Hsp70 is phosphorylated in a conserved response to DNA damage and contributes to cell cycle control
- G.W. Hooper Foundation, University of California, San Francisco, United States
- Department of Microbiology and Immunology, University of California, San Francisco, United States
- Department of Pharmaceutical Chemistry and the Institute for Neurodegenerative Diseases, University of California, San Francisco, United States
- Biohub, United States
Figures
Figure 1
The phosphomimetic Hsc70 T495E mutant adopts an open-like conformation.
(a) Crystal structure of bovine Hsc70 (residues 1–554; PDB: 1YUW). The nucleotide-binding domain (NBD, residues 1–383) is shown in cyan, the interdomain linker (residues 384–394) in green, and the substrate-binding domain (SBD, residues 395–506) in magenta. T495 is highlighted in white and marked with an asterisk. (b) Multiple sequence alignment of cytosolic Hsp70 orthologs. Human (P11142), mouse (P63017), cow (P19120), chicken (O73885), zebrafish (Q90473), fruit fly (P11147), worm (P09446), budding yeast (P10591), fission yeast (Q10265), and Arabidopsis (P22953) Hsc70 UniProt sequences were aligned with MAFFT (v7). Coloring follows CLUSTAL conventions; T495 is marked with an asterisk (*). (c) J-protein-stimulated ATPase activity of wild-type (WT) and phosphomimetic Hsc70(T495E) measured by malachite green assay. Data points represent mean + SD of technical triplicates. (d) Fluorescence polarization of ATP-FAM binding to WT and T495E Hsc70. Values were normalized to the minimum and maximum polarization; data points represent mean + SD of technical triplicates. (e) Partial proteolysis of WT and T495E Hsc70 by trypsin in the presence of ATP or ADP. Digestion products were resolved by SDS-PAGE and visualized with a Coomassie stain, and band intensities were quantified (bar graph, right). Statistical significance was determined by two-way ANOVA with Šidák’s multiple comparisons test (adjusted p=0.0002, n=4 technical replicates). (f) Tau binding to immobilized WT and T495E Hsc70 measured by ELISA. Data points represent mean + SD of technical triplicates.
-
Figure 1—source data 1
tif file containing original unedited Coomassie for Figure 1e.
- https://cdn.elifesciences.org/articles/110044/elife-110044-fig1-data1-v1.zip
-
Figure 1—source data 2
tif file containing original Coomassie for Figure 1e with bands labeled.
- https://cdn.elifesciences.org/articles/110044/elife-110044-fig1-data2-v1.zip
Figure 2 with 1 supplement
Base excision repair drives phosphorylation of Hsp70 in human cells.
(a) Hsp70 phosphorylation by methyl methanesulfonate (MMS) treatment or LegK4 overexpression. HEK293T cells were transiently transfected overnight with LegK4∆1–58:GFP or treated with 10 mM MMS for 5 hr. Phosphorylation at T495 was detected using a phospho-specific antibody to pHsp70 T495; GAPDH was used as a loading control. Data are representative of n>3 independent experiments. (b) Schematic of the base excision repair (BER) pathway, highlighting steps relevant to MMS-induced DNA damage. (c) N-methylpurine DNA glycosylase (MPG) overexpression increases pHsp70 levels. HEK293T cells were transiently transfected with MPG overnight, treated with MMS, and analyzed by immunoblotting for pHsp70, the loading controls GAPDH and Hsp70, and the DNA damage marker γH2AX. Data are representative of n=3 independent experiments. (d) Inhibition of APE1 reduces MMS-induced pHsc70. Cells were pretreated for 1 hr with 5 µM, 10 µM, or 50 µM APE1 inhibitor (APE1 compound III) before MMS treatment. Hsp70 and pHsp70 were detected by immunoblotting. Data are representative of n=3 independent experiments. (e) Masking of AP sites prevents pHsp70 accumulation. Cells were pretreated with 60 mM methoxyamine (Mx) for 30 min, followed by cotreatment with 30 mM Mx and 10 mM MMS for 5 hr. pHsp70, the loading controls GAPDH and Hsp70, and the DNA damage marker γH2AX were detected by immunoblotting. Data are representative of n=3 independent experiments. (f) DNA damage specificity panel for pHsp70 induction. Cells were treated with bleomycin (10 µM, 5 hr or 24 hr), camptothecin (10 µM, 5 hr), hydroxyurea (2 mM, 24 hr), MMS (3 mM or 10 mM, 5 hr), sodium arsenite (0.5 mM, 5 hr), or DMSO vehicle (5 hr). Immunoblotting was performed for pHsp70, DDR kinase activation markers (pDNA-PKcs S2056, pChk2 T68, pChk2 S16, pATM S1981), DNA damage marker γH2AX, and loading controls (Hsp70 and Hsp90). Data are representative of n=3 independent experiments.
-
Figure 2—source data 1
tif files containing original unedited Western blots for Figure 2a and c–f.
- https://cdn.elifesciences.org/articles/110044/elife-110044-fig2-data1-v1.zip
-
Figure 2—source data 2
tif file containing original Western blots for Figure 2a and c–f with bands labeled.
- https://cdn.elifesciences.org/articles/110044/elife-110044-fig2-data2-v1.zip
Figure 2—figure supplement 1
Base excision repair drives phosphorylation of Hsp70 in human cells.
(a) Methyl methanesulfonate (MMS)-induced pHsp70 band is sensitive to phosphatases. Cells were treated with 10 mM MMS for 5 hr or left untreated, and then lysed in the presence or absence of phosphatase inhibitor. pHsp70, Hsp70, and GAPDH levels were examined via immunoblotting. Data are representative of n=3 independent experiments. (b) Effect of overexpression of APE1 on pHsp70 levels. Cells were transiently transfected with APE1-Halo or EV overnight before treatment with MMS. pHsp70 and APE1 levels were examined via immunoblotting, with tubulin as a loading control. Data are representative of n=3 independent experiments. (c) Effect of overexpression of Polβ on pHsp70 levels. Cells were transiently transfected with Polβ or EV overnight before treatment with MMS. pHsp70 and Polβ levels were examined via immunoblot. γH2AX was probed to detect overall levels of DNA damage. DNA-PKcs autoactivation was monitored by immunoblotting pDNA-PKcs (S2056). Tubulin was used as a loading control. Data are representative of n=2 independent experiments. (d) Masking of AP sites prevents arsenite-induced pHsp70 accumulation. Cells were pretreated with 60 mM methoxyamine (Mx) for 30 min, followed by cotreatment with 30 mM Mx and 0.5 mM sodium arsenite for 5 hr. pHsp70 and the loading control α-tubulin were detected by immunoblotting. Data are from n=1 experiment. (e) Inhibition of APE1 reduces arsenite-induced pHsc70. Cells were pretreated for 1 hr with 50 µM APE1 inhibitor (APE1 compound III) before arsenite treatment. pHsp70 and the loading control α-tubulin were detected by immunoblotting. Data are from n=1 experiment.
-
Figure 2—figure supplement 1—source data 1
tif files containing original unedited Western blots for Figure 2—figure supplement 1a–e.
- https://cdn.elifesciences.org/articles/110044/elife-110044-fig2-figsupp1-data1-v1.zip
-
Figure 2—figure supplement 1—source data 2
tif file containing original Western blots for Figure 2—figure supplement 1a–e with bands labeled.
- https://cdn.elifesciences.org/articles/110044/elife-110044-fig2-figsupp1-data2-v1.zip
Figure 3 with 1 supplement
DNA damage response (DDR) kinase activity is upstream of Hsp70 phosphorylation.
(a) DNA-PKcs knockdown reduces pHsp70 levels. Cells were transiently transfected with three independent siRNAs targeting DNA-PKcs or a scramble control for 72 hr, followed by treatment with 10 mM methyl methanesulfonate (MMS) for 5 hr. pHsp70 and GAPDH (loading control) were detected by immunoblotting. Data are representative of n=3 independent experiments. (b) Pharmacological inhibition of ataxia-telangiectasia mutated (ATM) decreases pHsp70 induction. Cells were pretreated for 1 hr with ATM inhibitors (10 µM KU-60019 or 200 nM AZD1390), then treated with 10 mM MMS for 5 hr. ATM and DNA-PKcs autoactivation were monitored by immunoblotting pATM (S1981) and pDNA-PKcs (S2056), respectively. Tubulin and total Hsp70 served as loading controls. Data are representative of n=3 independent experiments. (c) Pharmacological inhibition of ATM, DNA-PKcs, Chk2, and CK1 decreases Hsp70 phosphorylation during MMS treatment. Cells were pretreated for 1 hr with inhibitors for ATM (200 nM AZD1390), DNA-PKcs (2 µM AZD7648), Chk2 (5 µM CCT241533), CK1 (50 µM PF-670462), or with vehicle control (DMSO), then treated with 10 mM MMS for 5 hr. Immunoblotting was performed against pHsp70 and the loading control Hsp70. Data are representative of n=3 independent experiments. (d) Time course of MMS-induced DDR activation and pHsp70 phosphorylation. Cells were treated with 10 mM MMS and harvested hourly. ATM and DNA-PKcs activation were detected by pATM (S1981) and pDNA-PKcs (S2056), respectively. Chk2 activation was monitored by pChk2 (T68) and pChk2 (S516). DNA damage was assessed via γH2AX. Hsp70 and Hsp90 were used as loading controls. Data are representative of n=3 independent experiments.
-
Figure 3—source data 1
tif files containing original unedited Western blots for Figure 3a–d.
- https://cdn.elifesciences.org/articles/110044/elife-110044-fig3-data1-v1.zip
-
Figure 3—source data 2
tif file containing original Western blots for Figure 3a–d with bands labeled.
- https://cdn.elifesciences.org/articles/110044/elife-110044-fig3-data2-v1.zip
Figure 3—figure supplement 1
DNA damage response (DDR) kinase activity is upstream of Hsp70 phosphorylation.
(a) Ataxia-telangiectasia mutated (ATM) knockdown does not reduce pHsp70 levels during methyl methanesulfonate (MMS) treatment. Cells were transiently transfected with three independent siRNAs targeting ATM or a scramble control for 72 hr, followed by treatment with 10 mM MMS for 5 hr. ATM, pHsp70, and GAPDH (loading control) were detected by immunoblotting. Data are from n=1 experiment. (b) Ataxia-telangiectasia and Rad3-related (ATR) knockdown does not reduce pHsp70 levels during MMS treatment. Cells were transiently transfected with three independent siRNAs targeting ATR or a scramble control for 72 hr, followed by treatment with 10 mM MMS for 5 hr. ATR, pHsp70, and GAPDH (loading control) were detected by immunoblotting. Data are from n=1 experiment. (c) CK1 inhibition leads to dose-dependent decrease of pHsp70 accumulation. Cells were pretreated with vehicle or the CK1 inhibitor PF-670462 (5 µM, 25 µM, or 50 µM) for 1 hr, followed by 10 mM MMS treatment for 5 hr. pHsp70 and the loading control GAPDH were detected by immunoblotting. Data are representative of n=3 independent experiments. (d) Pharmacological inhibition of ATM, DNA-PKcs, Chk2, and CK1 decreases Hsp70 phosphorylation during arsenite treatment. Cells were pretreated for 1 hr with inhibitors for ATM (200 nM AZD1390), DNA-PKcs (2 µM AZD7648), Chk2 (5 µM CCT241533), CK1 (50 µM PF-670462), or with vehicle control (DMSO), then treated with 0.5 mM arsenite for 5 hr. Immunoblotting was performed against pHsp70, active DDR kinases (pDNA-PKcs(S2056), pChk2(T68), pATM(S1981), pChk2(S516)), or the loading controls Hsp70 or Hsp90. Data are representative of n=2 independent experiments.
-
Figure 3—figure supplement 1—source data 1
tif files containing original unedited Western blots for Figure 3—figure supplement 1a–d.
- https://cdn.elifesciences.org/articles/110044/elife-110044-fig3-figsupp1-data1-v1.zip
-
Figure 3—figure supplement 1—source data 2
tif file containing original Western blots for Figure 3—figure supplement 1a–d with bands labeled.
- https://cdn.elifesciences.org/articles/110044/elife-110044-fig3-figsupp1-data2-v1.zip
Figure 4 with 1 supplement
Hsp70 phosphorylation is linked to the cell cycle.
(a) Variable pulse-chase methyl methanesulfonate (MMS) treatment suggests a complex signaling pathway. Cells were treated with 10 mM MMS for 1–5 hr, washed, then incubated in MMS-free media for the remainder of the 5 hr period. Ataxia-telangiectasia mutated (ATM) and DNA-PKcs activation were detected by pATM (S1981) and pDNA-PKcs (S2056); Chk2 activation by pChk2 (T68) and pChk2 (S516); DNA damage by γH2AX. Cell cycle progression was monitored with S phase markers thymidine kinase (ThyK) and CDT1; mitotic entry marker pCdk1(Y15) (dephosphorylation permits M phase entry), M phase marker phospho-histone H3 (S10) (pH3); and cyclins B and E. GAPDH and Hsp90 are loading controls. Data are representative of n=3 independent experiments. (b) Early S phase synchronization fails to increase pHsp70 accumulation. Cells were synchronized with 2.5 mM thymidine (18 hr→ 9 hr release → 17 hr retreatment) and released into fresh media ±10 mM MMS for the indicated times. Asynchronous cells were also MMS-treated. Immunoblots were performed for pHsp70, cell cycle markers (pCdk1 Y15, pH3, CDT1, ThyK), and loading controls α-tubulin and Hsp90. Data are representative of n=2 independent experiments. (c) G2/M stalling by CDK1 inhibition reduces pHsp70 levels. Cells were pretreated with 10 µM CDK1 inhibitor Ro3306 or DMSO for 17.5 hr, washed, then treated again with Ro3306 or DMSO ± 10 mM MMS for 5 hr. Immunoblotting was performed for pHsp70, cell cycle markers (pCdk1 Y15, pH3, CDT1, cyclin A), DDR markers (pDNA-PKcs S2056, pChk2 T68, γH2AX), and loading controls Hsp70 and Hsp90. Data are representative of n=3 independent experiments. (d) Subcellular fractionation of pHsp70 during MMS treatment shows nuclear localization. Cells were treated with 10 mM MMS from 1 to 5 hr or left untreated. Cytoplasmic and nuclear extracts were prepared using the NE-PER kit. Immunoblotting was performed for pHsp70 and total Hsp70 levels; α-tubulin and lamin B1 served as cytoplasmic and nuclear markers, respectively. Data are representative of n=3 independent experiments. (e) A 2 hr MMS pulse chase reveals pHsp70 accumulation post-mitosis. Cells were treated with 10 mM MMS for 2 hr, washed, and then incubated in fresh media. Samples were harvested hourly, alongside an untreated control. Immunoblotting was performed for pHsp70, DDR markers (pDNA-PKcs S2056, pChk2 T68, pATM S1981, pChk2 S516, γH2AX), cell cycle markers (cyclin A, pCdk1 Y15, pH3, cyclin B, ThyK), and loading controls Hsp70 and Hsp90. Data are representative of n=3 independent experiments.
-
Figure 4—source data 1
tif files containing original unedited Western blots for Figure 4a–e.
- https://cdn.elifesciences.org/articles/110044/elife-110044-fig4-data1-v1.zip
-
Figure 4—source data 2
tif file containing original Western blots for Figure 4a–e with bands labeled.
- https://cdn.elifesciences.org/articles/110044/elife-110044-fig4-data2-v1.zip
Figure 4—figure supplement 1
Mitosis precedes Hsp70 phosphorylation.
(a) G2/M stalling by CDK1 inhibition reduces arsenite-induced pHsp70 levels. Cells were pretreated with 10 µM CDK1 inhibitor Ro3306 or DMSO for 16 hr, washed twice with PBS, then treated again with Ro3306 or DMSO in the presence or absence of 0.5 mM sodium arsenite for 5 hr. Immunoblotting was performed for pHsp70, cell cycle markers (pCdk1(Y15), pH3, cyclin B, ThyK), DDR markers (pChk2 (T68), γH2AX), and loading controls Hsp70 and Hsp90. Data are representative of n=2 independent experiments.
-
Figure 4—figure supplement 1—source data 1
tif files containing original unedited Western blots for Figure 4—figure supplement 1a.
- https://cdn.elifesciences.org/articles/110044/elife-110044-fig4-figsupp1-data1-v1.zip
-
Figure 4—figure supplement 1—source data 2
tif file containing original Western blots for Figure 4—figure supplement 1a with bands labeled.
- https://cdn.elifesciences.org/articles/110044/elife-110044-fig4-figsupp1-data2-v1.zip
Figure 5 with 1 supplement
Ssa1 T492 phosphorylation mutations cause cell cycle defects in S. cerevisiae.
(a) Phosphorylation of Hsp70 is conserved in yeast. Strains were grown to mid-log and treated with 0.05% methyl methanesulfonate (MMS) in YPAD or fresh YPAD for 3 hr. Immunoblots were performed for pHsp70, and total protein (Stain-Free, Bio-Rad) was used as a loading control. Data are representative of n=2 experiments. (b) Growth curves of S. cerevisiae Ssa1 mutants show delayed growth. Indicated strains were grown to mid-log phase, diluted to the same starting concentration, and monitored overnight at 30°C in a plate reader. Data represent the average of technical triplicates. Data are representative of n=3 independent experiments. (c) Half-times (t1/2) of both Ssa1 mutants in the ssa2∆ background, and of the phosphomimetic mutant in the SSA2 background, are significantly increased. Sigmoidal fits were applied to growth curves to determine t1/2 values. The data represent three technical replicates with two biological replicates per strain. Bars represent mean ± SD of six replicates (n=6; 2 biological replicates × 3 technical replicates) Statistical significance was determined by ordinary one-way ANOVA followed by Dunnett’s multiple comparison test (**p=0.0015; ****p<0.0001). (d) Cell cycle distribution analysis reveals G1 stalling of Ssa1 phosphomutants. Yeast were grown to mid-log phase, adjusted to the same concentration, and immediately fixed. Cells were stained with Sytox Green and analyzed by flow cytometry to determine DNA content. Histograms display DNA content (X-axis) with 1N corresponding to G1 phase, 2N to G2/M, and intermediate values to S phase. Left: WT SSA2 background; right: ssa2∆ background. Data are representative of n=4 technical replicates with 2 biological replicates per strain. (e) Ssa1 phosphomutants display increased MMS sensitivity in a spot test assay. Yeast were grown to mid-log phase, adjusted to 2e7 cells/mL, serially diluted 1:10, and spotted (5 µL) onto YPAD plates with or without 0.0095% MMS. Plates were incubated at 30°C and imaged after 3 days. Data are representative of n=3 independent experiments. (f) Ssa1 phosphomutants exhibit perturbed G1/S stalling during MMS recovery. Yeast were grown to mid-log phase, treated with 0.05% MMS for 3 hr, washed, and resuspended in fresh media for recovery. Samples were collected at the indicated times points and analyzed by staining and flow cytometry as described as in (d). Data are representative of n=2 technical replicates with 2 biological replicates per strain.
-
Figure 5—source data 1
tif files containing original unedited Western blot and Stain-Free gel for Figure 5a.
- https://cdn.elifesciences.org/articles/110044/elife-110044-fig5-data1-v1.zip
-
Figure 5—source data 2
tif file containing original Western blot and Stain-Free gel for Figure 5a with bands labeled.
- https://cdn.elifesciences.org/articles/110044/elife-110044-fig5-data2-v1.zip
Figure 5—figure supplement 1
Cell size is increased for Ssa1 phosphomutant yeast strains in the absence of Ssa2.
(a) Size distribution of Ssa1 mutant strains. Yeast were grown to mid-log phase, adjusted to the same concentration, and immediately fixed. Cells were stained with Sytox Green and analyzed by flow cytometry to determine DNA content. Cells were gated by singlets and then by DNA content (1N=G1; 2N=G2/M). Size is displayed as forward scatter area (FSC-A) on the X axis and count normalized to unit area on the Y axis. The left column are strains in the SSA2 background, and the right is strains in the ssa2∆ background. Ssa1 mutants are color-coded (WT gray, TA blue, TE purple). Data are representative of n=4 independent technical replicates with 2 biological replicates per strain.
Tables
Appendix 1—key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Transfected construct (human) | Hsc70 in pMCSG7 | Moss 2019 Seo et al., 2016 | pSM226 | |
| Transfected construct (human) | Hsc70(T495E) in pMCSG7 | Moss 2019 Seo et al., 2016 | pSM227 | |
| Transfected construct (human) | LegK4∆1–58 in pEGFP-C2 | Moss 2019 Seo et al., 2016 | pSM160 | |
| Transfected construct (human) | MPG in pIRESNeo | Addgene | Plasmid #12548 | |
| Transfected construct (human) | APE1 in pCMVd3 | This paper | pSM303 | Plasmid for APE1 overexpression experiment in human cells (see Figure 2—figure supplement 1) |
| Transfected construct (human) | pCMVd3 empty vector | This paper | pSM304 | Empty vector control for APE1 overexpression experiment in human cells (see Figure 2—figure supplement 1) |
| Transfected construct (human) | Polβ in pLVX-GWE-IRES-puro | Addgene | Plasmid #128653 | |
| Transfected construct (human) | plVX-GWE-IRES-puro empty vector | This paper | pSM289 | Empty vector control for Polβ overexpression experiment in human cells (see Figure 2—figure supplement 1) |
| Transfected construct (human) | pYM13 PCR template KanMX resistance | Gift from David O. Morgan Lab | pSM302 | |
| Transfected construct (human) | siRNA to DNA-PKcs #1 | genomeRNAi | s773 | GCGUUGGAGUGCUACAACA[dT][dT] |
| Transfected construct (human) | siRNA to DNA-PKcs #2 | genomeRNAi | s775 | CAAGCGACUUUAUAGCCUU[dT][dT] |
| Transfected construct (human) | siRNA to DNA-PKcs #3 | genomeRNAi | SI02663633 | GACCCUGUUGACAGUACUU[dT][dT] |
| Transfected construct (human) | siRNA to ATM #1 | genomeRNAi | s1710 | GCUGUUACCUGUUUGAAAA[dT][dT] |
| Transfected construct (human) | siRNA to ATM #2 | genomeRNAi | SI02663360 | CACCUGUUUGUUAGUUUAU[dT][dT] |
| Transfected construct (human) | siRNA to ATM #3 | genomeRNAi | SI03068506 | CAGCUGUCAUCAUAUAAGA[dT][dT] |
| Transfected construct (human) | siRNA to ATR #1 | genomeRNAi | s534 | GAGCCGAUUUUUAAGUCAA[dT][dT] |
| Transfected construct (human) | siRNA to ATR #2 | genomeRNAi | s535 | GAUGAGUAUGCAAAAUUUA[dT][dT] |
| Transfected construct (human) | siRNA to ATR #3 | genomeRNAi | SI02625476 | GCCGCUAAUCUUCUAACAU[dT][dT] |
| Sequence-based reagent | SSA1 gDNA T492E Forward | This paper | PCR primers | TCGATGTCGACTCTAACGGTATTTTGAATGTTTCCGCCGTCGAAAAGGGTGAAGGTAAGTCTAACAAG |
| Sequence-based reagent | SSA1 gDNA T492A Forward | This paper | PCR primers | TCGATGTCGACTCTAACGGTATTTTGAATGTTTCCGCCGTCGAAAAGGGTGCTGGTAAGTCTAACAAG |
| Sequence-based reagent | SSA1 gDNA Reverse | This paper | PCR primers | CAGATCATTAAAAGACATTTTCGTTATTATCAATTGCCGCACCAATTGGCGCATGCCGGTAGAGG |
| Sequence-based reagent | SSA2-KanMx Forward | This paper | PCR primers | TTGATTAATTCCAACAGATCAAGCAGATTTTATACAGAAATATTTATACAATGGGTAAGGAAAAGACTCA |
| Sequence-based reagent | KanMx-Ssa2 Reverse | This paper | PCR primers | GGAAAGCAAAAGTAAAACTTTTCGGATATTTTACAGGGCGATCGCTAAGCTTAGAAAAACTCATCGAGCA |
| Antibody | Anti-pHsp70 (mouse, monoclonal) | Custom (Moss 2019) Seo et al., 2016 | WB (1:5000) | |
| Antibody | Anti-GAPDH (mouse, monoclonal) | Proteintech | 60004-1-lg | WB (1:3000) |
| Antibody | Anti-γH2AX (mouse, monoclonal) | Millipore Sigma | 05-636 | WB (1:1000) |
| Antibody | Anti-Hsp70 (mouse, monoclonal) | Santa Cruz Biotechnology | sc-66048 | WB (1:1000) |
| Antibody | Anti-phospho-DNA-PKcs (S2056) (rabbit, polyclonal) | Abcam | ab18192 | WB (1:1000) |
| Antibody | Anti-phospho-Chk2 (T68) (rabbit, monoclonal) | Cell Signaling Technology | 2197T | WB (1:1000) |
| Antibody | Anti-Hsp90 (rabbit, polyclonal) | Cell Signaling Technology | 4874S | WB (1:1000) |
| Antibody | Anti-phospho-Chk2 (S516) (rabbit, polyclonal) | Cell Signaling Technology | 2669T | WB (1:1000) |
| Antibody | Anti-phospho-ATM (S1981) (mouse, monoclonal) | Cell Signaling Technology | 4526S | WB (1:1000) |
| Antibody | Anti-tubulin (mouse, monoclonal) | Proteintech | 66031-1-Ig | WB (1:3000) |
| Antibody | Anti-thymidine kinase (rabbit, monoclonal) | Cell Signaling Technology | 28755S | WB (1:1000) |
| Antibody | Anti-phospho-CDK1(Y15) (rabbit, monoclonal) | Cell Signaling Technology | 4539S | WB (1:1000) |
| Antibody | Anti-cyclin B (mouse, monoclonal) | Santa Cruz Biotechnology | sc-245 | WB (1:500) |
| Antibody | Anti-phospho-histone-H3 (S10) (rabbit, monoclonal) | Cell Signaling Technology | 53348S | WB (1:1000) |
| Antibody | Anti-cyclin E (mouse, monoclonal) | Santa Cruz Biotechnology | sc-247 | WB (1:1000) |
| Antibody | Anti-CDT1 (rabbit, monoclonal) | Cell Signaling Technology | 8064S | WB (1:1000) |
| Antibody | Anti-lamin B1 (rabbit, polyclonal) | Proteintech | 12987-1-AP | WB (1:1000) |
| Antibody | Anti-cyclin A (mouse, monoclonal) | Santa Cruz Biotechnology | sc-271682 | WB (1:1000) |
| Antibody | Anti-Polβ (rabbit, polyclonal) | Proteintech | 18003-1-AP | WB (1:1000) |
| Antibody | Anti-APE1 (rabbit, polyclonal) | Proteintech | 10203-1-AP | WB (1:1000) |
| Antibody | Anti-ATM (rabbit, monoclonal) | Cell Signaling Technology | 2873S | WB (1:1000) |
| Antibody | Anti-ATR (rabbit, polyclonal) | Cell Signaling Technology | 2790S | WB (1:1000) |
| Strain, strain background (S. cerevisiae) | W303α | Gift from David O. Morgan Lab | Y017 | Parental strain for yeast mutants |
| Strain, strain background (S. cerevisiae) | Ssa1(WT)-NAT #1 | Gift from David O. Morgan Lab | Y019 | S. cerevisiae strain with WT Ssa1 (see Figure 5) |
| Strain, strain background (S. cerevisiae) | Ssa1(WT)-NAT #2 | This paper | Y034 | Independently generated S. cerevisiae strain with WT Ssa1 (see Figure 5) |
| Strain, strain background (S. cerevisiae) | Ssa1(T492A)-NAT #1 | This paper | Y040 | Independently generated S. cerevisiae strain with Ssa1 T492A (see Figure 5) |
| Strain, strain background (S. cerevisiae) | Ssa1(T492A)-NAT #2 | This paper | Y041 | Independently generated S. cerevisiae strain with Ssa1 T492A (see Figure 5) |
| Strain, strain background (S. cerevisiae) | Ssa1(T492E)-NAT #1 | This paper | Y038 | Independently generated S. cerevisiae strain with Ssa1 T492E (see Figure 5) |
| Strain, strain background (S. cerevisiae) | Ssa1(T492E)-NAT #2 | This paper | Y039 | Independently generated S. cerevisiae strain with Ssa1 T492E (see Figure 5) |
| Strain, strain background (S. cerevisiae) | Ssa1(WT)-NAT;ssa2∆ #1 | This paper | Y023 | Independently generated S. cerevisiae strain with WT Ssa1 and disrupted SSA2 (see Figure 5) |
| Strain, strain background (S. cerevisiae) | Ssa1(WT)-NAT;ssa2∆ #2 | This paper | Y037 | Independently generated S. cerevisiae strain with WT Ssa1 and disrupted SSA2 (see Figure 5) |
| Strain, strain background (S. cerevisiae) | Ssa1(T492A)-NAT;ssa2∆ #1 | This paper | Y051 | Independently generated S. cerevisiae strain with Ssa1 T492A and disrupted SSA2 (see Figure 5) |
| Strain, strain background (S. cerevisiae) | Ssa1(T492A)-NAT;ssa2∆ #2 | This paper | Y046 | Independently generated S. cerevisiae strain with Ssa1 T492A and disrupted SSA2 (see Figure 5) |
| Strain, strain background (S. cerevisiae) | Ssa1(T492E)-NAT;ssa2∆ #1 | This paper | Y044 | Independently generated S. cerevisiae strain with Ssa1 T492E and disrupted SSA2 (see Figure 5) |
| Strain, strain background (S. cerevisiae) | Ssa1(T492E)-NAT;ssa2∆ #2 | This paper | Y057 | Independently generated S. cerevisiae strain with Ssa1 T492E and disrupted SSA2 (see Figure 5) |
| Cell line (Homo sapiens) | HeLa | ATCC | CRM-CCL-2 | |
| Cell line (H. sapiens) | HEK293T | ATCC | CRL-3216 | |
| Software | Prism Version 10.4.2 | GraphPad | https://www.graphpad.com/scientific-software/prism/ | |
| Software | ImageLab 6.0.1 | Bio-Rad | https://www.bio-rad.com/en-us/product/image-lab-software?ID=KRE6P5E8Z | |
| Software | FlowJo 10.10.0 | BD Life Sciences | https://flowjo.com/flowjo/download | |
| Software | UCSF Chimera X v1.3 | Pettersen et al. Blackford and Stucki, 2020 | https://www.rbvi.ucsf.edu/chimera | |
| Chemical compound, drug | Methyl methanesulfonate | Fisher Scientific | AC156890050 | |
| Chemical compound, drug | Methoxyamine hydrochloride | Sigma-Aldrich | 226904 | |
| Chemical compound, drug | APE1 compound III | EMD Millipore | 262017 | |
| Chemical compound, drug | Bleomycin (sulfate) | Thomas Scientific | C830H18 | |
| Chemical compound, drug | Camptothecin | Selleck | S1288 | |
| Chemical compound, drug | Hydroxyurea | Sigma-Aldrich | H8627 | |
| Chemical compound, drug | Sodium arsenite | Fisher Scientific | S88733 | |
| Chemical compound, drug | KU-60019 | MedChem Express | HY-12061 | |
| Chemical compound, drug | AZD1390 | MedChem Express | 2089288-03-7 | |
| Chemical compound, drug | CCT241533 | MedChem Express | HY-14715B | |
| Chemical compound, drug | PF-670462 | Sigma-Aldrich | SML0795 | |
| Chemical compound, drug | Thymidine | Fisher Scientific | 501882638 | |
| Chemical compound, drug | Ro-3306 | MedChem Express | HY-12529 | |
| Chemical compound, drug | AZD7648 | MedChem Express | 2230820-11-6 |
Additional files
Download links
A two-part list of links to download the article, or parts of the article, in various formats.
Downloads (link to download the article as PDF)
Open citations (links to open the citations from this article in various online reference manager services)
Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)
Hsp70 is phosphorylated in a conserved response to DNA damage and contributes to cell cycle control
eLife 15:RP110044.
https://doi.org/10.7554/eLife.110044.3
