with wild-type human CRT, CRTDel52, and the CRT(1–351) mutant (Figure 3A, C, and D and Table 1). However, consistent with previous studies with mCRT(1–339), endothermic calcium binding by human CRT(1–339) was of lower magnitude compared to other constructs, with a KD value that was too low to be reliably fit, suggesting the loss of low-affinity calcium-binding sites in this mutant (Figure 3B and Table 1). There are exothermic peaks observed with human CRT(1–339) at the beginning of the calcium titration, which may be attributed to altered low-affinity sites retained within the mutant or reduced affinity of the high-affinity sites. We concluded that CRTDel52 retains at least some low-affinity calcium-binding sites that are measurable by ITC.

Figure 3
Download asset Open asset
Calcium binding to the low-affinity sites of purified human CRT proteins.

Low-affinity calcium binding by purified hCRTWT, CRTDel52, and the indicated truncation mutants was measured using isothermal titration calorimetry (ITC). (A–D) Representative isotherms and fitting curves of calcium binding to the low-affinity sites of the wild-type and mutant CRT proteins as indicated, measured using ITC. Prior to titration, the proteins were incubated with 50–100 µM CaCl2 to block the high-affinity calcium-binding sites. At 37°C, 10 mM CaCl2 was titrated against 100 µM protein. The heat change was measured for 25 injections, and the data were curve-fitted to calculate the dissociation constant, enthalpy, and binding stoichiometry using NanoAnalyze software. Data replicates and statistical analyses are specified in Table 1. This figure has Figure 3—source data 1, related to A–D.

Figure 3—source data 1

Isothermal titration calorimetry measurements of calcium binding to CRT proteins.

https://cdn.elifesciences.org/articles/109647/elife-109647-fig3-data1-v1.xlsx
Table 1
Calorimetric data on measurement of calcium binding to the low-affinity binding site of recombinant purified CRT.
Recombinant CRT proteins/isothermal calorimetric measurementΔH (k/mol)n (mol)Dissociation constant – KD (µM)
CRTWT7.88±2.155.40±1.31574.24±109.93
CRT (1–351)79.82±32.552.59±1.56444.34±139.99
CRT (1–339)Too low to reliably fit
CRTDel523.89±1.367.73±1.81938.82±275.89

  1. Calorimetric data are represented as the mean ± SE. Data shown are averages from three to five independent replicates.

Similar ER calcium levels in CRT-KO HEK cells reconstituted with wild-type CRT or CRTDel52

While the CRTDel52 mutant retains some ability to bind calcium (Figure 3 and Table 1), the loss of the ER-retention KDEL sequence induced by the frameshift mutation, which results in the secretion of the protein from the ER (Araki et al., 2016; Chachoua et al., 2016; Han et al., 2016; Arshad and Cresswell, 2018; Liu et al., 2020; Masubuchi et al., 2020; Venkatesan et al., 2021a; Pecquet et al., 2023) might be expected to cause ER calcium insufficiency in cells expressing CRTDel52 compared to wild-type CRT. We investigated ER calcium signals in CRT-KO HEK293T cells generated by CRISPR/Cas9 gene editing. A clonal KO line was generated and subsequently reconstituted with constructs encoding wild-type CRT, CRTDel52, or CRTDel52 with a KDEL sequence added at the C-terminus (CRTDel52-KDEL). Protein expression was assessed by immunoblotting with anti-CRT(N), which detects an N-domain epitope present in all CRT constructs, and anti-CRT(C-mut), which was specifically raised against the mutant CRT C-terminus (Venkatesan et al., 2021a). While the recognition with anti-CRT (N) was very weak in lysates of cells expressing CRTDel52, which is secreted, CRTDel52-KDEL is readily detectable with both antibodies, consistent with prior studies demonstrating the contributions of the KDEL sequence to the ER retention of CRT and its mutants, including in human embryonic kidney (HEK) cells (Arshad and Cresswell, 2018; Sönnichsen et al., 1994). Both wild-type CRT and CRTDel52-KDEL were reconstituted to higher levels than in the parental cells (Figure 4A, lanes 1 and 2 compared to 7–8 and 11–12).

Figure 4
Download asset Open asset
Flow cytometry-based endoplasmic reticulum (ER) calcium measurements indicate similar ER calcium levels in CRT-KO HEK293T cells and those reconstituted with wild-type CRT and CRTDel52.

(A) CRISPR-Cas9 editing of human embryonic kidney (HEK) cells using lentiviral constructs with calreticulin-targeting gRNA (CRT-KO) or empty vector (HEK-Vec). CRT-KO HEK cells were subsequently reconstituted with wild-type human CRT, CRTDel52, or CRTDel52 with a C-terminal KDEL sequence as indicated. Representative blots showing expression levels of CRT in the indicated HEK cells. Cell lysates were subjected to SDS-PAGE followed by immunoblotting. Wild-type CRT, mutant CRT, and GAPDH were detected with anti-CRT (N), anti-CRT C-(mut), and anti-GAPDH antibodies, respectively. (B) Gating strategy for flow cytometry. HEK-Vec cells transiently transfected with the vector encoding the ratiometric GEM-CEPIA1er probe for 72 hr were used to assess ER calcium levels by flow cytometry based on the measurements of fluorescence emission signals for the Ca2+-bound or unbound probe in the Pacific Blue and Amcyan channels, respectively, following excitation with the 405 nm (violet) laser. Transfected cells were gated based on forward (FSC-A) and side scatter (SSC-A), then on 7AAD-negative (live) cells, and further on the cells positive for the calcium-bound and unbound probe signals. Representative dot plots of changes in fluorescence intensities in response to treatment with thapsigargin (Tg), a SERCA inhibitor, before (0 min) or after (10 min) treatment, are shown. (C) Representative histograms showing changes to Ca2+-bound and unbound signals at different time points following Tg treatment of cells. Mean fluorescence intensities (MFIs) for Ca2+-bound and unbound signals were used to calculate the bound/unbound ratios at different time points. (D and E) The basal free ER calcium signals were measured as bound/unbound MFI ratios from the corresponding histograms of CRT-KO or HEK-Vec cells (D, left panel) or CRT-KO cells reconstituted with the indicated CRT constructs (D, right panel). The fractional changes in ER calcium signals in response to Tg were measured in the indicated cells (E). The fractional change ratios were calculated as (R0–R10/R0)×100. Statistical significance was determined using GraphPad Prism and based on paired t-tests (left panels of D and E) or repeated-measures one-way ANOVAs with Tukey’s test (right panels of D and E). ns, not significant; ***p-value≤0.001. All measurements were undertaken in the presence of 2 mM extracellular Ca2+. Data shown in D and E are based on 7–15 independent experiments as indicated by the individual data points within the graphs. GAPDH, glyceraldehyde-3-phosphate dehydrogenase; SDS-PAGE, sodium dodecyl sulfate-polyacrylamide gel electrophoresis. This figure has Figure 4—source data 1 and 2, related to A, Figure 4—source data 3, related to D–E.

Figure 4—source data 1

Immunoblots of CRT expression in HEK293T cells.

https://cdn.elifesciences.org/articles/109647/elife-109647-fig4-data1-v1.zip
Figure 4—source data 2

Immunoblots of CRT expression in HEK293T cells.

https://cdn.elifesciences.org/articles/109647/elife-109647-fig4-data2-v1.zip
Figure 4—source data 3

Flow cytometry-based endoplasmic reticulum (ER) calcium measurements in HEK293T cells.

https://cdn.elifesciences.org/articles/109647/elife-109647-fig4-data3-v1.xlsx

The KO and reconstituted cells were further transfected with pCIS-GEM-CEPIA1er, which encodes a ratiometric ER calcium probe (Suzuki et al., 2014). Emission signals for calcium-bound (peak ~460 nm) and unbound (peak ~510 nm) probe were measured using flow cytometry in the Pacific Blue and AmCyan channels, respectively, following excitation with the 405 nm (violet) laser. Flow cytometric analysis was undertaken in a buffer containing 2 mM extracellular Ca2+ (Figure 4B and C). There was a significant decrease in basal free ER calcium, measured by the bound/unbound ratios in CRT-KO cells compared to the parental cells (Figure 4D, left panel). ER calcium levels were partially restored, although non-significantly, when the CRT-KO cells were reconstituted with wild-type CRT. CRT-KO cells reconstituted with CRTDel52 and CRTDel52-KDEL showed small but non-significant decreases in ER calcium levels compared to those reconstituted with wild-type CRT (Figure 4D, right panel). Changes to ER calcium levels in response to thapsigargin (Tg), a SERCA inhibitor, were similar in the parental vs. CRT-KO cells, and in the CRT-KO cells compared with those reconstituted with different CRT proteins (Figure 4E).

Spectrofluorimetry was used to verify the maintenance of ER calcium signals in the different HEK cell lines. Cells were again transfected with the pCIS-GEM-CEPIA1er probe and spectra were recorded in a buffer containing 2 mM Ca2+, following excitation at 390 nm. Representative spectra are shown in Figure 5A. Consistent with the flow cytometric measurements, there were no significant differences in the basal ER calcium levels between CRT-KO cells and those reconstituted with wild-type CRT or CRTDel52 (Figure 5B). There were also similar changes to ER calcium levels in response to Tg treatment in the CRT-KO cells compared to cells reconstituted with either wild-type CRT or CRTDel52 (Figure 5C).

Figure 5
Download asset Open asset
Fluorimetry-based endoplasmic reticulum (ER) calcium measurements indicate similar ER calcium levels in CRT-KO HEK293T cells and those reconstituted with wild-type CRT and CRTDel52.

Human embryonic kidney (HEK) cells transiently transfected with a vector encoding the ratiometric GEM-CEPIA1er probe for 72 hr were used to assess ER calcium levels in the presence of 2 mM extracellular Ca2+. Fluorescence emission spectra were recorded following excitation at 390 nm. (A) Representative emission spectra show changes to Ca2+-bound (~460 nm) and unbound (~510 nm) peaks at different time points following Tg treatment of cells. The spectrum in blue was obtained with untransfected HEK cells. (B) Basal Ca2+-bound (~460 nm)/unbound (~510 nm) fluorescence intensity (FI) ratios were calculated for the indicated HEK cell lines before Tg addition. (C) The fractional changes to the bound (~460 nm)/unbound (~510 nm) fluorescence intensity ratios at 15 min relative to baseline were calculated as (R0–R15/R0)×100. Statistical significance was determined by repeated-measures one-way ANOVAs with Tukey’s test using GraphPad Prism. Data shown are based on four independent experiments, indicated by the individual data points within the graphs. ns, not significant. This figure has Figure 5—source data 1, related to B and C.

Figure 5—source data 1

Spectrofluorimetric endoplasmic reticulum (ER) calcium measurements in HEK293T cells.

https://cdn.elifesciences.org/articles/109647/elife-109647-fig5-data1-v1.xlsx

Similar cytosolic calcium and SOCE signals in a CRT-KO megakaryocyte cell line reconstituted with wild-type CRT or CRTDel52

MPN CRT mutations cause thrombopoietin-independent differentiation of megakaryocytes to platelets via the thrombopoietin receptor (MPL) (Araki et al., 2016; Chachoua et al., 2016; Marty et al., 2016; Li et al., 2018; Masubuchi et al., 2020). We, therefore, used a megakaryoblast cell line, MEG-01, to assess the role of CRT deficiency and the CRTDel52 mutant on basal cytosolic calcium levels and SERCA inhibition-induced calcium influx into the cytosol. As with the HEK cells (Figure 4), we created a stable CRT knockout clone of MEG-01 cells by CRISPR/Cas9 editing for cytosolic calcium measurements. The cells were subsequently reconstituted with wild-type CRT or CRTDel52. Representative immunoblots are shown to demonstrate the successful knockout and reconstitution (Figure 6A). Wild-type CRT reconstitution in MEG-01 CRT-KO cells resulted in expression levels higher than those in the parental cells (Figure 6A, lanes 7 and 8 compared with lanes 1 and 2). In the presence of 2 mM Ca2+ in the media, we observed no significant differences in the basal cytosolic calcium levels or cyclopiazonic acid (CPA)-induced calcium release from ER in CRT-KO cells compared to the parental MEG-01 cells (Figure 6C and D). Additionally, no significant differences in basal cytosolic calcium were observed in CRT-KO cells compared to those reconstituted with wild-type CRT or CRTDel52 (Figure 6E). Furthermore, cytosolic calcium levels in CRT-KO and the two reconstituted cell lines were not statistically different following CPA treatments.

Figure 6 with 2 supplements see all
Download asset Open asset
Calcium imaging studies indicate similar cytosolic calcium levels in the megakaryoblastic (MEG-01) cells with CRT-KO and those reconstituted with wild-type CRT or CRTDel52.

(A) CRISPR-Cas9 editing of MEG-01 cells using lentiviral constructs encoding calreticulin-targeting gRNA (CRT-KO). CRT-KO MEG-01 cells were subsequently reconstituted with viral constructs encoding wild-type human CRT or CRTDel52 or transduced with empty vector (Vec) as indicated in the figure panels. Representative immunoblots of CRT expression in the indicated cells detected by the anti-CRT(N) and anti-CRT(C-mut) antibodies. (B–F) Cells in 2 mM extracellular Ca2+ were loaded with the Fura-2/AM dye. Following excitation at 340 or 380 nm and recordings of emission at 510 nm, the emission ratios (340/380) are calculated. (B) Representative calcium imaging data from indicated cells in the presence of 2 mM extracellular Ca2+ and following ER calcium depletion with SERCA inhibitor, cyclopiazonic acid (CPA). (C and E) Basal cytosolic calcium levels are plotted as the mean 340/380 ratios. Data were normalized relative to the MEG-01 signals. (D and F) Mean fractional changes to cytosolic calcium levels calculated as (Rpeak–Rbaseline/Rbaseline)×100 and total calcium release determined as the area under the curve (AUC) are plotted. Data shown in C–F are based on four or five independent experiments with measurements averaged from 50 to 100 cells per experiment. Statistical analysis was performed using paired t-tests (C and D) or repeated-measures one-way ANOVAs with Tukey’s test (E and F). Statistical significance was determined based on p-value≤0.05 using GraphPad Prism. ns, not significant. This figure has Figure 6—source data 1 and 2 related to A, Figure 6—source data 3, related to C–D, and Figure 6—source data 4, related to E–F. This figure has two figure supplements: Figure 6—figure supplements 1 and 2.

Figure 6—source data 1

Immunoblots of CRT expression in MEG-01 cells.

https://cdn.elifesciences.org/articles/109647/elife-109647-fig6-data1-v1.zip
Figure 6—source data 2

Immunoblots of CRT expression in MEG-01 cells.

https://cdn.elifesciences.org/articles/109647/elife-109647-fig6-data2-v1.zip
Figure 6—source data 3

Cytosolic calcium measurements in MEG-01 parental and CRT-KO cells.

https://cdn.elifesciences.org/articles/109647/elife-109647-fig6-data3-v1.zip
Figure 6—source data 4

Cytosolic calcium measurements in CRT-KO cells and those reconstituted with wild-type CRT and CRTDel52.

https://cdn.elifesciences.org/articles/109647/elife-109647-fig6-data4-v1.zip

CALR mutations are generally found in BCR-ABL1-negative MPN (Klampfl et al., 2013; Nangalia et al., 2013), whereas MEG-01 cells have the BCR-ABL1 translocation (Ogura et al., 1985), which induces constitutive tyrosine kinase activity. This could influence intracellular calcium homeostasis (Cabanas et al., 2018). To eliminate possible effects of BCR-ABL1 expression on the measured responses (Figure 6), cytosolic calcium signals in the various MEG-01 cell lines were compared with and without treatment of cells with the tyrosine kinase inhibitor, Imatinib. We initially verified the effect of Imatinib on MEG-01 cells by assessing the expression of STAT5 and the formation of phospho-STAT5 using immunoblots. These analyses showed significantly reduced or abrogated phospho-STAT5 expression upon Imatinib treatment (Figure 6—figure supplement 1). Similar to the findings in the absence of Imatinib (Figure 6, left panel), there were no significant differences in the basal cytosolic calcium levels in Imatinib-treated CRT-KO cells compared to those reconstituted with wild-type CRT and CRTDel52 (Figure 6—figure supplement 2, left panel). Likewise, CPA-induced calcium release from ER was generally similar in CRT-KO cells compared to cells reconstituted with wild-type CRT or CRTDel52 both in imatinib-treated and untreated cells (Figure 6—figure supplement 2, middle and right panels).

SOCE is an important process for restoring ER calcium and maintaining intracellular calcium levels. In contrast to cytosolic calcium signals in the presence of 2 mM Ca2+ in the media, in calcium-free saline, CRT-KO cells exhibited a small but significant increase in basal cytosolic calcium levels relative to the parental cells (Figure 7A, left panel, and Figure 7B). Upon ER calcium depletion with CPA, the mean fractional increase in the cytosolic calcium measured in the Ca2+-free saline did not differ significantly in parental cells vs. CRT-KO cells. The areas under the curve were also not different for the two cell lines (Figure 7A and C). However, consistent with the higher basal cytosolic calcium measured in CRT-KO cells in calcium-free saline, the measured SOCE signal (following the addition of 2 mM Ca2+ and CPA) was significantly reduced in CRT-KO cells compared to parental cells (Figure 7D). Reconstitution of the CRT-KO cells with either wild-type CRT or CRTDel52 tended to reduce basal cytosolic calcium and induce SOCE (Figure 7A, right panel, Figure 7E and G), but both trends were non-significant compared to CRT-KO cells. Importantly, there were no significant differences between the wild-type CRT and CRTDel52 reconstituted cells, in either their basal or CPA-induced cytosolic calcium signals or in SOCE (Figure 7E–G). In calcium-free saline, cytosolic calcium signals and SOCE induction were generally similar in CRT-KO cells as in the wild-type CRT and CRTDel52 reconstituted cells, both in the presence and absence of imatinib (Figure 7—figure supplement 1).

Figure 7 with 1 supplement see all
Download asset Open asset
Calcium imaging studies indicate similar cytosolic calcium levels and store-operated calcium entry (SOCE) in MEG-01 cells with CRT-KO and those reconstituted with wild-type CRT or CRTDel52.

Cells were loaded with Fura-2/AM dye. Following excitation at 340 or 380 nm and recordings of emission at 510 nm, the emission ratios (340/380) were calculated. (A) Representative calcium imaging data from cells in the absence of extracellular calcium, followed by the addition of cyclopiazonic acid (CPA), and subsequent addition of extracellular calcium and CPA as indicated. (B and E) Basal cytosolic calcium levels are plotted as the mean 340/380 ratios prior to CPA addition. Data are normalized relative to the signals of cells transduced with empty vector (Vec). (C and F) Fractional changes to cytosolic calcium calculated as (Rpeak–Rbaseline/ Rbaseline)×100 (left panel) and total calcium release measured as the area under the curve (AUC) (right panel) are plotted for the indicated cells, following ER calcium depletion with CPA. (D and G) Fractional changes to cytosolic calcium following CPA and extracellular calcium additions (2 mM) are calculated as (Rpeak–Rbaseline/Rbaseline)×100, where Rbaseline and Rpeak were measured over 1 min intervals. Data shown are based on 8–10 independent experiments, and an average of over 20–100 cells in each experiment. Comparisons were performed by paired t-test (panels B–D) and one-way ANOVA (panels E–G) using GraphPad Prism. Statistical significance is based on a p-value≤0.05. ns, not significant, **p≤0.01. This figure has Figure 7—source data 1, related to B–D, Figure 7—source data 2, related to E–G. This figure has one supplement, Figure 7—figure supplement 1.

Figure 7—source data 1

Cytosolic calcium measurements and store-operated calcium entry (SOCE) in parental and CRT-KO cells.

https://cdn.elifesciences.org/articles/109647/elife-109647-fig7-data1-v1.zip
Figure 7—source data 2

Cytosolic calcium measurements and store-operated calcium entry (SOCE) in CRT-KO cells and those reconstituted with wild-type CRT and CRTDel52.

https://cdn.elifesciences.org/articles/109647/elife-109647-fig7-data2-v1.zip

CRT deficiency induced numerous transcriptional changes to genes within the calcium signaling pathway

As noted in Figures 4 and 7, some of the measured differences between CRT-KO and parental cells are not fully reversed by reconstitution with wild-type CRT, although the trends are maintained. We predicted that there may be other indirect effects of CRT-KO and reconstitution that affect cellular calcium levels and calcium signaling that could explain some of these measured differences. As proof of concept, we undertook bulk RNA sequencing to determine differential gene expression in MEG-01 parental vs. CRT-KO cells. There were 3078 upregulated and 1790 downregulated genes. The volcano plot and heatmap show identified genes that were differentially expressed in CRT-KO MEG-01 compared to parental cells (Figure 8A). Based on pathway analysis, numerous genes involved in cellular calcium signaling were identified. Of specific note is the upregulation of GRP94 encoded by the HSP90B1 gene, BiP encoded by the HSPA5 gene, and PDIA6 encoded by the PDIA6 gene, which are known to have low-affinity calcium-binding sites (Lièvremont et al., 1997; Macer and Koch, 1988; Biswas et al., 2007; Marzec et al., 2012; Okumura et al., 2021; Figure 8A and B). Other studies have reported similar upregulation of these genes in CRT-KO (Tang et al., 2025), as well as in heterozygous CRTDel52 knock-in cells (Figure 8C; Foßelteder et al., 2023). Upregulation of these proteins may serve a compensatory role in buffering calcium in CRT-KO cells. Additionally, PDIA3, which is shown to regulate the activities of stromal interaction molecule 1 (STIM1) (Prins et al., 2011) and sarcoplasmic reticulum/ER Ca2+ ATPase (SERCA2b) (Li and Camacho, 2004), was consistently upregulated in all the studies.

Figure 8
Download asset Open asset
Transcriptional changes to the expression of genes encoding endoplasmic reticulum (ER) calcium-binding/regulating proteins in CRT-KO MEG-01 cells.

(A) RNA sequencing analysis was used to identify differentially expressed genes in MEG-01 CRT-KO cells in comparison to parental MEG-01 cells. Volcano plot shows significantly upregulated (blue) and downregulated (red) genes identified by RNA sequencing. Genes related to ER calcium binding and homeostasis have been highlighted and labeled. The differentially expressed genes were selected as those with a log2 fold-change of <−0.49 or >0.49 and p-values <0.05. (B) Heatmap shows the differential expression of genes encoding ER-resident calcium-binding proteins or ER calcium regulators that were identified by RNA sequencing in CRT-KO Meg-01 cells compared to parental cells (n=3 biological replicates). (C) Comparison of expression ratio of HSPA5, HSP90B1, PDIA3, and PDIA6 in CRT-KO MEG-01 cells (this study) or murine lung cancer cells (Tang et al., 2025), heterozygous CRTDel52 knock-in (Del52-KI) cells (Foßelteder et al., 2023) normalized to their expression in respective control cell lines expressing wild-type CRT. The normalized expression of various genes identified in each dataset was calculated as a ratio of expression in CRT-KO, CRTDel52 knock-in, or CRTDel52 cells relative to the expression in wild-type CRT-expressing cells. Multiple unpaired t-tests were used to determine statistical significance with the Benjamini-Hochberg FDR correction (p-adjusted)<0.05. (D–G) Left and middle panels: Relative expression of mRNA transcripts of HSPA5 (n=8–11), HSP90B1 (n=7), PDIA6 (n=6), and PDIA3 (n=6) genes in the indicated MEG-01 cells determined by RT-qPCR using specific gene primers. Relative gene expression was calculated by normalizing the target gene’s cycle threshold (Ct) to a single or multiple endogenous controls (ACTB, GAPDH, and HPRT1), which was used for comparison across different cell lines as indicated. Data show 6–11 independent runs with duplicate measurements for each run. Student’s t-test was used to determine the statistical significance between two groups while multiple group comparison was performed by one-way ANOVA using GraphPad Prism. Statistical significance is based on a p-value≤0.05. ns, not significant, *p≤0.05, **p≤0.01, ***p≤0.001, ****p≤0.0001. Right panels: Representative immunoblots of BiP, GRP94, PDIA6, and PDIA3 expression in the indicated cells detected by specific antibodies. This figure has Figure 8—source data 1, related to C, Figure 8—source data 2, related to D–G (left panels), and Figure 8—source data 3 and 4, related to D–G (right panels).

Figure 8—source data 1

Comparison of expression ratio of HSPA5, HSP90B1, PDIA3, and PDIA6.

https://cdn.elifesciences.org/articles/109647/elife-109647-fig8-data1-v1.xlsx
Figure 8—source data 2

Relative expression of mRNA transcripts of HSPA5, HSP90B1, PDIA6, and PDIA3 genes.

https://cdn.elifesciences.org/articles/109647/elife-109647-fig8-data2-v1.xlsx
Figure 8—source data 3

Immunoblots of BiP, GRP94, PDIA6, and PDIA3 expression.

https://cdn.elifesciences.org/articles/109647/elife-109647-fig8-data3-v1.zip
Figure 8—source data 4

Immunoblots of BiP, GRP94, PDIA6, and PDIA3 expression.

https://cdn.elifesciences.org/articles/109647/elife-109647-fig8-data4-v1.zip

We further used real-time polymerase chain reaction (PCR) with target gene primers (Supplementary file 1B) to validate the expression of the key ER-resident proteins identified from the RNA sequencing data which have roles in calcium binding and regulation of ER calcium homeostasis. Consistent with the RNA sequencing data, the expression of HSPA5, HSP90B1, PDIA6, and PDIA3 mRNA transcripts was significantly increased in CRT-KO MEG-01 compared to parental cells. Reconstitution of CRT-KO cells with wild-type CRT but not CRTDel52 showed a significant decrease in the expression of HSPA5, HSP90B1, PDIA6, and PDIA3 (Figure 8D–G). Protein levels of BiP, GRP94, PDIA6, and PDIA3 were also assessed in the indicated cells by immunoblots using specific antibodies. Representative immunoblots show increased expression of BiP (Figure 8D, right panel), GRP94 (Figure 8E, right panel), PDIA6 (Figure 8F, right panel), and PDIA3 (Figure 8G, right panel) in CRT-KO cells compared to parental MEG-01 cells, as well as increased expression in CRT-KO-Vec cells compared to CRT-KO cells reconstituted with wild-type CRT. The effects of CRTDel52 in reducing expression were generally less robust than wild-type CRT.

Discussion

Calreticulin is a ubiquitously expressed ER luminal calcium-binding chaperone, with a role in ER calcium storage (Venkatesan et al., 2021b; Michalak, 2024). A number of prior studies have examined the effects of CRT deficiency and overexpression upon cytosolic and ER calcium signals and SOCE (Arnaudeau et al., 2002; Bastianutto et al., 1995; Mery et al., 1996; Nakamura et al., 2001). CRT deficiency in mouse fibroblasts did not affect free ER calcium levels relative to wild-type cells (Nakamura et al., 2001). Previous studies using dye-based assays reported impaired calcium binding by the MPN-associated CRTDel52 mutant (Ibarra et al., 2022). Yet, direct and more quantitative analyses of its calcium-binding properties have been lacking. In this study, we investigated low-affinity calcium binding by wild-type human CRT, CRTDel52, and the truncation mutants CRT(1–351) and CRT(1–339) using ITC (Figure 3 and Table 1). Our studies show that wild-type CRT, CRTDel52, and CRT(1–351) retain low-affinity calcium-binding sites, exhibiting average KD values of 574.24, 938.82, and 444.34 µM, respectively. On the other hand, low-affinity calcium binding by CRT(1–339) could not be reliably fit. This is the first quantitative characterization of the low-affinity calcium-binding profiles of wild-type human CRT, CRTDel52, and functionally informative truncation mutants.

Although CRTDel52 retains at least partial low-affinity calcium-binding capability, loss of its KDEL retention sequence (Figure 1) could still disrupt ER calcium storage and signaling. Interestingly, the cellular assays reveal that ER and cytosolic calcium levels, as well as SOCE, are similar between CRT-KO cells and those reconstituted with either wild-type CRT or CRTDel52 (Figures 4—7). One study has reported decreased ER calcium levels in a human osteosarcoma cell line transiently transfected to overexpress a CRT type I mutant, compared to those overexpressing wild-type CRT or a type II mutant, which was linked to unfolded protein response induction in type I mutant-expressing cells (Ibarra et al., 2022). The same study suggested the contributions of the P- and C-domains of wild-type CRT in restoring ER calcium levels in cells expressing CRTDel52 (Ibarra et al., 2022). The conditions of those experiments differ from the studies described in our study, which uses a CRT-KO background with wild-type CRT or CRTDel52 reconstitutions to simulate homozygous MPN type I CALR mutations. Achieving endogenous expression levels of wild-type CRT is a limitation of our study, as in many other studies examining the effects of CRT on cellular calcium signaling. Despite this, our findings are consistent with the theoretical prediction that any excess free ER calcium generated in cells lacking CRT or sufficient ER calcium-binding sites would rapidly diffuse out of the ER and be pumped out of the cell.

Related to cytosolic calcium levels and SOCE activation, consistent with our findings (Figure 7G, Figure 7—figure supplement 1), a previous study found no differences in cytosolic calcium levels or SOCE induction in myeloid progenitor 32D cells expressing wild-type CRT and CRTDel52 both under conditions of cytokine deprivation and thrombopoietin stimulation (Bhuria et al., 2024). On the other hand, studies with cultured megakaryocytes from MPN patients with CALR mutations have reported cytosolic calcium abnormalities compared to healthy control cells (Di Buduo et al., 2020; Pietra et al., 2016). In one study, cultured megakaryocytes from patients with type I but not type II CALR mutations were found to have high cytosolic calcium and SOCE activation in cultured megakaryocytes (Pietra et al., 2016). In another study, a larger number of cultured megakaryocytes from MPN patients with type I or type II CALR mutations displayed spontaneous cytosolic calcium spikes and reduced CRT interactions with stromal interaction molecule I (STIM-1) (reflective of SOCE) compared with megakaryocytes from healthy donors or patients with the JAK2V617F mutation (Di Buduo et al., 2020). Thus, there are differences in the findings of the two studies with primary cultured megakaryocytes, the first of which reported increased SOCE activation in cultured megakaryocytes from patients with type I but not type II CALR mutations, and the second of which reported increased frequency of cytosolic calcium spikes and reduced STIM-1-CRT binding in cultured megakaryocytes from patients with both type I and type II CALR mutations (Pietra et al., 2016; Di Buduo et al., 2020). In the absence of engineered controls, sample-to-sample heterogeneities in primary cells make it difficult to attribute any measured differences to direct rather than indirect effects of CRT mutations on cellular calcium signaling.

We found that CRT-KO HEK cells displayed lower ER calcium compared with the parental HEK cells (Figure 4D, left panel) and also that CRT-KO MEG-01 cells displayed increased cytosolic calcium in the absence of extracellular calcium (Figure 7B). However, reconstitutions with wild-type CRT did not reverse these effects (Figure 4D, right panel, and Figure 7E). Transcriptomic analysis identified significant alterations in the expression of genes related to calcium storage and signaling between parental and CRT-KO MEG-01 cells (Figure 8). These changes highlight adaptive or compensatory pathways induced by CRT-KO and emphasize that, when comparing wild-type and CRT-KO cell lines for subcellular calcium levels or responses to SERCA inhibitors, the measured effects might not be based solely on the abilities of CRT to maintain ER and cytosolic Ca2+ levels via its calcium binding, storage, and buffering capacity. Rather, many other compensatory cellular changes could affect subcellular calcium levels and signaling. In this study, various ER proteins with known calcium-binding activities were found to be upregulated in CRT-KO cells (Figure 8A and B). GRP94 (Macer and Koch, 1988; Biswas et al., 2007; Marzec et al., 2012), BiP (Lièvremont et al., 1997 and our unpublished findings), and PDIA6 (Okumura et al., 2021) are each known to contain low-affinity calcium-binding sites. CRT-KO cells have significantly induced expression of the genes encoding these proteins. Wild-type CRT reconstitution into the CRT-KO cells significantly reduced the expression of these ER proteins, whereas CRTDel52 reconstitution only partly and non-significantly reduced the expression of HSP90B1 and PDIA6 and did not reduce the expression of HSPA5 (Figure 8D–F). GRP94, BiP, and PDIA6 have functions in ER protein folding and quality control (Hendershot et al., 2024; Okumura et al., 2021). Related to the mechanisms of induction of calcium-binding proteins, it is known that CRTDel52 has impaired chaperone activity toward its substrates compared with wild-type CRT (Arshad and Cresswell, 2018; Schürch et al., 2022; Kaur et al., 2025). This could account for some of the measured differences between wild-type CRT and CRTDel52 in altering the expression of the ER calcium-binding proteins that also function as chaperones and folding factors. However, the induction of GRP94, BiP, and PDIA6 in knock-in cells with heterozygous expression of wild-type CRT and CRTDel52 (Foßelteder et al., 2023), where the wild-type CRT appears sufficient for protein folding activities (Kaur et al., 2025; Schürch et al., 2022), points to compensatory effects relevant to calcium signaling. Regardless of the precise mechanisms relevant to the induction of the calcium-binding proteins, their combined expression, despite protein compositional differences between the KO and reconstituted cells, appears sufficient to maintain ER calcium levels (Figure 4D, right panel), calcium release from the ER (Figure 4E, right panel, and Figure 6F), and cytosolic calcium levels (Figure 6E).

PDIA3 (ERp57) forms a complex with CRT and interacts with and regulates the activities of the ubiquitously expressed SERCA2b (Li and Camacho, 2004). Its expression is also induced by the CRT-KO and suppressed by wild-type CRT expression but non-significantly by CRTDel52 expression. Altered SERCA2b activity could also affect basal ER calcium levels, contributing to similarities between CRT-KO and wild-type CRT or CRTDel52 reconstituted cells.

Collectively, our findings reveal that CRTDel52 retains some ability to bind calcium at low-affinity sites. CRT-KO cells reconstituted with wild-type or CRTDel52 have comparable ER and cytosolic calcium levels and SOCE. CRT-KO induces broad changes in ER calcium-binding protein expression as well as in the expression of ERp57. Overall, we can conclude that a number of factors that contribute to the maintenance of ER calcium levels and regulation of calcium transport into the ER are altered in CRT-KO cells. Thus, any disease-related changes in calcium signaling and homeostasis are likely multifactorial, encompassing transcriptional regulation and altered expression of critical mediators of calcium storage, transport, and signaling pathways. These studies provide a more nuanced understanding of CRT’s role in cellular calcium signaling and may inform future therapeutic strategies targeting calcium signaling pathways in hematological malignancies.

Materials and methods

Key resources table
Reagent type (species) or resourceDesignationSource or referenceIdentifiersAdditional information
Strain, strain background (Escherichia coli)Origami B(DE3)Sigma-AldrichRef 70836-MChemically competent
Cell line (human)MEG-01ATCCRRID:CVCL_0425This cell line was authenticated by Labcorp using STR genotyping
Cell line (human)HEK293TATCCRRID:CVCL_0063This cell line was authenticated by Labcorp using STR genotyping
AntibodyAnti-CRT (N) (rabbit monoclonal)Cell Signaling TechnologyCST #12238;RRID:AB_26880131:5000
AntibodyAnti-CRT (C-mut)PMCID:PMC80857721:10,000
AntibodyAnti-GRP78/BiP (rabbit polyclonal)Proteintech11587–1-AP;RRID:AB_21198551:10,000
AntibodyAnti-GRP94 (rabbit polyclonal)Proteintech14700–1-AP;RRID:AB_22333471:10,000
AntibodyAnti-ERp57 or PDIA3 (rabbit polyclonal)Proteintech15967–1-AP;RRID:AB_22367841:10,000
AntibodyAnti-PDIA6 (rabbit polyclonal)Proteintech18233–1-AP;RRID:AB_108057651:20,000
AntibodyAnti-STAT5 (rabbit monoclonal)Cell Signaling TechnologyCST #94205;RRID:AB_27374031:1000
AntibodyAnti-phospho-STAT5 (rabbit monoclonal)Cell Signaling TechnologyCST # 9359;RRID:AB_8236491:1000
AntibodyAnti-vinculinCell Signaling TechnologyCST 13901;RRID:AB_27287681:20,000
AntibodyAnti-GAPDHCell Signaling TechnologyCST 2118;RRID:AB_5610531:20,000
Recombinant DNA reagentpCIS-GEM-CEPIA1er (plasmid)AddgeneRRID:Addgene_58217
Recombinant DNA reagentpsPAX2 (plasmid)AddgeneRRID:Addgene_12260
Recombinant DNA reagentpMD2.GAddgeneRRID:Addgene_12259
Recombinant DNA reagentpMSCV (plasmid)AddgeneRRID:Addgene 75085
recombinant DNA reagentZsGreen1 (pLVX-IRES-Puro)AddgeneRRID:Addgene_180278
Recombinant DNA reagentpLentiCRISPRv2-BLAST (pLB)AddgeneRRID:Addgene_98293
Recombinant DNA reagentpSIP-CALRWT (plasmid)This paperWild-type calreticulin (CALRWT) cDNA cloned in pSIP-ZsGreen (pLVX-SFFV-IRES-Puro) vector at EcoRI and NotI sites
Recombinant DNA reagentpSIP-CALRDel52 (plasmid)This paperMutant calreticulin (CALRDel52) cDNA cloned in pSIP-ZsGreen (pLVX-SFFV-IRES-Puro) vector at EcoRI and NotI sites
Recombinant DNA reagentpSIP-CALRDel52+KDEL (plasmid)This paperMutant calreticulin+KDEL (CALRDel52+KDEL) cDNA cloned in pSIP-ZsGreen (pLVX-SFFV-IRES-Puro) vector at EcoRI and NotI sites
Recombinant DNA reagentpGB1-CALRWT (plasmid)This paperB1 domain of streptococcal protein G (GB1) (Huth et al., 1997) and hexa-histidine tag using the pGB1 vector via ligation-independent cloning, as described earlier (Del Cid et al., 2010; DelProposto et al., 2009)
Recombinant DNA reagentpGB1-CALR(1-351) (plasmid)This paperB1 domain of streptococcal protein G (GB1) (Huth et al., 1997) and hexa-histidine tag using the pGB1 vector via ligation-independent cloning, as described earlier (Del Cid et al., 2010; DelProposto et al., 2009) with quickchange site mutagenesis
Recombinant DNA reagentpGB1-CALR(1-339) (plasmid)This paperB1 domain of streptococcal protein G (GB1) (Huth et al., 1997) and hexa-histidine tag using the pGB1 vector via ligation-independent cloning, as described earlier (Del Cid et al., 2010; DelProposto et al., 2009) with quickchange site mutagenesis
Sequence-based reagentACTB (Primer)Real-time primersVHPS-110
Sequence-based reagentGAPDH (Primer)Real-time primersVHPS-3541
Sequence-based reagentHPRT1 (Primer)Real-time primersVHPS-4263
Commercial assay or kitPierce ECL western blotting substrateThermo Fisher ScientificCat #32106
Commercial assay or kitPierce BCA protein quantification assayThermo Fisher ScientificCat #23225
Commercial assay or kitRNeasy Plus Mini KitQIAGENRef 74136
Commercial assay or kitSuperscript III First-Strand SynthesisThermo Fisher ScientificRef 18080051
Commercial assay or kitSYBR Green PCR Master MixApplied BiosystemsRef 4309155
Commercial assay or kitLipofectamine LTX with PLUS reagentInvitrogenRef 15338100
Commercial assay or kitQuickChange II XL Site-Directed MutagenesisAgilent TechnologiesCat #200522
Chemical compound, drugFura-2 LR AMION Biosciences1061E
Chemical compound, drugThapsigarginEnzo Life SciencesBML-PE180-0001
Chemical compound, drugCyclopiazonic acidCayman Chemical11326
Chemical compound, drugPluronic F-127Sigma-AldrichP2443
Chemical compound, drugImatinibSigma-AldrichCDS022173
Software, algorithmGraphPad PrismDotmaticsRRID:SCR_002798
Software, algorithmMicrosoft ExcelMicrosoftRRID:SCR_016137

DNA constructs

Bacterial expression vectors

Request a detailed protocol

Wild-type human CRT (accession number P27797) and CRTDel52 described earlier (Venkatesan et al., 2021a) was expressed as a fusion protein with the B1 domain of streptococcal protein G (GB1) (Huth et al., 1997) and hexa-histidine tag using the pGB1 vector via ligation-independent cloning, as described earlier (Del Cid et al., 2010; DelProposto et al., 2009). Using the pGB1-hCALR plasmid as a template, constructs for expressing his-tagged CRT(1–351) and CRT(1–339) truncation mutants were generated using QuikChange Site-Directed Mutagenesis Kit (Agilent Technologies) following the manufacturer’s protocol and using primers indicated in the Supplementary file 1A.

CRT knockdown

Request a detailed protocol

The single-guide RNA (sgRNA) for CRT knockdown was designed to target the GGCCACAGATGTCGGGACCT sequence found at the boundary of intron 3 and exon 4 of the CALR gene (Mohan et al., 2020). The primers for cloning of sgRNA into pLentiCRISPRv2-BLAST (pLB) vector (RRID:Addgene_98293) are given in the Supplementary file 1A.

pSIP vectors for CRT expression in human cells

Request a detailed protocol

The pMSCV constructs (RRID:Addgene 75085) used for expression of wild-type CRT and the CRTDel52 described earlier (Venkatesan et al., 2021a) were used as templates to subclone wild-type CALR and CALRDel52 cDNA sequences into the pSIP-ZsGreen (pLVX-SFFV-IRES-Puro) vector (RRID:Addgene_180278; Bashirova et al., 2020) at the EcoRI and NotI sites using primers given in the Supplementary file 1A. The cloning of CALR genes at the EcoRI and NotI sites within the pSIP-ZsGreen vector resulted in the removal of a fragment carrying ZsGreen so that the transduced cells did not express ZsGreen.

gRNA-resistant versions for reconstitution of CALR expression in KO cells

Request a detailed protocol

Silent mutations were introduced into the target sequence for sgRNA in the pSIP-CALRWT and pSIP-CALRDel52 constructs by site-directed mutagenesis to make them resistant to Cas9-mediated editing. The QuikChange II XL Site-Directed Mutagenesis Kit (Agilent) was used along with primers listed in the Supplementary file 1A. The PCR reaction was set up according to the manufacturer’s protocol, followed by DpnI treatment for 1 hr at 37°C to digest the parental DNA strand. The DpnI-treated product was used to transform XL10-Gold ultracompetent cells. Two sets of primers were used to introduce a total of six silent mutations: C1QF and C1QR primers were used in the first round, and C2QF and C2QR primers were used to introduce further mutations into the DNA templates generated from the first round of mutagenesis.

Addition of a KDEL sequence into CRTDel52

Request a detailed protocol

The pSIP-CALRDel52-KDEL construct containing a C-terminal KDEL motif was generated using sgRNA-resistant pSIP-CALRDel52 construct as a template and primers given in Supplementary file 1A. The amplicons were cloned at the EcoRI and NotI sites in the pSIP vector. The cloning of CALR genes at the EcoRI and NotI sites within the pSIP-ZsGreen vector resulted in the removal of a fragment carrying ZsGreen so that the transduced cells did not express ZsGreen.

Cell culture, viral transduction, and reconstitution of the expression of CRT mutants

Request a detailed protocol

Megakaryoblastic leukemia cell line (MEG-01) (RRID:CVCL_0425) from ATCC and HEK 293T cell lines (RRID:CVCL_0063) were cultured and maintained in RPMI 1640 and DMEM media, respectively, supplemented with 10% heat-inactivated fetal bovine serum (FBS, Gibco), antibiotic/antimycotic solution containing penicillin, streptomycin, and amphotericin (15240062), respectively, at 37°C, 5% CO2, and 95% humidity. Wild-type CRT was knocked out in MEG-01 cells and HEK293T cells (CRT-KO) using Cas9 and sgRNA targeting GGCCACAGATGTCGGGACCT sequence within the CALR gene. For CRISPR/Cas9-mediated CRT knockdown, the HEK293T cells were first transfected with the lentiviral construct containing CRT-targeting sgRNA (pLB-CALR sgRNA) or the empty pLB vector along with the psPAX2 (RRID:Addgene_12260) and MD2.G (RRID:Addgene_12259) vectors using Lipofectamine LTX with PLUS reagent (Invitrogen) to make lentivirus. The lentivirus-containing media were harvested, filtered with 0.45 µm syringe filters, and added onto the target cells (MEG-01 or HEK293T cells) for infection. The MEG-01 cells were infected by spinoculation at 2500 rpm for 2 hr at room temperature in the presence of polybrene (8 µg/mL), followed by the replacement of 80% of virus-containing media with fresh complete media.

For HEK293T cells, the harvested viral supernatant was added to HEK 293T cells and incubated for 2 hr at 37°C, after which 80% of the viral suspension was replaced with complete growth media. Virus-containing media was completely replaced with fresh growth media 24 hr after infection, and the drug selection started with 2.5 µg/mL blasticidin 48 hr post-infection. Following drug selection, the CRT-KO cells were plated at a dilution of one cell per well in a 96-well plate to isolate single-cell clones.

The selected single-cell clones of CRT-KO MEG-01 and HEK293T cells were subsequently reconstituted with wild-type human CRT, CRTDel52, or CRTDel52 with a C-terminal KDEL sequence using the respective sgRNA-resistant pSIP constructs and the same method of transduction explained above. The cells transduced with the empty pSIP vector without ZsGreen (Supplementary file 1A) were also generated to serve as control cells. Cells expressing CRT proteins or those containing empty pSIP vector were selected with 2 µg/mL puromycin. Selected cells were expanded and used for ER calcium measurements. Both MEG-01 and HEK293T cells were authenticated by Labcorp using STR genotyping and routinely screened for mycoplasma contamination before use.

Protein expression and purification

Request a detailed protocol

The B1 domain of streptococcal protein G (GB1) and his-tagged versions of wild-type CRT, CRT(1–351), CRT(1–339), and CRTDel52 were cloned into the pGB1 vector (DelProposto et al., 2009). Chemically competent Origami B(DE3) E. coli cells were transformed with the pGB1 constructs of wild-type CRT, CRT(1–351), CRT(1–339), and CRTDel52. Single colonies were grown overnight at 37°C. The overnight cultures were inoculated into larger (1–2 L) volumes of LB media and grown in a shaking incubator at 220 rpm and 37°C until the OD600 reached 0.8. Protein expression was then induced with 200 µM IPTG, and the cultures were further incubated at 16°C overnight on shaking. The bacterial cells were harvested, pelleted, and lysed in 50 mL of HEPES buffer containing (20 mM HEPES pH 7.5, 140 mM NaCl, 1 mM CaCl2) by sonication. The lysates were clarified by centrifugation at 10,000 rpm, 4°C for 30 min. The supernatant was incubated with nickel-NTA resin (QIAGEN, 1018244) for 3 hr at 4°C and purified through a gravity-flow column. The unbound proteins and contaminants were removed by washing with a wash buffer containing 20 mM HEPES pH 7.5, 140 mM NaCl, 1 mM CaCl2, and 10 mM imidazole. The his-tagged GB1-CRT proteins were eluted with buffer containing 20 mM HEPES pH 7.5, 140 mM NaCl, 1 mM CaCl2, and 350 mM imidazole. The eluted proteins were concentrated and subjected to fast protein liquid chromatography over a Superdex 200 Increase 10/300 GL column at 4°C in 20 mM HEPES pH 7.5, 140 mM NaCl, 1 mM CaCl2 as described previously (Del Cid et al., 2010; Wijeyesakere et al., 2011). Monomer fractions, collected between 14 and 20 mL as shown in Figure 2, were pooled, dialyzed, and concentrated to 4 mg/mL in 20 mM HEPES, 10 mM NaCl, 1 mM CaCl2 pH 7.5 using Amicon Ultra concentrators with a molecular weight cutoff of 30,000 Da (Millipore) and frozen in 10% glycerol for further use.

Isothermal titration calorimetry

Request a detailed protocol

ITC measurements were done using the Nano-ITC SV (TA Instruments). Purified GB1-CRT monomers were dialyzed into 20 mM HEPES, 10 mM NaCl pH 7.5, brought to a concentration of 100 µM, and then pre-incubated with 50–100 µM CaCl2 in 20 mM HEPES, 10 mM NaCl pH 7.5 for 30 min to block the high-affinity calcium-binding sites. This was followed by 25 sequential 10 µL injections of 20 mM HEPES, 10 mM NaCl, 10 mM CaCl2 pH 7.5 into the protein solution maintained at 37°C in a total volume of 1.3 mL to final CaCl2 concentrations of 1.6–1.7 mM. The heat changes measured for the sequential injections were curve-fitted to calculate the enthalpies, stoichiometries, and the dissociation constants using NanoAnalyze software.

Cytosolic calcium measurement and SOCE induction

Request a detailed protocol

MEG-01 cells and their CALR-modified versions were plated on glass coverslips pretreated with 0.01% poly-L-lysine to facilitate cell attachment. In separate experiments, cells were treated with 10 µM Imatinib (Sigma), a tyrosine kinase inhibitor, for 2 hr prior to cytosolic calcium measurements. Cells were loaded with 2.5 µM Fura-2/AM dye (Ion Biosciences) supplemented with 0.1% pluronic acid in a physiological salt solution (PSS) containing 140 mM NaCl, 2 mM CaCl2, 5 mM KCl, 2 mM MgCl2, 10 mM HEPES, and 11 mM glucose, and incubated for 60 min at 37°C. Live single-cell imaging was done at ×20 magnification using an Olympus IX71 inverted microscope equipped with a TILL Polychrome V monochromator light source, a Dual-View emission beam splitter, and a cooled Photometrics Quant-EM camera. Cells were transferred to a perfusion chamber that was mounted on the microscope stage, and PSS with or without 2 mM CaCl2 was flowed over cells using a gravity-fed perfusion system. Cytosolic calcium measurements were performed by perfusing Fura-2-loaded cells in the chamber with 2 mM Ca2+, followed by the addition of 25 µM CPA (Cayman) into the imaging buffer. To determine cytosolic calcium levels after activating SOCE, cells were initially perfused with Ca2+-free PSS containing 0.1 mM EGTA, followed by the addition of 25 µM CPA in Ca2+-free PSS and subsequent addition of 2 mM Ca2+ and 25 µM CPA in PSS (without EGTA) to reestablish calcium influx. The emission signals corresponding to the 340 and 380 nm excitation were recorded, and the signals resulting from 340/380 nm excitation were calculated using the Meta Fluor software. The basal cytosolic calcium was defined as the 340/380 nm signal ratio before CPA treatment (measured over a 4 or 5 min interval immediately before CPA addition). The fractional increase in cytosolic calcium levels after ER Ca2+ depletion with CPA was calculated as the difference between peak signal (single time point) and baseline (averaged over a 4 or 5 min interval before CPA addition), as a ratio relative to the baseline. The fractional increase in cytosolic calcium after addition of 2 mM extracellular Ca2+ and CPA was calculated as the difference between the peak signal following Ca2+ and CPA addition (averaged over a 1 min time interval following the peak signal) and the baseline (the signal averaged over a 0.8–1 min interval immediately before the Ca2+ and CPA addition) relative to the baseline. Total calcium release after ER Ca2+ depletion was reported as the total area under the curve (AUC). Fractional increases were calculated as (Peak–Baseline)/Baseline × 100. This was calculated as peak signals after CPA addition relative to the baseline before CPA (measured over a 4 or 5 min interval immediately before CPA addition).

ER calcium measurements in HEK293T cells

Request a detailed protocol

CALR-modified HEK cells as described in Materials and methods were transiently transfected with pCIS-GEM-CEPIA1er (RRID:Addgene_58217; Suzuki et al., 2014) using Fugene HD reagent (Promega). The transfected cells were harvested after 72 hr. Cells were washed twice with FACS buffer (phosphate-buffered saline [PBS]+2% FBS) supplemented with 2 mM Ca2+ and resuspended in the same FACS buffer. The live-dead stain 7-AAD (BD, 559925; RRID:AB_286926) was added at 1:200 dilution and the cells were analyzed by flow cytometry using the BD LSRFortessa cell analyzer. The signal for the Ca2+-bound GEM-CEPIA1er probe was recorded in the Pacific Blue channel (excitation at 405 nm and emission at 452–455 nm) and the signal for the unbound GEM-CEPIA1er probe was recorded in the AmCyan channel (excitation at 405 and emission at 498 nm). The analysis of flow cytometry data was done using the FlowJo software (v10.10.00;RRID:SCR_008520). The cells were gated based on the forward (FSC-A) and side scatter (SSC-A), followed by gating on the 7AAD-negative (live) cells, and subsequent gating on the cells positive for the expression of GEM-CEPIA1er probe measured in the Pacific Blue and AmCyan channels. Basal signals were initially recorded, followed by the addition of 5 µM thapsigargin (Tg) and subsequent recording of signals for the treated and untreated cells at four different time points between 2 and 10 min. The ratio of mean fluorescence intensity of the bound to the unbound signal was used for calculations. In additional experiments, ER calcium levels were measured by spectrofluorimetry in HEK cells transfected with pCIS-GEM-CEPIA1er. Fluorescence emission spectra were recorded between 420 and 600 nm, following excitation at 390 nm. Basal spectra were initially recorded using 3 million cells suspended in PBS containing 2 mM Ca2+, followed by treatment with 5 µM Tg, and additional spectra were recorded at 3 min intervals (3–15) min. The ratios of mean fluorescence intensities of the bound (~460 nm) to unbound (~510 nm) peak signals were calculated in the absence of Tg or at 15 min following Tg addition to compare the basal signals and the changes following Tg addition.

Immunoblotting

Request a detailed protocol

The HEK293T and MEG-01 cells were harvested and lysed in lysis buffer (50 mM Tris pH 7.5, 150 mM NaCl, 1% Triton X-100, 5 mM CaCl2) for 30 min at 4°C. The lysates were clarified by centrifugation, and the total amount of protein in the lysates was determined using the BCA reagent kit (Thermo Scientific). The volume of lysate containing 20–40 μg of protein was denatured by boiling in 1× SDS loading dye for 5 min and subjected to SDS-PAGE. Following electrophoresis, the proteins were transferred onto a PVDF membrane. The membranes were blocked in 5% non-fat dry milk solution in TBST (Tris-buffered saline with Tween-20), followed by immunoblotting and detection for protein expression using primary anti-CRT(N) antibody (Cell Signaling Technology [CST] 12238; RRID:AB_2688013; 1:10,000 dilution) for detection of CRTWT and anti-CRT(C-mut) antibody for detection of CRT mutants (Venkatesan et al., 2021a). Primary anti-STAT5 (94205S, RRID:AB_2737403; 1:1000), anti-phospho-STAT5 (93559S, RRID:AB_823649; 1:1000), anti-GRP78/BiP (11587-1-AP, RRID:AB_2119855; 1:10,000), anti-GRP94 (14700-1-AP, RRID:AB_2233347; 1:10,000), anti-ERp57 (15967-1-AP, RRID:AB_2236784; 1:10,000), and anti-PDIA6 (18233-1-AP, RRID:AB_10805765; 1:20,000) were used to probe for the expression of BiP, GRP94, PDIA3, and PDIA6, respectively. Anti-GAPDH (CST 2118, RRID:AB_561053; 1:20,000) and anti-vinculin (CST 13901, RRID:AB_2728768; 1:20,000) were used to probe for GAPDH and vinculin as loading controls. Blots were incubated with horseradish peroxidase-conjugated secondary antibodies (Jackson ImmunoResearch) and developed by chemiluminescence (Pierce ECL western blotting substrate, 32106). Immunoblot images were captured using the Azure 300 Chemi Imager (Azure Biosystems).

RNA sequencing

Request a detailed protocol

The parental and CRT-KO MEG-01 cells were grown in complete media for 12–18 hr before harvesting. Total RNA was isolated using the RNeasy Plus Mini Kit (QIAGEN). This was followed by poly-A selection and enrichment of mRNA using NEB Next Ultra Express RNA kit and a NEB Poly A kit (New England Biolabs). Sequencing was done on the NovaSeq at PE150, targeting 30–40 million reads/sample after cDNA library preparation. Data were pre-filtered to remove genes with zero counts in all samples. Differential gene expression analysis was performed using DESeq2 (RRID:SCR_015687). The differentially expressed genes were selected as those with a log2 fold-change of <−0.49 or >0.49 and p-values<0.05. The results from RNA sequencing were further analyzed in the iPathwayGuide to identify significantly altered proteins related to calcium signaling. The volcano plot was plotted in GraphPad Prism as log2 fold-change (x-axis) vs. –log10 adjusted p-value.

Real-time PCR

Request a detailed protocol

Total RNA was isolated using the RNeasy Plus Mini Kit (QIAGEN) followed by synthesis of complementary DNA using the Superscript III First-Strand Synthesis Kit (Thermo Fisher Scientific) following the manufacturer’s protocol. Quantitative RT-PCR was performed on the ABI 7500 FAST Real-Time PCR machine (Thermo Fisher Scientific, USA) using the SYBR Green PCR Master mix (Applied Biosystems, UK) and gene-specific primers (Supplementary file 1B). Measurement was done in technical duplicates. The expression of target genes was quantified using the 2–∆∆Ct method and normalized to the expression of either one or multiple endogenous control genes, including beta-actin (ACTB), glyceraldehyde 3-phosphate dehydrogenase (GAPDH), and hypoxanthine phosphoribosyltransferase 1 (HPRT1). The expression of the target gene in MEG-01 CRT-KO and wild-type and CRTDel52 reconstitution cells was further normalized to the mean expression of parental MEG-01 or CRT-KO-Vec. The calculated relative mRNA transcript expression values (RQ) were plotted using GraphPad Prism.

Statistical analysis

Request a detailed protocol

All data were compiled using Microsoft Excel (RRID:SCR_016137). A paired, two-tailed Student’s t-test analysis was done to compare mean differences between two groups, while a one-way ANOVA was done to compare mean differences among more than two groups. These analyses were done using GraphPad Prism 10.4 (RRID:SCR_002798) statistical package. The threshold for statistical significance was observed at a p-value≤0.05.

Data availability

RNA sequencing gene expression data is available in the GEO database with accession number GSE296671.All source data for all Figures can be accessed at https://www.immport.org/ under study accession ID SDY3677.

The following data sets were generated
    1. Tagoe INA
    2. Kaur A
    3. Raghavan M
    (2026) NCBI Gene Expression Omnibus
    ID GSE296671. Differential gene expression in the MEG-01 Megakaryoblast Cell Line (ATCC CRL-2021) with and without calreticulin knockout.
    https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE296671
    1. Tagoe I
    2. Raghavan M
    (2026) ImmPort
    SDY3677: Molecular and Functional Analysis of Calcium Binding by a Cancer-linked Calreticulin Mutant.
    https://doi.org/10.21430/M3IQGOHZUZ
The following previously published data sets were used
    1. Tank K
    2. Wu L
    3. Hu L
    4. Xue T
    5. Jin Y
    6. Zhou X
    7. Luo C
    8. Zhao Y
    9. Tong L
    10. Dai J
    11. Feng D
    12. Zeng Z
    13. Pan D
    (2025) NCBI Gene Expression Omnibus
    ID GSE285113. Perturbation of calreticulin potentiates CD8+ T cell-mediated antitumor immunity.
    https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE285113

References

Article and author information

Author details

  1. Ishmael Nii Ayibontey Tagoe

    1. Department of Microbiology and Immunology, University of Michigan Medical School, Ann Arbor, United States
    2. West African Centre for Cell Biology of Infectious Pathogens, Departments of Biochemistry, Cell and Molecular Biology, University of Ghana, Accra, Ghana
    Contribution
    Investigation, Visualization, Methodology, Writing – original draft, Writing – review and editing
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0009-0003-4511-6410

  2. Amanpreet Kaur

    Department of Microbiology and Immunology, University of Michigan Medical School, Ann Arbor, United States
    Contribution
    Investigation, Visualization, Writing – review and editing
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0001-6806-8448

  3. Osbourne Quaye

    West African Centre for Cell Biology of Infectious Pathogens, Departments of Biochemistry, Cell and Molecular Biology, University of Ghana, Accra, Ghana
    Contribution
    Supervision, Writing – review and editing
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-0621-876X

  4. Emmanuel Ayitey Tagoe

    Medical Laboratory Sciences, University of Ghana, Accra, Ghana
    Contribution
    Supervision, Writing – review and editing
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0001-7179-1872

  5. Nicole M Koropatkin

    Department of Microbiology and Immunology, University of Michigan Medical School, Ann Arbor, United States
    Contribution
    Resources, Formal analysis, Supervision, Methodology, Writing – review and editing
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-2459-3336

  6. Leslie S Satin

    Department of Pharmacology, University of Michigan Medical School, Ann Arbor, United States
    Contribution
    Resources, Formal analysis, Supervision, Funding acquisition, Methodology, Writing – review and editing
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0003-1355-8647

  7. Malini Raghavan

    Department of Microbiology and Immunology, University of Michigan Medical School, Ann Arbor, United States
    Contribution
    Conceptualization, Resources, Formal analysis, Supervision, Funding acquisition, Visualization, Methodology, Writing – original draft, Project administration, Writing – review and editing
    For correspondence
    malinir@umich.edu
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-1345-9318

Funding

National Institute of Allergy and Infectious Diseases (AI123957)

  • Malini Raghavan

National Institute of Diabetes and Digestive and Kidney Diseases (DK46409)

  • Leslie S Satin

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

Acknowledgements

We thank Grace Pagnucco for generating the CRISPR/Cas9-engineered HEK293T CRT-KO cells and Arunkumar Venkatesan for generating the MEG-01 CRT-KO cells. We would like to extend special thanks and appreciation to Chante Liu and Mathewos Biniam Tebeje from the Satin lab for their support with microscopic calcium measurements. We thank Luis Teran-Rodriguez for assistance with data analysis and Dr. Sivaraj Sivaramakrishnan for many helpful suggestions. We thank the Advanced Genomic Core (ACG) at the University of Michigan for conducting the library preparation and next-generation sequencing, as well as Rebecca Tagett and the Bioinformatics Core of the University of Michigan Medical School for conducting the RNA sequencing data analysis. We thank Dr. Arthur Sherman for many insightful comments. This work was funded by the National Institutes of Health grants (R01 AI123957 to MR and R01 DK46409 to LSS) and by the University of Michigan Fast Forward Protein Folding Diseases Initiative.

Version history

  1. Preprint posted:
  2. Sent for peer review:
  3. Reviewed Preprint version 1:
  4. Reviewed Preprint version 2:
  5. Version of Record published:

Cite all versions

You can cite all versions using the DOI https://doi.org/10.7554/eLife.109647. This DOI represents all versions, and will always resolve to the latest one.

Copyright

© 2026, Tagoe et al.

This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.

Metrics

  • 798
    views
  • 26
    downloads
  • 0
    citations

Views, downloads and citations are aggregated across all versions of this paper published by eLife.

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Open citations (links to open the citations from this article in various online reference manager services)

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

  1. Ishmael Nii Ayibontey Tagoe
  2. Amanpreet Kaur
  3. Osbourne Quaye
  4. Emmanuel Ayitey Tagoe
  5. Nicole M Koropatkin
  6. Leslie S Satin
  7. Malini Raghavan
(2026)
Molecular and functional analysis of calcium binding by a cancer-linked calreticulin mutant
eLife 15:RP109647.
https://doi.org/10.7554/eLife.109647.3

Share this article

https://doi.org/10.7554/eLife.109647

Categories and tags

Research organism