eLife Assessment

This important paper presents a rigorous and comprehensive deep mutational analysis of the kinase TYK2, revealing how single amino acid substitutions influence protein abundance, signaling activity, and responses to pharmacological inhibitors. By combining high‑quality experimental design with dose‑response signaling assays and multiple inhibitor conditions, the authors generate a robust dataset that identifies variants across all domains of TYK2, including clusters at functionally critical sites and protein-protein interfaces. The study highlights mutations that drive drug resistance or potentiation and shows that reduced TYK2 abundance aligns with protective autoimmune‑associated variants, underscoring the therapeutic relevance of modulating TYK2 stability. Overall, the work provides compelling insights with clear implications for biochemistry, immunology, clinical genetics, and drug discovery.

https://doi.org/10.7554/eLife.110149.2.sa0

Abstract

Tyrosine kinase 2 (TYK2) is a genetically defined target for autoimmune disease, with first-generation inhibitors showing clinical success in some but not all associated indications. A deeper understanding of TYK2 structure-function relationships, protein-ligand interactions, and the impact of human variants could inform next-generation therapeutics. Here, we applied deep mutational scanning (DMS) to assess >23,000 amino acid substitutions across two TYK2 functions: interferon alpha (IFN-α) signaling and protein abundance. This enabled high-resolution structure-function mapping and the identification of novel allosteric sites. By coupling DMS with inhibitor treatment, we uncovered variants that modulate compound potency. We also show that human variants – both common and rare – that are protective against autoimmune phenotypes reduce TYK2 protein abundance. Together, these findings demonstrate that DMS can prospectively reveal novel druggable sites, clarify structure-activity relationships (SAR), and highlight TYK2 degradation as a potential therapeutic strategy in autoimmunity.

Introduction

Tyrosine kinase 2 (TYK2) is a member of the Janus kinase (JAK) family of non-receptor kinases and plays an essential role in signal transduction of multiple interferon and interleukin cytokine pathways (Minegishi et al., 2006; Kreins et al., 2015; Muromoto et al., 2022). TYK2 binds to the intracellular domains of cytokine receptors alongside cognate JAK family members. Cytokine binding at the cell surface leads to receptor dimerization and activation of the intracellular kinases, which then phosphorylate the STAT effector transcription factors that subsequently activate downstream transcriptional programs critical for immune responses (Muromoto et al., 2022; Hu et al., 2021). Human genetic studies have shown that TYK2 is a key mediator of many immune-related phenotypes. Individuals harboring rare variants that abolish TYK2 function (in homozygosity or compound heterozygosity) have immune deficiency and increased susceptibility to mycobacterial infection (OMIM: #611521) (Minegishi et al., 2006; Kreins et al., 2015). Additionally, genome-wide association studies (GWAS) have reproducibly identified common variants at the TYK2 locus as associated with reduced risk to many autoimmune phenotypes, including psoriasis (PsO), rheumatoid arthritis (RA), ulcerative colitis (UC), multiple sclerosis, and others (International Multiple Sclerosis Genetics Consortium, 2013; Diogo et al., 2015; Genetic Analysis of Psoriasis Consortium & the Wellcome Trust Case Control Consortium 2, 2010; Dendrou et al., 2016). The most well-studied of these protective variants (rs34536443) is a missense allele that changes the proline at residue 1104 to alanine (henceforth referred to as P1104A) that is associated with reduced activity for a subset of TYK2 signaling functions in human immune cells (Dendrou et al., 2016; Boisson-Dupuis et al., 2018; Ogishi et al., 2022). In contrast to variants that fully abolish TYK2 function, P1104A is associated with an increased risk to tuberculosis but not otherwise implicated in severe immune deficiency (Dendrou et al., 2016; Boisson-Dupuis et al., 2018; Ogishi et al., 2022). The orthologous mouse allele has been shown to protect against autoimmune encephalomyelitis in an engineered model (Dendrou et al., 2016). Collectively, these findings suggested that therapies that partially, but not fully, reduce TYK2 function could be broadly effective for treating autoimmune disease with limited risk of severe infection (Dendrou et al., 2016).

The selective inhibition of TYK2 is particularly appealing for the treatment of autoimmune phenotypes, as many approved therapies nonselectively inhibit multiple JAK proteins (e.g. JAK1, JAK2, and/or JAK3) and are associated with serious side effects (Samuel et al., 2023). Allosteric TYK2 inhibitors that selectively bind to the protein’s regulatory pseudokinase domain have recently emerged as promising alternatives. Deucravacitinib (Sotyktu) was the first such selective TYK2 inhibitor, approved in 2022 for the treatment of moderate to severe plaque PsO without a black box safety warning (Papp et al., 2018; Armstrong et al., 2025; Hoy, 2022). Clinical trials are ongoing for this and other TYK2 inhibitors for a range of indications (Jensen et al., 2023; Armstrong et al., 2024; Danese et al., 2025). While TYK2 inhibition has shown early success in treating PsO, it has not demonstrated clinical efficacy in UC, despite the disease association with the common protective P1104A variant (Anonymous, 2022). This underscores the need for a more comprehensive mechanistic understanding of human TYK2 variants that protect against autoimmune disease. Such insights could inform the discovery and development of next-generation pharmaceuticals for the target.

Deep mutational scanning (DMS) is a powerful emerging method to characterize variant effects and protein structure-function relationships by using multiplexed cellular reporter assays to measure the impact of thousands of amino acid substitutions on a desired protein’s function (Fowler and Fields, 2014; Starita et al., 2017; Maes et al., 2023). In previous work, we demonstrated a DMS approach that uses cellular transcriptional assays, DNA barcoded reporters, and advanced statistical analysis methods to quantitatively and precisely measure variant effects and protein-ligand interactions for G-protein-coupled receptors (GPCRs) (Jones et al., 2020; Howard et al., 2025). In this study, we extended these methods to a new target class (kinases) and elucidated insights into TYK2 biology that could meaningfully inform future drug discovery. In total, we assessed the effects of >99.9% of the 23,740 possible single amino acid substitutions to TYK2 on two functions: TYK2 protein abundance and immune signaling through the interferon alpha (IFN-α) pathway. By integrating abundance and signaling data, we identified protein regions with critical catalytic and allosteric functions, including novel allosteric sites with potential therapeutic value. We performed DMS assays in the presence of TYK2 inhibitors to map the function of target-drug interactions at amino acid resolution and pinpointed residues that modulate drug resistance and potency. Finally, we showed that naturally occurring TYK2 variants that reduce protein abundance are associated with protection against autoimmune disease, including rare variants with previously unknown functional or phenotypic effects. Together, these results establish a comprehensive structure-function map of TYK2, elucidate the relative importance of different drug-target interactions that could guide future compound optimization, and strongly suggest that therapies that reduce TYK2 protein abundance would be effective for the treatment of autoimmune disease.

Results

Effects of >23k TYK2 variants on IFN-α signaling and protein abundance

Two independent DMS assays were developed to profile the functional consequences of all 23,740 possible single missense and nonsense substitutions on two TYK2 characteristics: (1) activation of the IFN-α immune signaling pathway and (2) TYK2 protein abundance (Figure 1A). The IFN-α DMS assay was adapted from a highly quantitative barcoded transcriptional reporter-based method we previously described (Jones et al., 2020; Howard et al., 2025) (see Materials and methods for further details). Briefly, we started with a HEK293T cell line that harbors a single-copy landing pad site for Bxb1 recombinase-mediated DNA integration of DMS reporters (Howard et al., 2025) and knocked out all endogenous alleles of TYK2 in this cell line using Cas9 and sequence-specific single-guide RNAs (sgRNAs). We then made the resulting cell line capable of IFN-α signaling by randomly but stably integrating transgenes for two key pathway components (STAT2 and IRF9) that are not expressed in HEK293T cells. In parallel, we built a DNA reporter cassette containing TYK2, along with a barcoded luciferase reporter gene that is under the control of an interferon-stimulated response element (ISRE) (Levy et al., 1988). Integrating a single copy of this reporter via Bxb1 recombination into the landing pad site of the engineered IFN-α competent HEK293T cell line resulted in reporter gene expression that was TYK2- and IFN-α dose-dependent (Figure 1—figure supplement 1A).

Figure 1 with 3 supplements see all
Effects of >23,000 amino acid variants on TYK2 signaling and protein abundance.

(A) Schematic showing the reporter design for TYK2 deep mutational scanning (DMS) assays on interferon alpha (IFN-α) signaling (left) and protein abundance (right). BC, unique DNA barcode; BFP, blue flourescent protein; GFP, green fluorescent protein; ISRE, interferon-stimulated response element. (B) Heatmaps showing the functional effects of each TYK2 variant, represented as z-scores, for IFN-α signaling (left, 100 U/mL IFN-α condition) and protein abundance (right). Rows and columns of the heatmap correspond to amino acid position and variant identity, respectively. TYK2 protein domains are shown on the far right. GOF, gain-of-function; LOF, loss-of-function; WT, wild-type. (C) Structures of the TYK2 kinase and pseudokinase domains (PDB: 4OLI) with residues colored blue to indicate positions that have at least two significant LOF variants at that position in the IFN-α signaling (left) or protein abundance (right) assay (FDR<0.01). Panel A was created with BioRender.com.

For the TYK2 protein abundance assay, we used the same engineered cell line described above and adapted the variant abundance by massively parallel sequencing (VAMP-seq) reporter method (Matreyek et al., 2018) (see Materials and methods for further details). Briefly, green fluorescent protein (GFP) was appended to the amino-terminus of TYK2 (Figure 1A), and this was linked to a second reporter gene (blue fluorescent protein [BFP]) that served as a transcriptional control. Fluorescence-activated cell sorting (FACS) of GFP normalized to BFP clearly distinguished wild-type (WT) TYK2 from variants (e.g. E154X, K930E) that reduce TYK2 stability (Figure 1—figure supplement 1B).

Finally, we previously described the development of a negative binomial mixed effect model-based analysis method for DMS data (Howard et al., 2025), which we used for the IFN-α assay. Existing VAMP-seq analysis methods do not harness the full statistical power of the DNA barcodes present in the reporter design. Therefore, we developed a new analysis framework for this assay (described in detail in Materials and methods). Briefly, we used a negative binomial generalized linear mixed model to explicitly account for both covariates and the high degree of barcode multiplexing, while allowing inference of mean shifts between conditions. We applied the results of this model to define and compute secondary quantities of interest, like contrasts across conditions and bin midpoints for VAMP-seq. This prevents loss of information induced by aggregating barcodes linked to the same variant, by treating them as independent experiments in distinct cells. With these tools in hand, we then built comprehensive DMS libraries and assessed the effects of all possible single amino acid substitutions on TYK2 functions.

For both assays, we generated high-quality DMS libraries with near-complete (>99.9%) variant coverage. Of 23,740 possible single missense or nonsense variants, the IFN-α and abundance libraries included 23,737 and 23,716 variants, respectively (Figure 1B). Each variant was uniquely represented many times in both libraries, with a median of 25 and 15 unique barcodes per variant for the IFN-α and abundance DMS libraries, respectively. These factors, combined with running the IFN-α DMS assay under a range of cytokine stimulation conditions (Table 1), allowed us to accurately and comprehensively assess quantitative variant effects for nearly all possible single amino acid substitutions and nonsense variants of TYK2 (Figure 1B, Figure 1—figure supplements 2 and 3A, B). For example, running the IFN-α DMS assay under high stimulation (100 U/mL IFN-α) identified 2578 loss-of-function (LOF) variants (~11% of tested variants, FDR<0.05, Figure 1—figure supplement 3A). For the protein abundance assay, 4718 variants (~20%) significantly reduced protein abundance (FDR<0.05, Figure 1—figure supplement 3A).

Table 1
Experimental conditions assayed by deep mutational scanning (DMS).
ReporterCytokine stimulationInhibitor
IFN-α
IFN-α1 U/mL IFN-α
IFN-α10 U/mL IFN-α
IFN-α100 U/mL IFN-α
IFN-α100 U/mL IFN-α20 nM BMS-986202 (IC75)
IFN-α100 U/mL IFN-α1 µM BMS-986202 (IC99)
IFN-α100 U/mL IFN-α10 µM BMS-986202 (>IC99)
IFN-α100 U/mL IFN-α7 nM NDI-034858 (IC75)
IFN-α100 U/mL IFN-α1 µM NDI-034858 (IC99)
Abundance
  1. IC: inhibitory concentration.

Benchmarking these results against orthogonal structural data and variant classifications supports the high quality of these DMS assays. As expected, variants that are LOF in either assay cluster in the cores of the major domains of the protein (Figure 1C). Furthermore, variants predicted to be pathogenic by AlphaMissense (Cheng et al., 2023) have significantly lower IFN-α activity and TYK2 protein abundance scores than those predicted to be benign (Figure 1—figure supplement 3C; e.g. IFN-α assay median z-scores were –1.1 versus –0.1 for variants predicted by AlphaMissense to be pathogenic versus benign, respectively; p<2.2e-16, Kolmogorov-Smirnov test). From literature searches, we identified a panel of 32 TYK2 variants that were previously characterized, including 15 reported to be LOF (Minegishi et al., 2006; Kreins et al., 2015; Boisson-Dupuis et al., 2018; Sanda et al., 2013; Dyment et al., 2012; Kerner et al., 2019; Yeh et al., 2000; Staerk et al., 2005; Li et al., 2013; Lupardus et al., 2014; Waanders et al., 2017; Shaw et al., 2003; Wu et al., 2020; Gauzzi et al., 1996). Of these, 11/15 (73.4%) were identified as significantly LOF in the IFN-α assay (100 U/mL stimulation), with the same number LOF in the protein abundance assay (Figure 1—figure supplement 3D). Finally, although the majority of TYK2 variants in ClinVar have unknown functional or clinical significance, our DMS results are consistent with those that do have reported classifications. Specifically, only 3 variants are reported as pathogenic in ClinVar, 19 are classified as benign or likely benign, and 391 are of uncertain significance (Landrum et al., 2025). For the IFN-α signaling assay, 2/3 (66.7%) ClinVar pathogenic variants are significantly LOF, and 18/18 (100%) ClinVar benign/likely benign variants show no significant effect on function (Figure 1—figure supplement 3E). Results were similar for the protein abundance assay (Figure 1—figure supplements 3E, 66.7% of ClinVar pathogenic variants show significantly reduced abundance, 77.8% of ClinVar benign variants show no significant effect on abundance). Collectively, these results demonstrate the high quality and broad coverage of these deep scans of TYK2 function.

Such highly quantitative DMS results can, in principle, be used to glean mechanistic and pharmacological insights to inform decision-making during drug discovery and development (Howard et al., 2025; Weng et al., 2024). For example, these methods, when performed on multiple protein functions and combined with varying assay conditions, should enable prospective identification of distinct allosteric sites on the target, predict variant-specific drug responses or potential resistance mechanisms, assess the relative functions of target-ligand interactions, and identify the mechanistic effects of human variants to guide modality selection for a therapeutic program. To this end, we performed the IFN-α signaling assay with a variety of TYK2 inhibitor conditions (Table 1), generating a total of 356,089 estimates of TYK2 variant-condition effects, and integrated together results from both functional assays (cytokine signaling and protein abundance) to build an in-depth understanding of TYK2 to enable future drug discovery efforts.

Identifying key functional sites of TYK2

JAK kinases bind the intracellular tail of cytokine receptors, and, in their inactive state, the kinase and pseudokinase domains are tightly bound to one another. Upon cytokine binding, the receptors dimerize and bring together their cognate kinases, leading to activation of the kinase domains (Philips et al., 2022), likely through an unfurling of the kinase domain from the pseudokinase domain (Glassman et al., 2022). A growing number of TYK2 inhibitors, including the recently approved therapy deucravacitinib (Sotyktu), target a known allosteric region within the pseudokinase domain of TYK2 and harness the regulatory function of this domain to inhibit TYK2’s kinase activity (Lé et al., 2022; Tokarski et al., 2015). Targeting this allosteric site affords better target specificity, limiting off-target interactions of the drug with other members of the JAK family and reducing the risk of severe side effects (Jensen et al., 2023; Chimalakonda et al., 2021). The identification of other key allosteric sites would provide additional desirable nodes for therapeutic modulation of TYK2. By systematically mapping protein function to structure, DMS is a potentially powerful tool for this purpose (Weng et al., 2024). Specific to the identification of allosteric sites, the IFN-α signaling assay identifies variants that impact TYK2 activity by any mechanism (e.g. inactivating catalytic activity, reducing protein expression, etc.), while the protein abundance assay specifically identifies variants that impact protein abundance (e.g. via folding, stability, trafficking, and/or turnover). Therefore, we hypothesized that intersecting the cytokine signaling and abundance DMS results to define variants that impact the cytokine signaling function without also affecting protein abundance could identify key allosteric and catalytic domains within TYK2 (Figure 2A).

Figure 2 with 1 supplement see all
Identification of allosteric and other functionally important sites of TYK2.

(A) Schematic showing approach to identify key functional sites by pinpointing TYK2 variants that impact interferon alpha (IFN-α) signaling but not protein abundance. LOF, loss-of-function. (B) Scatterplot of individual TYK2 variant effects on IFN-α signaling activity (x-axis) and TYK2 protein abundance (y-axis). Variants highlighted in blue were classified as signaling-only LOF (see Materials and methods for details). GOF, gain-of-function; WT, wild-type. (C) Count of signaling-only LOF variants (horizontal axis) at each residue of TYK2 (vertical axis), shown alongside the functional domains of the protein (left). Regions important for TYK2 function are highlighted in red, including known catalytic, known allosteric, and novel allosteric sites predicted by this analysis. (D) Structure of the TYK2 kinase and pseudokinase domains (PDB: 4OLI) with amino acid positions that have at least two significant signaling-only LOF variants colored blue. Novel allosteric sites predicted by this analysis are labeled with an asterisk (*). (E) Structural model of inactive full-length TYK2 (colored as in D) bound to the intracellular tail of the IFNAR1 receptor (yellow). See Materials and methods for details on how this composite model was constructed. Panel E was created with BioRender.com.

To this end, we partitioned variants that were LOF in the IFN-α assay (100 U/mL stimulation condition) by whether they also impacted TYK2 abundance (see Materials and methods for details). This identified a subset of 948 variants that lead to defects in signaling but not abundance, spread across 373 positions (Figure 2A–C, Figure 2—figure supplement 1, Supplementary file 1). Many positions harbor just one such variant, and these are broadly dispersed throughout the protein. To identify key functional sites, we focused on those positions where there are two or more variants that impact signaling but not abundance (Figure 2C, Figure 2—figure supplement 1). This resulted in 162 positions, including several where most amino acid substitutions at the given position impacted cytokine signaling but not protein abundance (Figure 2C). Importantly, these positions include three key catalytic residues in the orthosteric site of the protein (E947, D1023, D1041), in addition to non-catalytic residues in the orthosteric pocket (positions 1021, 1022, 1063, 1064) and the activation segment (positions 1042, 1043, 1045, 1048, 1052, 1054) that are known to regulate kinase activity (Roskoski, 2023; Figure 2C and D). This also highlighted multiple residues in the known allosteric binding pocket of TYK2 (positions 594, 596, 598, 603, 606, 694, 695, 696, 737, 739, 740, 757) (Jensen et al., 2023; Leit et al., 2023; Figure 2C and D). Collectively, this confirms that the approach can identify key sites of functional regulation of TYK2.

In addition to key sites of known function, we capture intriguing, less well-characterized functional positions. Two distinct regions at the kinase-pseudokinase domain interface show clusters of positions where mutation impacts cytokine signaling but not abundance (Figure 2C and D, Figure 2—figure supplement 1), suggesting that these residues are important for the regulation of the kinase domain by the pseudokinase domain (Lupardus et al., 2014). We also identified intriguing potential allosteric regions within the FERM and SH2 domains of the protein, which are less well characterized than the kinase and pseudokinase domains (Figure 2C). Because a full-length structure of TYK2 does not currently exist, we used available partial structures and a full-length structure of a related protein (JAK1) to construct a full-length model of TYK2 bound to a cytokine receptor and mapped these sites onto it (Figure 2E, see Materials and methods for details). This revealed two surfaces that interface with the tail of the interferon alpha and beta receptor subunit 1 (IFNAR1) (Figure 2E, circled), including several residues known to interact directly with IFNAR1 (L144, S476, T477, and R503) (Wallweber et al., 2014). Our data also captured two clusters of residues along the FERM domain surface that faces the plasma membrane (Figure 2E, asterisks), suggesting novel target sites that regulate TYK2 activity. In summary, our complementary signaling and abundance DMS datasets comprehensively map key functional sites of TYK2. In addition to known catalytic and allosteric positions, this includes novel allosteric sites that may modulate intra- and inter-protein interactions that could be explored for future therapeutic targeting of TYK2.

Functional insights into protein-drug interactions

In addition to providing key insights into protein function, DMS can be used to elucidate functional protein-drug interactions. This includes identifying variants that are likely to lead to drug resistance and, with sufficiently sensitive methods, those that potentiate (i.e. improve) the effects of therapies (Howard et al., 2025; Pines et al., 2020; Persky et al., 2020; Procko, 2020; Chardon et al., 2023; Estevam et al., 2025). In principle, variants that improve the effects of drug candidates could be harnessed in structure-activity relationship (SAR)-based methods to guide the design of more potent compounds (Howard et al., 2025). To gain additional understanding of how selective allosteric inhibitors of TYK2 interact with its pseudokinase domain – and how these interactions may be improved – we performed IFN-α signaling DMS experiments in the presence of two inhibitor compounds: BMS-986202 (Liu et al., 2021) and NDI-034858 (alias: TAK-279) (Leit et al., 2023; Figure 3—figure supplement 1A). We confirmed that these two compounds result in dose-dependent inhibition of WT TYK2’s IFN-α signaling activity in our assay (Figure 3—figure supplement 1B). We then ran the IFN-α DMS assay under a range of inhibitor concentrations to probe two distinct questions: (1) to identify positions that are critical for inhibitor activity, we looked for variants that retain TYK2 activity under high drug concentrations (i.e. drug-resistant variants); and (2) to identify variants that improve inhibitor activity (i.e. drug-potentiating variants), we identified variants that led to further inhibition of TYK2 activity under sub-maximal drug concentrations (Table 1, Figure 3A).

Figure 3 with 1 supplement see all
Functional characterization of protein-drug interactions.

(A) Conceptual schematic of how inhibitor dose influences variant effect interpretation. (B) Volcano plot of variant effects under very high dose (>IC99) of BMS-986202, with significant drug-resistant variants colored pink (FDR<0.01 used as significance threshold throughout figure). (C) Surface representation of the TYK2 pseudokinase domain (PDB: 6NZP) colored as in (B). (D) Allosteric binding site of the TYK2 pseudokinase domain with inhibitor BMS-986202 bound (dark gray) and positions with significant drug resistance colored pink (as in C) for increasing concentrations of BMS-986202. (E) Scatter plot of variant effects (Z-statistic) in the presence of inhibitor (IC99 concentration), with variants colored by whether they exhibit resistance to BMS-986202 (pink), NDI-034858 (cyan), or both (orange). (F) Heatmap of drug-resistant positions (x-axis) and variants (y-axis) colored as in (E, G). Structure (PDB: 6NZP) of TYK2 pseudokinase domain (colored as in E). (H, I, J) Variants that exhibit drug-potentiation to each inhibitor (at IC75 concentrations) displayed as in (E, F, and G), respectively.

First, we assessed variant resistance to a range of high doses of the first inhibitor compound (BMS-986202). At a very high dose of BMS-986202 (10 µM, well above the 99% inhibitory concentration [>IC99]), we identified ten drug-resistant variants located at five unique positions (Figure 3B and C, right panel of Figure 3D; significance of FDR<0.01). Many of these variants occur at residues that have been shown through crystallography to be important for protein-drug interactions, validating the DMS prediction that these positions are critical for direct binding and/or steric accommodation of the inhibitor. For example, position 690 forms a hydrogen bond interaction between TYK2 and compounds structurally similar to BMS-986202 (Wrobleski et al., 2019). Changing this position from valine to proline results in resistance to BMS-986202. Additionally, residue A671 creates an open ‘alanine pocket’ that was exploited in the design of BMS-986202 to confer target specificity (Wrobleski et al., 2019), and substitution to E, K, L, Q, or Y leads to drug resistance. Three of the remaining four resistance variants (T687R, S758D, and S758H) occur at other proximal positions within the binding pocket.

Using a high dose of inhibitor exposes residues that are critical for compound binding, and we reasoned that exploring lower doses would reveal residues that make more subtle, quantitative contributions to protein-drug interactions. Indeed, as inhibitor concentrations were lowered (to IC99 and IC75), we observed an expansion of the spatial distribution of drug-resistant variants (Figure 3D). Lower doses revealed drug-resistant variants at additional positions within the binding pocket, suggesting that these positions more weakly contribute to the binding and activity of the drug. We also observed drug-resistant variants at lower doses that are within the pseudokinase domain but are well outside of the binding pocket (Figure 3D). These more distal positions likely represent residues important for the allosteric activity of the inhibitor and may shed light on how inhibition is transduced from the drug binding site through the pseudokinase domain.

We next identified resistance variants for a second inhibitor (NDI-034858), which binds the same allosteric pocket of TYK2 but in a different orientation and assessed whether we could use the spectrum of resistance variants identified by DMS to distinguish subtle differences in binding interactions between the two small molecules. Comparing drug-resistance profiles of matched (IC99) concentrations for BMS-986202 with NDI-034858 identified drug-resistant variants that are common to the two drugs, along with variants that uniquely ablate activity of one or the other (Figure 3E–G, Figure 3—figure supplement 1C). For example, at position 671, which forms the pocket unique to TYK2 that is thought to drive target specificity of BMS-986202 (Wrobleski et al., 2019), 11 variants at this position confer resistance to BMS-986202 (Figure 3F). Only half of these variants also disrupt the activity of NDI-034858 (Figure 3F). Conversely, variants at positions 603 and 694 disproportionately lead to resistance to NDI-034858 (Figure 3F), and these sites have been shown to provide key interactions between TYK2 and this compound (Leit et al., 2023). This analysis also highlights residues that are important for protein-drug interactions (e.g. residues 601, 640; Figure 3F) that have not previously been shown to participate in direct interactions with either compound. Collectively, these results demonstrate that DMS comprehensively identifies variants that lead to drug resistance and provides an important layer of functional insight into protein-drug interactions that complements static structural data.

Lastly, we performed IFN-α signaling DMS assays at lower concentrations (IC75) of both inhibitors to identify variants that potentiate, or improve, the effect of the compounds (see Materials and methods for details). In total, we identified 35 variants that increased inhibitor activity, including 10 that uniquely potentiate BMS-986202, 13 that uniquely potentiate NDI-034858, and 6 that potentiate both compounds (Figure 3H–J, Figure 3—figure supplement 1D). While there was some positional overlap between variants that led to resistance or potentiation (e.g. compare position 758 results for NDI-034858 in Figure 3F and I), the distributions were largely unique (Figure 3F–G and I–J). Interestingly, there are three positions (residues 603, 694, and 739) where drug-potentiating variants of one drug occur at a position where there exists a known interaction with the other drug (Figure 3I, red boxes). For example, N739 forms a known interaction with BMS-986202, and mutation of this residue to H or M increases the activity of NDI-034858. The converse is true of positions 603 and 694. By capturing potentiation at positions where a unique protein-drug interaction exists for just one compound, DMS reveals that there is capacity to recreate similar interactions with other small molecules. Traditional small-molecule drug design employs SAR of small molecules, testing how iterative changes to a small molecule alter the function of a target. Our data captures the functional consequence of making changes to the protein instead, performing inverse SAR to highlight key residues on the target to exploit for drug design. Findings such as these suggest that DMS data can be used to identify novel protein-drug interactions that could be reverse engineered into small molecules to increase compound potency, potentially saving time by reducing the number of iterations in the design process.

Variants that protect against autoimmune disease reduce TYK2 abundance

Our TYK2 DMS experiments measure the effects of all common and rare human missense and nonsense variants on TYK2 signaling and abundance. This allows us to comprehensively assess how changes in TYK2 function relate to susceptibility to immune phenotypes, which could point to specific therapeutic modalities to prioritize in future TYK2 drug discovery programs. To this end, we examined how altering TYK2’s IFN-α signaling function or protein abundance relates to risk of autoimmunity.

We first focused on P1104A (rs34536443), the most well-characterized of the common TYK2 variants, which has been shown to be protective broadly against autoimmune phenotypes (International Multiple Sclerosis Genetics Consortium, 2013; Dendrou et al., 2016; Ban et al., 2009). Using genotype-phenotype information for a cohort of more than 1 million total individuals (from UK Biobank, FinnGen, and other sources), we performed a phenome-wide association study (PheWAS) and independently confirmed that this allele is protective against many autoimmune diseases (Figure 4A, Figure 4—figure supplement 1A; see Materials and methods and Supplementary file 2 for full list of data sources). While P1104A has been reproducibly shown to reduce TYK2 signaling through the interleukin-23 (IL-23) pathway (Dendrou et al., 2016; Boisson-Dupuis et al., 2018), its effect on IFN-α signaling has been inconsistent in the literature. Some studies report that it reduces IFN-α signaling activity (Dendrou et al., 2016) and others report no effect (Boisson-Dupuis et al., 2018). P1104A showed no significant effect on TYK2 activity in our IFN-α assay (FDR>0.01). This does not preclude there being an effect of the variant on IFN-α signaling in other conditions not tested here, but it does support hypotheses that P1104A has a lower impact on interferon than interleukin signaling pathways (Boisson-Dupuis et al., 2018). Although it showed no effect on interferon signaling, P1104A did, interestingly, result in significantly lower TYK2 protein abundance in our DMS assay (Figure 4B; FDR<2.2E-16).

Figure 4 with 3 supplements see all
Human variants that protect against autoimmune disease reduce TYK2 abundance.

(A) Odds ratios from comprehensive phenome-wide association study (PheWAS) for the TYK2 P1104A allele (see Materials and methods), which confirm protective effect on many autoimmune phenotypes (see Supplementary file 2 for list of phenotype abbreviations). (B) Deep mutational scanning (DMS) results for the interferon alpha (IFN-α) (x-axis) and protein abundance (y-axis) assays, as in Figure 2B. Each point represents a unique missense or nonsense variant, and P1104A is highlighted in blue. GOF, gain-of-function; LOF, loss-of-function; WT, wild-type. (C) TYK2 protein abundance measured using western blotting of HEK293T and Kit225 cells harboring the wild-type (WT, gray) and P1104A (blue) alleles of TYK2. Data are shown normalized by the abundance of the WT allele for each cell type. Bars represent means, with error bars reporting standard error, and p-values determined by unpaired t-test. (D) Effect sizes (beta) of association between P1104A allele and abundance of three proteins in human plasma from UK Biobank. Error bars are 95% confidence intervals. (E) Rare variant dose-response curve for TYK2 variants found in the UK Biobank shows that TYK2 protein abundance (x-axis, from DMS assay) predicts the probability of autoimmune disease diagnosis (y-axis). See Materials and methods for details. Gray shading indicates 95% confidence intervals.

The protein abundance DMS assay reports a relative, rather than absolute, effect on abundance and uses an engineered reporter. Therefore, we sought to validate this finding in several ways. First, we individually cloned and tested P1104A and a panel of other TYK2 alleles using the protein abundance reporter used for the DMS (see Materials and methods). Consistent with the DMS library results, FACS of the individual P1104A cell line validated that the allele led to lower normalized reporter signal than WT (Figure 4—figure supplement 1B; mean GFP:BFP signal for P1104A: 0.92; for WT: 1.16; p<0.0001 by Welch’s t-test, n=435,000 and 353,342 cells, respectively). Next, we integrated WT and P1104A TYK2, with no additional protein tags, under the control of a constitutive promoter in single copy at the H11 landing pad locus of HEK293T cells (see Materials and methods). Western blot analyses of these lines showed that P1104A resulted in an ~25% reduction in TYK2 abundance relative to WT (Figure 4C, p=0.0202 by unpaired t-test). Third, we used CRISPR/Cas9 engineering to generate a Kit225 cell line harboring the P1104A allele in homozygosity at the endogenous TYK2 locus (Figure 4—figure supplement 1C, see Materials and methods). Western blotting showed that the P1104A allele resulted in ~10% lower TYK2 protein abundance than WT in Kit225 cells (Figure 4C, Figure 4—figure supplement 1D, p=0.0464 by unpaired t-test). Finally, we used a protein quantitative trait loci (pQTL) map within the UK Biobank (Sun et al., 2023) to explore if P1104A (rs34536443) is associated with reduced abundance of any proteins in human plasma (see Materials and methods). The abundance of TYK2 itself was not directly measured in this dataset, but P1104A is significantly associated with the reduced abundance of several proteins that were measured, including the interleukin receptor IL12RB1 and the interferon receptor IFNAR1 (Figure 4D, Figure 4—figure supplement 1E, p<5e-08, genome-wide significance via pQTL mapping as reported by UK Biobank-Pharma Proteomics Project [UKB-PPP]). These proteins are the two most significant pQTL associations for P1104A and are the receptors that directly interface with TYK2 in the IL-12/IL-23 and IFN-α signaling pathways, respectively (Muromoto et al., 2022). Loss of TYK2 is well established to lead to reduced localization of both receptors at the cell surface (Kreins et al., 2015). Collectively, these results support that the P1104A allele, which is protective for autoimmunity, leads to a modest but significant reduction of TYK2 abundance in both engineered cell lines and humans.

A second common missense variant in TYK2 that changes the isoleucine at position 684 to serine (I684S; rs12720356) is also associated with a variety of autoimmune phenotypes. Its association is more complex than P1104A, providing protection against some phenotypes and risk to others (Dendrou et al., 2016), which we confirmed through the independent PheWAS validation described above (Figure 4—figure supplement 1A). Like P1104A, I684S has no significant effect on IFN-α signaling in our DMS assay (FDR>0.01) but does negatively impact protein abundance (FDR<2.2E-16) (Figure 4—figure supplement 1F). This variant is also a significant pQTL for abundance of IL12RB1 and IFNAR1 in human serum (Figure 4—figure supplement 1E, p<5e-08). Similarly to P1104A, these results support that common missense variants in TYK2 that are associated with autoimmune phenotypes lead to reduced TYK2 abundance.

Finally, we assessed if rare human TYK2 variants that decrease IFN-α signaling or protein abundance show analogous protection against autoimmune phenotypes. Using autoimmune phenotype and TYK2 genotype information from the UK Biobank, along with the DMS data described above, we constructed genetic dose-response curves (Plenge et al., 2013) comparing TYK2 function (either IFN-α signaling or protein abundance) with the probability of having an autoimmune phenotype (see Materials and methods for details). This uncovered a quantitative dose-related relationship between the probability of autoimmune disease and TYK2 abundance, but not IFN-α signaling function (Figure 4E, Figure 4—figure supplement 2). In other words, reduced TYK2 abundance provides subtle but significant protection against developing autoimmune disease (Figure 4E, p=0.006, Supplementary file 3). Collectively, these results support that both common and rare sequence variants that reduce the abundance of TYK2 protein confer protection against autoimmune phenotypes. This strongly suggests that therapies, such as targeted protein degraders, that specifically reduce the abundance of TYK2 would be effective for the treatment of autoimmune diseases.

Discussion

Over the last decade, DMS has become a powerful technology for elucidating protein structure-function relationships and human variant interpretation. As such, it has substantial potential to improve many stages of drug discovery and development. However, this potential has yet to be fully realized because it requires highly quantitative methods that are directly relevant to the mechanisms underlying specific human phenotypes. In previous work, we described the development of quantitative DMS assays and analysis methods for GPCR proteins (β2AR and MC4R) and showed how they can elucidate structure-function relationships for the targets and their interactions with both native and novel agonists (Jones et al., 2020; Howard et al., 2025). In this study, we meaningfully extend these methods to another important target class for drug discovery (kinases) and uncover key insights into the biology of TYK2, a critical new target for the treatment of autoimmune disease.

First, we show how integrating DMS assays for multiple distinct functions (cytokine signaling and protein stability) can distinguish sites on TYK2 with important functional activities, such as allosteric regulation and protein-protein interaction. The ability to systematically map functionally critical protein regions and residues can influence early stages of drug discovery, where these data can be combined with structural insights to define relevant surfaces on the protein for drug targeting. Our DMS datasets successfully mapped the binding sites of small-molecule allosteric inhibitors of TYK2 and distinguished subtle differences in protein-drug interactions at the amino acid level. These experiments capture the functional consequence of protein changes on drug activity, which serves as a valuable complement to traditional SAR-based methods where the protein is kept static and the small-molecule design is iteratively changed. Such insights could be used to streamline compound optimization. Finally, we discovered that human TYK2 variants that protect against autoimmune disease, including the common P1104A variant and many rare variants of previously unknown function, are associated with reduced TYK2 protein abundance. This finding strongly suggests that therapies designed to reduce TYK2 protein levels, such as targeted protein degraders, could be particularly effective for treating autoimmune diseases.

Collectively, this work demonstrates that high-quality DMS data leads to actionable therapeutic insights that span multiple critical stages of drug discovery: defining a desirable pharmacological profile, identifying functionally relevant sites of action to target, and elucidating SAR to guide chemical optimization. The ability to inform drug discovery and development at multiple stages highlights the value of DMS as a tool for integrating structural, biochemical, and genetic information toward the development of better therapies. As DMS technology continues to improve, it will increasingly provide actionable insights for drug discovery and precision medicine.

Materials and methods

Key resources table
Reagent type (species) or resourceDesignationSource or referenceIdentifiersAdditional information
Gene (Homo sapiens)TYK2UniProtUniProt:P29597
Genetic reagentIFN-α signaling DMS reporterThis studyISRE-minP-luciferase barcoded reporter with doxycycline-inducible TYK2
Genetic reagentProtein abundance (VAMP-seq) DMS reporterThis studyGFP-TYK2-IRES-BFP-T2A-BSR reporter
Genetic reagent (H. sapiens)TYK2 knockout sgRNAsSynthegoGene Knockout Kit v2; sgRNA sequences in Materials and methods
Genetic reagent (H. sapiens)STAT2 transgeneThis studyNCBI:NM_005419.4Constitutive expression under EF1A promoter; piggyBac integration
Genetic reagent (H. sapiens)IRF9 transgeneThis studyNCBI:NM_006084.5Constitutive expression under EF1A promoter; piggyBac integration
Genetic reagentP1104A HDR ssODN donorIDTAltR end-modifications; sequence in Materials and methods
Cell line (H. sapiens)HEK293TATCC, this studyH11 landing pad; TYK2 knockout
Cell line (H. sapiens)Kit225JCRBIL-2-dependent human T-cell line
Recombinant DNA reagentTYK2 DMS variant librariesThis paperBarcoded variant libraries for signaling and abundance assays; see Materials and methods
Sequence-based reagentDNA oligo pools (variant libraries)Twist Bioscience~270 bp oligos encoding all single amino acid substitutions; see Materials and methods
AntibodyRabbit anti-TYK2AbcamCat#:ab223733; no RRID registered(1:500)
AntibodyMouse anti-GAPDH (1A10)Novus BiologicalsCat#:NBP1-47339; RRID:AB_3212111(1:10,000)
AntibodyIRDye 800CW Goat anti-Rabbit IgGLI-CORCat#:926-32211; RRID:AB_621843(1:15,000)
AntibodyIRDye 800CW Goat anti-Mouse IgGLI-CORCat#:926-32210; RRID:AB_621842(1:15,000)
Peptide, recombinant proteinHuman IFN-alpha 2aPBL Assay ScienceCat#:11100Cytokine
Peptide, recombinant proteinHuman IL-2Thermo FisherCat#:PHC0023Cytokine
Peptide, recombinant proteinPyogenes HiFi Cas9 V3IDTCRISPR RNP editing of Kit225 cells
Chemical compound, drugBMS-986202MedChemExpressCat#:HY-131968; CAS:1771691-34-9TYK2 pseudokinase domain inhibitor
Chemical compound, drugNDI-034858 (TAK-279/Zasocitinib)MedChemExpressCat#:HY-150096; CAS:2272904-53-5TYK2 pseudokinase domain inhibitor
Chemical compound, drugDoxycycline hyclateApexBioCat#:A4052; CAS:24390-14-5
Chemical compound, drugBlasticidin S HClGibcoCat#:A1113903
Commercial assay or kitLipofectamine CRISPRMAXInvitrogenCat#:CMAX00015RNP transfection
Commercial assay or kitQuick-DNA KitZymoCat#:D3024Genomic DNA extraction
Commercial assay or kitZR-96 PCR KitZymoCat#:D402496-Well genotyping
Commercial assay or kitClonaCellSTEMCELL TechnologiesCat#:03814Isoclonal cell line generation
Commercial assay or kitDNeasy Blood and Tissue KitQIAGENCat#:69504Genomic DNA extraction
Commercial assay or kitEZ-PCR Mycoplasma Detection KitSartoriusCat#:20-700-20Mycoplasma testing
Commercial assay or kitRapid Gold BCA Protein Assay KitPierceCat#:A53225Protein quantification
Software, algorithmCustom R/analysis codehttps://github.com/octantbio/bms-dms; Abell et al., 2026
Software, algorithmUCSF ChimeraXPettersen et al., 2021RRID:SCR_015872Molecular visualization
Software, algorithmFiji/ImageJSchindelin et al., 2012RRID:SCR_002285Densitometry and image analysis
Software, algorithmFlowJoBD BiosciencesRRID:SCR_008520Flow cytometry analysis
Software, algorithmREGENIEMbatchou et al., 2021Association testing
Software, algorithmGCTA-COJOYang et al., 2011Conditional analysis
Software, algorithmSuSIEWang et al., 2020Fine-mapping
Software, algorithmEnsembl VEPMcLaren et al., 2016RRID:SCR_007931Variant annotation
Software, algorithmCRISPR-DAVWang et al., 2020CRISPR NGS data analysis
Software, algorithmR SKAT-OLee et al., 2012Variance component test
Software, algorithmR AllelicSeriesMcCaw et al., 2023Allelic series association test
Software, algorithmSynthego ICE AnalysisSynthegoCRISPR editing efficiency
Software, algorithmBioRenderBioRender.comFigure generation
Software, algorithmAlphaMissenseCheng et al., 2023
Software, algorithmClinVarLandrum et al., 2025RRID:SCR_006169
Software, algorithmbcl2FastqIllumina
OtherTYK2 DMS raw FASTQ filesThis studyNCBI BioProject: PRJNA1291213SRA
OtherTYK2 DMS barcode maps and read countsThis studyZenodo: 15347448
OtherTYK2 IFN-α signaling DMS scoresThis studyMaveDB: urn:mavedb:00001270a
OtherTYK2 abundance DMS scoresThis studyMaveDB: urn:mavedb:00001271a
OtherUK BiobankSun et al., 2023; Bycroft et al., 2018Genetic and proteomic data
OtherFinnGenKurki et al., 2023PheWAS; GWAS summary statistics

Reporter design and optimization

Request a detailed protocol

The IFN-α signaling reporter was adapted from DMS assays used previously for GPCR signaling (Jones et al., 2020; Howard et al., 2025) that employ RNA sequencing of transcriptional reporters to assess variant effects. Briefly, the plasmid design for this system was modified to include a doxycycline-inducible TYK2 allele transgene upstream of an eight-copy ISRE (Levy et al., 1988), which was followed by the Promega minimal promoter (minP) and a luciferase reporter gene harboring a unique DNA sequence barcode in the 3’ untranslated region.

The protein abundance reporter was modified from the previously described VAMP-seq reporter system (Matreyek et al., 2018). This system, which uses a polycistronic construct containing an amino-terminal GFP-tagged target protein (in this case TYK2) and a second fluorescent protein to normalize protein abundance to transcription levels, employs FACS and DNA sequencing to assess variant effects. We made three primary design modifications to this system. First, the abundance reporter was integrated into a landing pad site engineered at the H11 safe-harbor locus to include a CAG promoter (Jones et al., 2020), rather than a doxycycline-inducible Tet promoter, leading to constitutive expression of the reporter. Second, we used a co-transcriptionally linked BFP instead of mCherry for normalization, as our base cell line already expressed mCherry. An internal ribosome entry site (IRES) allowed for independent translation of the BFP from the shared reporter transcript. Finally, the full-length reporter plasmid included a Blasticidin resistance gene (BSR) transcriptionally linked to the BFP by a self-cleaving T2A peptide (GFP-TYK2-IRES-BFP-T2A-BSR) so that Blasticidin selection, rather than FACS, could be used to remove cells without the reporter construct integrated correctly into the safe-harbor locus.

Base cell line generation

Request a detailed protocol

All copies of the TYK2 gene were knocked out in HEK293T cells harboring a single-copy Bxb1 recombination-based landing pad at the H11 locus (Howard et al., 2025) using a CRISPR multi-guide RNA deletion strategy with reagents from Synthego (Gene Knockout Kit v2). sgRNA sequences were as follows: sgRNA1- 5’-CCACUGUCCCGGAUGUAGCA-3’; sgRNA2: 5’-CACACGCUCUGUGCCGAAGC-3’; sgRNA3: 5’-UUUGACCAUGACCAUCUGCU-3’. Guide RNAs were mixed with Cas9 protein to form ribonucleoproteins (RNPs), which were then transfected into cells using Lipofectamine CRISPRMAX reagents (Invitrogen). Knockout efficiency was measured at both 7 and 19 days post-transfection (passages 1 and 6, respectively) by performing PCR with validation primers (FWD: 5’-AACACAGAAACCCACCCCAG-3’; REV1: 5’-CCCAGCTTCAAGGACTGCAT-3’; REV2: 5’-CTCCTTCCGCCGGCATATC-3’) on genomic DNA extracted from pools of transfected cells (Zymo Quick-DNA, #D3024). The presence of multiple laddered bands in treated cells confirmed successful editing at the TYK2 locus. Sanger sequencing was also performed on the PCR products, and Synthego’s ICE analysis tool was used to confirm an editing efficiency of 80% or greater for both the positive control and pooled TYK2 knockout transfections. Isoclonal cell lines were obtained by seeding the edited cell pool into ClonaCell (STEMCELL Technologies, #03814) in a 10 cm dish. Cells were grown for 20 days, and then single colonies were picked into a 96-well plate in Dulbecco’s Modified Eagle Medium (DMEM; Gibco)+10% dialyzed fetal bovine serum (FBS; Gibco). Isoclonal cultures were grown for an additional 2–3 weeks, during which two rounds of genotyping were performed by Sanger sequencing to confirm gene editing (using the primers listed above and the Zymo ZR-96 PCR kit, #D4024). In sequence-validated isoclones, western blotting was used to validate that no TYK2 protein was produced, further confirming editing of all copies of TYK2 (see Western blotting section, below, for detailed methods). Finally, isoclonal cell lines were tested by luciferase assays using transient delivery of the IFN-α reporter plasmid described above (see Reporter design and optimization) and plasmids containing transgenes for STAT2 and IRF9, which are required for IFN-α but not expressed in HEK293T cells. The best knockout cell line was chosen for a combination of low background activity in transient reporter assays and healthy growth characteristics.

We then engineered IFN-α signaling activity into the TYK2 knockout cell line by performing stable piggyBac transposon-based integration of separate plasmids constitutively expressing the STAT2 and IRF9 genes under the control of the EF1A promoter (NM_005419.4 and NM_006084.5, respectively). The resulting cells were then isocloned as described above. Clonal lines were tested for signaling assay efficiency by Bxb1-mediated integration of the IFN-α reporter constructs described above (see Reporter design and optimization) into the H11 landing pad locus. With this reporter system, stimulation of cells with IFN-α cytokine leads to TYK2-dependent phosphorylation of STAT1 and STAT2 proteins, followed by transcriptional activation of the ISRE by the STAT1/2-IRF9 complex. The reconstitution line with the best signal-to-noise ratio for TYK2-dependent activation (determined by calculating Cohen’s d and Z-factor scores of luciferase luminescence with and without doxycycline induction of TYK2) was chosen as the base cell line for all DMS libraries (Figure 1—figure supplement 1A).

DMS library generation and barcode mapping

Request a detailed protocol

DMS plasmid and cell libraries for both assay types were generated as previously described (Jones et al., 2020; Howard et al., 2025). In brief, the TYK2 coding sequence (P29597) was first divided into 17 segments (‘sub-libraries’) of ~210 base pairs (bp), and pools of ~270 bp long DNA oligos (Twist Bioscience) were designed to encode every possible single amino acid substitution to the TYK2 coding sequence. Each TYK2 coding segment was amplified from the DNA oligo pools and cloned into base vectors through a multi-step process to yield pooled libraries of TYK2 variants with fully intact and barcoded reporter gene cassettes (see Supplementary file 4 for all amplification and sequencing primers used in this process). First, DNA barcodes were appended to variant alleles during the initial amplification step of each of the 17 oligo sub-libraries at sufficient scale to yield many unique barcodes per variant. These variant-barcode-linked PCR amplicons were cloned into sub-library specific destination plasmids. After this first step of cloning, variant segments were amplified, along with the associated barcode, and sequenced with 2×150 paired-end reads on an Illumina NextSeq 2000 instrument using a 300-cycle P3 kit. Sequencing data was de-multiplexed, and variant-barcode associations were mapped as previously described (Howard et al., 2025). A second cloning step was performed to integrate the missing piece of the reporter plasmid between the variant allele and barcode, resulting in fully assembled plasmid libraries. These were then co-transfected with a plasmid encoding Bxb1 recombinase, into the HEK293T cell line described above, and properly targeted cells were selected with 10 µg/mL Blasticidin (Gibco) for ~14 days. This resulted in a library of HEK293T cells, with each cell containing a single TYK2 allele-barcode combination integrated in single copy in a landing pad at the H11 safe-harbor locus.

DMS assay execution and sequencing

Request a detailed protocol

IFN-α signaling experiments were performed in triplicate as described for previous transcriptional DMS reporters (Howard et al., 2025) with some modifications: DMS cell libraries were seeded at ~19E6 cells per 150 mm tissue-culture-treated dish for each assay replicate. TYK2 expression was induced 24 hr later by replacing media with 24 mL DMEM+0.5% dialyzed FBS±1 µM doxycycline (ApexBio). Signaling was induced 24 hr later by adding human Interferon-Alpha 2a cytokine (‘IFN-α’, PBL Assay Science #11100, see Table 1 for concentrations used for each experiment). For experiments involving TYK2 inhibitors (MedChemExpress), a pre-drugging phase was introduced after overnight doxycycline induction where media was replaced with DMEM+0.5% dialyzed FBS, ±drug for 1 hr, followed by an exchange into DMEM+0.5% dialyzed FBS, ±cytokine, ±drug. Six hours after cytokine stimulation, cells were harvested by scraping in 4 mL Lysis Buffer (RLT buffer [QIAGEN]+143 mM β-ME). Cells were lysed, RNA was extracted from 1 mL of the homogenized lysate, and reverse transcription was performed on the extracted RNA using SuperScript IV Reverse Transcriptase (Invitrogen, #18091050). cDNA from each sample was treated with 3.2 µL RNase A (100 µg/mL, Thermo Fisher) and 8 µL RNase H (5000 U/mL, NEB) at 37°C for 30 min, followed by concentration to ~50 µL by spinning through Amicon Ultra 10 kDa concentrators (EMD Millipore, #UFC5010) for ~8 min.

The TYK2 protein abundance DMS assay was performed by adapting the VAMP-seq technique (Matreyek et al., 2018), with modifications as follows. Before performing the assay, the DMS HEK293T cell sub-libraries were bottlenecked to reduce barcode complexity to ~20 barcodes per variant by seeding ~200,000 cells from each sub-library into a single well of a 12-well plate followed by expansion. At the beginning of the assay, the bottlenecked sub-libraries were pooled, and each assay replicate was seeded with enough cells to achieve at least 7E6 cells per sub-library. Three assay replicates were seeded and independently sorted via FACS on 3 different days. Prior to sorting, cultures were harvested in log-phase and resuspended in cold DMEM+10% dialyzed FBS at a density of ~10E6 cells/mL. Cell slurry was passed through a 35 µm snap-cap filter into a 5 mL tube (Corning, #352235) 1 mL at a time to remove cell clumps and debris and then kept on ice until flow cytometry. Flow sorting was performed on a Sony MA900 using a 100 µm sorting chip. Control HEK293T cell lines (background reporter, BFP-only, and GFP-only) were first used to establish appropriate gates for forward scatter (FSC; single cells and no debris), back scatter (BSC; live cells), and fluorescence dynamic range for both BFP and GFP. Then, ~100,000 cells from the pooled DMS library were flowed, and the fluorescence distribution was used to generate polygonal gates that divided the population into equal quartiles based on the GFP:BFP fluorescence ratio. These quartiles were assigned to the four collection bins, and 5 mL collection tubes containing 2 mL of DMEM+20% dialyzed FBS were placed in each bin. The complete library was sorted, regularly replacing collection tubes as needed and keeping sorted cells on ice, until ~25E6 cells per bin were collected. Sorted cells for each quartile bin were pooled into a 50 mL conical, spun for 5 min at 300×g, and resuspended in 1.2 mL PBS. DNA was extracted from cells with the DNeasy Blood and Tissue extraction kit (QIAGEN, #69504) using one purification column for every 5E6 cells. After the addition of Buffer AL and ethanol, a shearing step that involved passing cell slurry 5× through an 18G syringe needle was performed to increase lysis before proceeding with genomic DNA extraction.

Both the IFN-α and abundance DMS libraries were assayed in biological triplicate and prepared for sequencing as previously described, with minor modifications (Howard et al., 2025). In brief, qPCR was performed on 1 µL DNA (diluted 1:8 in water to avoid late-cycle assay inhibition) with NEBNext Ultra II Q5 polymerase (NEB, #M0544L) and SYBR Green (Thermo Fisher, #S7563) (see Supplementary file 4 for qPCR amplification and sequencing primers described in this section). Illumina sequencing libraries were amplified with the same polymerase under the following cycling conditions: 98°C for 30 s, X cycles of [98°C for 10 s, 65°C for 75 s], followed by an extension of 65°C for 5 min. The number of amplification cycles for each sample was set to the respective Cq value determined by qPCR. Amplified products were purified with SPRI beads (Beckman Coulter, #B23317). An additional round of qPCR and library amplification was performed with secondary primers to append sequencing indices and further amplify the sample libraries. This secondary amplification was performed in duplicate for each biological replicate to account for potential PCR amplification or sequencing errors. To account for differences in library yields, 3 µL of each amplified DNA library sample was run on a 4% E-Gel (Thermo Fisher), and densitometry was performed using Fiji (Schindelin et al., 2012). Samples (i.e. from different replicates and assay conditions) were mixed at equimolar ratios into a single pool and then thoroughly purified by performing an SPRI-bead cleanup (1:1 ratio of beads:DNA, two 70% ethanol washes, and elution into 50 µL IDTE pH 8.0), agarose gel electrophoresis, and gel extraction (elution into 36 µL water), and then another SPRI-bead cleanup (3:1 ratio of beads:DNA, two 70% ethanol washes, and elution into 36 µL IDTE pH 8.0). The purified library was quantified using the DeNovix High-Sensitivity Fluorescence kit and prepared for sequencing with a 30% PhiX spike-in. The final library mixture was sequenced using custom read and index primers (Supplementary file 4) on an Illumina NextSeq 2000 with a 50-cycle P3 kit.

DMS primary variant effect analysis

Request a detailed protocol

Primary variant effect analysis of IFN-α signaling DMS experiments was performed as previously described (Howard et al., 2025). Briefly, the first 21 bp of each single-end read was extracted and joined to the previously generated variant-barcode map (see DMS library generation and barcode mapping), requiring a perfect barcode sequence match. The combined mapped counts across all samples were analyzed using the same negative binomial generalized linear mixed model as the previous work, fitting one model per position and incorporating all variant counts at that position, as well as all WT counts from the corresponding protein segment. Using this model, we extracted log2(fold change) estimates for all variants (relative to WT TYK2) and associated standard errors. Then, for each assay, we computed the linear contrast of each variant in each condition against that same variant in the untreated (no cytokine stimulation) condition, to obtain final variant effect estimates.

For abundance DMS analysis, we developed a new extension of our previous model that leveraged the multi-barcode library design to quantitatively capture the effect of variants on the FACS distribution of cells. We applied the same model as previously described (Howard et al., 2025), except using the four fluorescence bins (25/50/75/100) as the ‘condition’ and removing the offset. Then, for each variant, we computed a weighted average and standard error by simulating 1000 draws from a normal distribution, with mean and standard deviation defined by the estimate and standard error from the initial regression, respectively. This allowed us to compute a weighted average across all bins, as well as the corresponding standard error. The weights for each bin were specified as the midpoint of that bin (0.125/0.375/0.625/0.875). The resulting ‘midpoint’ estimates and standard errors were used for downstream analysis.

Orthogonal variant classification data

Request a detailed protocol

Variant effects for all reported TYK2 alleles available were downloaded from ClinVar (Landrum et al., 2025; Landrum et al., 2014) on January 9, 2025.

Classification of signaling-only LOF variants

Request a detailed protocol

To define TYK2 variants that affect signaling but not abundance, the 100 U/mL IFN-α signaling and protein abundance DMS datasets were merged and then filtered to identify variants that met both of the following criteria:

  1. Significant signaling LOF: log2(fold change of variant relative to WT) in IFN-α condition<0 and FDR(IFN-α condition)<0.05

  2. No statistically significant negative effect on Abundance: Abundance midpoint shift>0 or FDR(midpoint shift)>0.1

Identification of drug resistance and potentiation variants

Request a detailed protocol

To define TYK2 variants that conferred drug resistance or potentiation, drug-treated conditions (100 U/mL IFN-α stimulation+inhibitor, see Table 1) were assessed for variants that led to a significantly different drug-response relative to WT (FDR<0.01). For example, to define variants resistant to BMS-986202 inhibitor, we filtered for variants that were significantly more active than WT, indicating resistance to inhibition (Figure 3B–D). To define drug-potentiating variants, we filtered for the opposite: variants that had significantly less activity than WT at sub-maximal inhibitor doses (IC75), indicating a stronger response to the inhibitor. For potentiation profiling, drug-treatment conditions were normalized to the cytokine-stimulated condition without drug treatment to focus on drug-specific effects.

Data and code availability

Request a detailed protocol

Raw FASTQ files for each DMS assay sample are available on SRA in the BioProject with accession PRJNA1291213. Complete oligonucleotide-barcode maps for the DMS libraries, and mapped barcode-level read counts for each assay sample set, are available as tab-delimited text files on Zenodo at accession 15347448.

Code for data processing, statistical modeling, and summary statistics is available on GitHub at https://github.com/octantbio/bms-dms, copy archived at Abell et al., 2026. We provide one summary statistics file per dataset, with all variant effects in each condition, and a separate single file covering all assays containing the linear contrasts of each variant effect in each condition against the same variant in the untreated control. For the abundance dataset, we provide the raw variant effect summary statistics, as well as the post-processed ‘midpoint’ statistics.

Structural modeling

Request a detailed protocol

Molecular visualization of variant effects on TYK2 was performed with UCSF ChimeraX (Pettersen et al., 2021). For Figures 1C and 2D, the cryo-EM structure of the TYK2 kinase-pseudokinase domains (PDB: 4OLI) was used, and blue amino acid positions represent those with significant LOF variants. The full-length composite structure of TYK2 (Figure 2E) was generated from structures of TYK2(FERM-SH2)-IFNAR1 (PDB: 4PO6) and TYK2(kinase-pseudokinase) (PDB: 4OLI), using full-length JAK1-IFNAR1 (PDB: 7T6F) as a scaffold for the ChimeraX MatchMaker tool. For visualizing variant effects on protein-ligand interactions (Figure 3 and Figure 3—figure supplement 1), crystal structures of the inhibitor-bound pseudokinase domain were used (PDB: 6NZP and PDB: 8S9A), and residues were colored pink, cyan, or orange to denote association with BMS-986202, NDI-034858, or both, respectively.

GWAS and fine-mapping TYK2 signals

Request a detailed protocol

We analyzed the association of P1104A with autoimmune diseases, utilizing GWAS data aggregated together across a variety of sources, including the UK Biobank, FinnGen, and large studies reported in the literature (Supplementary file 2 lists all data sources for each phenotype) (Kurki et al., 2023; Bycroft et al., 2018; Langefeld et al., 2017; Tsoi et al., 2012; Okada et al., 2014; Liu et al., 2015; Patsopoulos et al., 2019; López-Isac et al., 2016; Betz et al., 2015). When multiple, non-overlapping studies were available, we performed inverse-variance fixed-effects meta-analyses to obtain the most robust effect size estimates for P1104A on the diseases. We selected autoimmune diseases for inclusion in our analysis based on the availability of well-powered GWAS. We additionally included cardiovascular diseases and several infectious diseases that could be utilized for safety considerations.

We conducted association testing with data from the UK Biobank to validate previous findings that common genetic variants in TYK2 are associated with autoimmune diseases (Dendrou et al., 2016). We initially selected variants for inclusion in our analysis, selecting high-quality common variants (imputation quality INFO score>0.8, minor allele frequency>0.01) at the TYK2 locus (including the 200 kb region surrounding TYK2). Using these variants, we conducted association analyses with the autoimmune traits in UK Biobank that have enough cases to perform a well-powered analysis, along with the pooled autoimmune trait. We used UK Biobank for this purpose due to the ability to utilize individual level data. The individual traits considered were PsO, RA, hypothyroidism (HT), inflammatory bowel disease (IBD), and UC. Covariates were the same as in our rare-variant analysis (first 10 principal components [PCs], sex, age). REGENIE was used for all association testing (Mbatchou et al., 2021).

Downstream of the association testing, we first dissected independent signals at the locus with conditional analysis, using the GCTA-COJO software (Yang et al., 2011). First, we used the 5×10–8 p-value threshold to obtain independent conditional signals in the investigated region. We then used the fine-mapping approach SuSIE (Wang et al., 2020) to confirm the most likely causal variants at these loci using probabilistic annotations. Furthermore, we conducted conditional analysis using a lowered threshold (p-values<5×10–5) to capture additional ‘suggestive’ signals and to shed light on potential signals that we were underpowered to detect.

Consistent with previous analyses (Dendrou et al., 2016), P1104A (rs34536443) was the most likely causal variant for the primary signal for PsO, RA, HT, and the pooled autoimmune trait (Figure 4—figure supplement 1A). It was also the most likely causal variant for a secondary suggestive signal for UC and IBD. Meanwhile, another missense variant, I684S (rs12720356), was identified as the most likely causal variant for the primary signal for IBD and UC, and the secondary signal for PsO. The directionality for I684S is opposite for PsO (protective) versus IBD/UC (risk), also consistent with previous reports (Dendrou et al., 2016). In addition to these, we see a secondary suggestive intronic signal for HT, with rs11085727 prioritized as the most likely causal variant here. It should also be noted that, while I684S does not come up as suggestively significant for RA, it barely misses the threshold (conditional p-value: 8×10–5).

UK Biobank genetic data

Request a detailed protocol

To build genetic dose-response curves (Plenge et al., 2013) with IFN-α and TYK2 protein abundance DMS data, we first identified rare human TYK2 missense or nonsense variants in the UK Biobank 450k whole exome sequencing dataset (Backman et al., 2021). We annotated variants using the Ensembl Variant Effect Predictor (VEP) (McLaren et al., 2016) and filtered to canonical transcript missense variants. We identified 447 rare protein-altering variants (MAF<0.01%) and used these variants to both calculate per individual DMS scores and perform rare variant analyses testing for an association of TYK2 with autoimmune disease.

UK Biobank phenotype data

Request a detailed protocol

We first filtered UK Biobank participants by excluding participants with outlier heterozygosity or missing rates, participants where submitted sex did not match genetically inferred sex, and participants with putative sex chromosome aneuploidy. Next, we subset to participants with British White ancestry and included only one individual per related pair. We then identified participants with PsO, RA, systemic lupus erythematosus, ankylosing spondylitis, primary biliary cirrhosis, UC, and Crohn’s disease by querying participants’ diagnosis data with a combination of ICD10 codes, general practice records, and PheCode definitions (Supplementary file 5). We pooled the participants with any endpoint diagnosis into a general TYK2-associated autoimmune disease cohort of 31,726 total cases to maximize association testing power. To generate an ‘unaffected’ control cohort, we started with the general quality control filtered set of participants in UK Biobank and excluded all participants with the autoimmune diagnoses listed above. This resulted in a control cohort of 308,674 participants.

Human variant analysis using DMS scores

Request a detailed protocol

We used the DMS IFN-α and protein abundance data to calculate a per-individual DMS score, analogous to a polygenic risk score where the variant effect size is its DMS scaled log2(fold change relative to WT) value. We calculated DMS scores for each participant (j) given their genotype (G) at each TYK2 variant (i) as:

DMS-Scorej=iNSiGij2Mj

where S denotes the scaled log2(fold change relative to WT) score for a variant and M denotes the total number of non-missing genotypes for TYK2 variants.

We aimed to test if DMS scores for variants that are rare in the human population could predict general autoimmune disease case status, and so we fit logistic regression models using the IFN-α and protein abundance DMS scores as predictors of disease case status. The common deleterious TYK2 missense variant rs34536443 (P1104A) is strongly associated with protection from various autoimmune diseases (Dendrou et al., 2016), and we anticipated that the effect of common variants in linkage disequilibrium with the rare variants used to construct the DMS score could confound the analysis. We used a conservative minor allele frequency filter (MAF<10–4) to control for these common variant haplotype effects, but we also explicitly included participant rs34536443 allele dosage as a covariate in the model in addition to including PCs 1–10, sex, and age. We fit a series of logistic regression models with increasing complexity, as well as a null model, including only covariates, and used Akaike information criterion to select the best fit model (see Supplementary files 3, 6–8 for model selection details and coefficients).

Rare variant association test

Request a detailed protocol

As a comparison to our novel DMS score association testing, we also employed traditional rare variant association analyses. We tested for associations using two methods that each assume different patterns of variant effects on the disease phenotype: a variance component test and allelic series test. We implemented the variance component tests with the R SKAT-O package (Lee et al., 2012) and the allelic series test with the R AllelicSeries package (McCaw et al., 2023). We included PCs 1–10, sex, and age as covariates in all rare variant association tests. We implemented all three association test approaches for each disease endpoint individually and for the general autoimmune disease super set.

The allelic series test requires variants to be categorized based on their predicted effect, as either benign missense variants, deleterious missense variants, or protein-truncating variants. We classified ‘missense variants’ in the allelic series test if the VEP consequence was missense variant, in-frame deletion, in-frame insertion, stop lost, start lost, or protein-altering. We classified protein-truncating variants as stop gained, splice acceptor variants, splice donor variants, or frameshift variants. To further subset missense variants, we classified variants as ‘benign’ if predicted to be ‘tolerated’ by SIFT or if they have a CADD Phred score less than or equal to 20. We classified variants as ‘deleterious’ if predicted to be ‘damaging’ by SIFT or if they have a CADD Phred score greater than or equal to 20. We further filtered protein-truncating variants to only include LOFTEE High Confidence predicted LOF.

Cell lines harboring individual alleles of TYK2 for variant effect validation

Request a detailed protocol

To confirm the effects of TYK2 variants on IFN-α signaling and protein abundance, individual variants were cloned and integrated into the H11 landing pad of our HEK293T reporter cell line following the same methods as DMS library integrations described above. N-terminally GFP-tagged TYK2 constructs were used to validate protein abundance effects by flow cytometry (Figure 4—figure supplement 1B). Untagged TYK2 constructs were used to validate protein abundance effects by western blotting (Figure 4—figure supplement 1D, Figure 4—figure supplement 3). Both tagged and untagged constructs had the same architecture as the abundance DMS reporter described above, with TYK2 expression driven by a CAG promoter.

FACS-based validation of protein abundance

Request a detailed protocol

Cell lines harboring a single copy of GFP-tagged TYK2 variants were grown to log-phase, harvested, and resuspended in cold DMEM+10% dialyzed FBS. Cell slurry was passed through a 35 µm snap-cap filter into a 5 mL tube (Corning, #352235) to remove cell clumps and debris and then kept on ice until flow cytometry. Cells were processed in the same manner as the protein abundance DMS experiment, collecting BFP and GFP signal per cell (but without subsequent cell collection). Approximately 600,000 events were collected for each sample, and FlowJo (BD Biosciences) was used to generate histograms of the GFP:BFP ratio of each sample (Figure 4—figure supplement 1B).

Engineering the P1104A allele into endogenous TYK2 of Kit225 cells

Request a detailed protocol

CRISPR RNP complexes containing an sgRNA with targeting sequence CTCCAGCCAGAGCCCCCCCA and Streptococcus pyogenes HiFi Cas9 protein V3 (IDT) were delivered to cells, along with an ssODN homologous-driven repair (HDR) donor (GGTATGCCCCAGAGTGCCTGAAGGAGTATAAGTTCTACTATGCGTCAGATGTCTGGTCCTTCGGGGTGACCCTGTATGAGCTGCTGACGCACTGTGACTCCAGCCAGAGCGCCCCCACGGTGAGAGCCAGGCCCGCAGCCCCACCGGGAG) (IDT) with ‘AltR’ end-modifications, using Nucleofection (Lonza) in solution SF with pulse code CA-137. Following several days of outgrowth, cells were single-cell cloned by limiting dilution in 96-well plates. The resulting clones were replicated and screened for knock-in by amplicon next-generation sequencing (NGS). Briefly, PCR primers TYK2-P1104-2F (5’-GCCTAGCCAATGAGCATATCAC-3’) and TYK2-P1104-2R (5’-TCTCTCTCCGTCCTGTCCTGTCTTA-3’) were used to amplify the targeted region out of genomic DNA lysates. Amplicons were purified using AMPure XP beads, and sequencing libraries were prepared using Illumina DNA Prep with Tagmentation. NGS libraries were pooled and sequenced on a MiSeq (Illumina) using 150 paired-end reads with dual indexes. Data was de-multiplexed using bcl2Fastq and run through the CRISPR-DAV analysis pipeline as previously described (Wang et al., 2017) with the HDR_NewBase parameter set to 10352442C (for the Chr19 change in the hg38 human reference genome) to specifically identify clones homozygous for the P1104A mutation. Kit225 cells were grown in RPMI 1640 (containing L-glutamine) with 10% FBS, 20 ng/mL human recombinant IL-2 (Thermo Fisher, #PHC0023).

Western blotting

Request a detailed protocol

For western blot experiments, cells in log-phase growth were harvested by lifting and washing 3× with cold PBS before freezing dry cell pellets at –80°C. Cell pellets were resuspended with 100 µL Lysis Buffer (RIPA, Thermo Scientific #89901; 1 µL Universal Nuclease, Pierce #88701; 1× Halt Protease and Phosphatase Inhibitor Cocktail, Thermo Scientific #78446) per 5E6 cells and lysed by incubation for 60 min on ice, vortexing every 10 min. Cell lysates were clarified by spinning for 10 min at 13,000 rpm and 4°C, and the resulting supernatant was quantified using a Rapid Gold BCA Protein Assay Kit (Pierce, #A53225). Lysate was diluted to 1–20 μg (depending on the experiment), and 5 μL of lysate sample was mixed with LDS Sample Buffer (Invitrogen, #B0007) and Reducing Agent (Invitrogen, #B0009) before heating at 95°C for 5 min. Denatured samples were loaded into 4–12% Bis-Tris Plus mini gels (Invitrogen, #NW04125BOX) and run at 120 V for 70 min in 1× MOPS Running Buffer (Invitrogen, #B0001). Protein was transferred to a PVDF membrane (pre-activated with methanol for 5 min) with pre-chilled 1× Running Buffer (Invitrogen, #BT0006) using a Mini Blot Module (Invitrogen, #B1000) run at 20 V for 70 min. Membranes were rinsed 3× with TBST (LI-COR, #927-65001) before blocking overnight in Blocking Buffer (LI-COR, #927-60001). The blocked membrane was cut just above loading control molecular weight (MW) band and incubated with primary antibodies diluted in TBST (1:500 rabbit anti-TYK2 [Abcam, #ab223733]); 1:10,000 mouse anti-GAPDH (Novus, #NBP1-47339) for 1 hr at 25°C on a rocker. Membranes were washed 3× with TBST before incubating with 1:15,000 dilutions of anti-rabbit or anti-mouse secondary antibody (LI-COR, #926-32211 and #926-32210) in TBST. Final washes with 3× TBST and 3× TBS were performed before imaging with an Odyssey System (LI-COR, #9120). Imaged blots were analyzed using Fiji (Schindelin et al., 2012). For each lane, the integrated density of the full-length TYK2 band was normalized to the integrated density of the GAPDH loading control. The average GAPDH-normalized value for the WT allele was set to 100% for each blot, and this average was used to compute the GAPDH-normalized relative expression of all TYK2 bands in the same blot (both WT and P1104A samples). Lanes were excluded from analysis if there were clear blemishes near bands of interest, no signal was detected for either band, or either TYK2 or GAPDH were outside of the linear range of detection (Figure 4—figure supplement 3).

Plasma pQTL association testing

Request a detailed protocol

We used data from the UKB-PPP (Sun et al., 2023) to detect proteins whose plasma levels are associated with variants predicted to be LOF for TYK2. To this end, we utilized the full pQTL mapping summary statistics from the UKB-PPP Consortium. Using the summary statistics for all 2936 proteins from the UKB-PPP Olink panel, we analyzed whether P1104A or I684S was implicated as a causal variant for each protein’s plasma levels.

We utilize a similar procedure as with the GWAS (see GWAS and fine-mapping TYK2 signals) to investigate causal variants, initially conducting conditional analysis for each protein to dissect conditionally independent signals at loci. The significance threshold for this analysis was at the 5E-08 level (genome-wide significance). Next, we used SuSIE (Wang et al., 2020) to confirm the prioritized variants corresponding to these signals.

Cell line validation

Request a detailed protocol

STR profiling performed by the University of California Berkeley DNA Sequencing Facility confirmed that cell lines used for DMS were HEK293-derived. Cell lines were verified as negative for mycoplasma contamination using the EZ-PCR Mycoplasma Detection Kit (Sartorius, #20-700-20).

Figure generation

Request a detailed protocol

The following figures were generated using BioRender: Figure 1A (initial schematics, which were further edited in other illustration software), Figure 2E (the lipid layer image only; the protein structure was generated using ChimeraX as described above).

Data availability

Raw FASTQ files for each DMS assay sample are available on SRA in the BioProject with accession PRJNA1291213. Complete oligonucleotide-barcode maps for the DMS libraries, and mapped barcode-level read counts for each assay sample set, are available as tab-delimited text files on Zenodo at accession 15347448. Results are available through MaveDB (accession numbers urn:mavedb:00001270-a and urn:mavedb:00001271-a). Code for data processing, statistical modeling, and summary statistics are available on GitHub at https://github.com/octantbio/bms-dms, copy archived Abell et al., 2026. We provide one summary statistics file per dataset, with all variant effects in each condition, and a separate single file covering all assays containing the linear contrasts of each variant effect in each condition against the same variant in the Untreated control. For the abundance dataset, we provide the raw variant effect summary statistics, as well as the post-processed "midpoint" statistics".

The following data sets were generated
    1. Howard CJ
    (2025) NCBI BioProject
    ID PRJNA1291213. Deep mutational scanning reveals pharmacologically relevant insights into TYK2 signaling and disease.
    1. Abell N
    (2026) MAVEdb
    ID urn:mavedb:00001270-a. Deep mutational scanning reveals pharmacologically relevant insights into TYK2 signaling and disease.
    1. Abell N
    (2026) MAVEdb
    ID urn:mavedb:00001271-a. Deep mutational scanning of >23,000 single amino acid substitutions across TYK2, measuring variant effects on IFN-α signaling and protein abundance in engineered HEK293T cells with and without pharmacological inhibition.
    1. Abell N
    2. Howard CJ
    (2025) Zenodo
    Deep mutational scanning reveals pharmacologically relevant insights into TYK2 signaling and disease.
    https://doi.org/10.5281/zenodo.15347448

References

    1. Anonymous
    (2022)
    Efficacy and safety of deucravacitinib, an oral, selective tyrosine kinase 2 inhibitor, in patients with moderately to severely active ulcerative colitis: 12-week results from the phase 2 LATTICE-UC study
    Gastroenterology & Hepatology 18:6.
    1. Kurki MI
    2. Karjalainen J
    3. Palta P
    4. Sipilä TP
    5. Kristiansson K
    6. Donner KM
    7. Reeve MP
    8. Laivuori H
    9. Aavikko M
    10. Kaunisto MA
    11. Loukola A
    12. Lahtela E
    13. Mattsson H
    14. Laiho P
    15. Della Briotta Parolo P
    16. Lehisto AA
    17. Kanai M
    18. Mars N
    19. Rämö J
    20. Kiiskinen T
    21. Heyne HO
    22. Veerapen K
    23. Rüeger S
    24. Lemmelä S
    25. Zhou W
    26. Ruotsalainen S
    27. Pärn K
    28. Hiekkalinna T
    29. Koskelainen S
    30. Paajanen T
    31. Llorens V
    32. Gracia-Tabuenca J
    33. Siirtola H
    34. Reis K
    35. Elnahas AG
    36. Sun B
    37. Foley CN
    38. Aalto-Setälä K
    39. Alasoo K
    40. Arvas M
    41. Auro K
    42. Biswas S
    43. Bizaki-Vallaskangas A
    44. Carpen O
    45. Chen C-Y
    46. Dada OA
    47. Ding Z
    48. Ehm MG
    49. Eklund K
    50. Färkkilä M
    51. Finucane H
    52. Ganna A
    53. Ghazal A
    54. Graham RR
    55. Green EM
    56. Hakanen A
    57. Hautalahti M
    58. Hedman ÅK
    59. Hiltunen M
    60. Hinttala R
    61. Hovatta I
    62. Hu X
    63. Huertas-Vazquez A
    64. Huilaja L
    65. Hunkapiller J
    66. Jacob H
    67. Jensen J-N
    68. Joensuu H
    69. John S
    70. Julkunen V
    71. Jung M
    72. Junttila J
    73. Kaarniranta K
    74. Kähönen M
    75. Kajanne R
    76. Kallio L
    77. Kälviäinen R
    78. Kaprio J
    79. FinnGen
    80. Kerimov N
    81. Kettunen J
    82. Kilpeläinen E
    83. Kilpi T
    84. Klinger K
    85. Kosma V-M
    86. Kuopio T
    87. Kurra V
    88. Laisk T
    89. Laukkanen J
    90. Lawless N
    91. Liu A
    92. Longerich S
    93. Mägi R
    94. Mäkelä J
    95. Mäkitie A
    96. Malarstig A
    97. Mannermaa A
    98. Maranville J
    99. Matakidou A
    100. Meretoja T
    101. Mozaffari SV
    102. Niemi MEK
    103. Niemi M
    104. Niiranen T
    105. O Donnell CJ
    106. Obeidat ME
    107. Okafo G
    108. Ollila HM
    109. Palomäki A
    110. Palotie T
    111. Partanen J
    112. Paul DS
    113. Pelkonen M
    114. Pendergrass RK
    115. Petrovski S
    116. Pitkäranta A
    117. Platt A
    118. Pulford D
    119. Punkka E
    120. Pussinen P
    121. Raghavan N
    122. Rahimov F
    123. Rajpal D
    124. Renaud NA
    125. Riley-Gillis B
    126. Rodosthenous R
    127. Saarentaus E
    128. Salminen A
    129. Salminen E
    130. Salomaa V
    131. Schleutker J
    132. Serpi R
    133. Shen H-Y
    134. Siegel R
    135. Silander K
    136. Siltanen S
    137. Soini S
    138. Soininen H
    139. Sul JH
    140. Tachmazidou I
    141. Tasanen K
    142. Tienari P
    143. Toppila-Salmi S
    144. Tukiainen T
    145. Tuomi T
    146. Turunen JA
    147. Ulirsch JC
    148. Vaura F
    149. Virolainen P
    150. Waring J
    151. Waterworth D
    152. Yang R
    153. Nelis M
    154. Reigo A
    155. Metspalu A
    156. Milani L
    157. Esko T
    158. Fox C
    159. Havulinna AS
    160. Perola M
    161. Ripatti S
    162. Jalanko A
    163. Laitinen T
    164. Mäkelä TP
    165. Plenge R
    166. McCarthy M
    167. Runz H
    168. Daly MJ
    169. Palotie A
    (2023) FinnGen provides genetic insights from a well-phenotyped isolated population
    Nature 613:508–518.
    https://doi.org/10.1038/s41586-022-05473-8
    1. Patsopoulos NA
    2. Baranzini SE
    3. Santaniello A
    4. Shoostari P
    5. Cotsapas C
    6. Wong G
    7. Beecham AH
    8. James T
    9. Replogle J
    10. Vlachos IS
    11. McCabe C
    12. Pers TH
    13. Brandes A
    14. White C
    15. Keenan B
    16. Cimpean M
    17. Winn P
    18. Panteliadis I-P
    19. Robbins A
    20. Andlauer TFM
    21. Zarzycki O
    22. Dubois B
    23. Goris A
    24. Søndergaard HB
    25. Sellebjerg F
    26. Sorensen PS
    27. Ullum H
    28. Thørner LW
    29. Saarela J
    30. Cournu-Rebeix I
    31. Damotte V
    32. Fontaine B
    33. Guillot-Noel L
    34. Lathrop M
    35. Vukusic S
    36. Berthele A
    37. Pongratz V
    38. Buck D
    39. Gasperi C
    40. Graetz C
    41. Grummel V
    42. Hemmer B
    43. Hoshi M
    44. Knier B
    45. Korn T
    46. Lill CM
    47. Luessi F
    48. Mühlau M
    49. Zipp F
    50. Dardiotis E
    51. Agliardi C
    52. Amoroso A
    53. Barizzone N
    54. Benedetti MD
    55. Bernardinelli L
    56. Cavalla P
    57. Clarelli F
    58. Comi G
    59. Cusi D
    60. Esposito F
    61. Ferrè L
    62. Galimberti D
    63. Guaschino C
    64. Leone MA
    65. Martinelli V
    66. Moiola L
    67. Salvetti M
    68. Sorosina M
    69. Vecchio D
    70. Zauli A
    71. Santoro S
    72. Mancini N
    73. Zuccalà M
    74. Mescheriakova J
    75. van Duijn C
    76. Bos SD
    77. Celius EG
    78. Spurkland A
    79. Comabella M
    80. Montalban X
    81. Alfredsson L
    82. Bomfim IL
    83. Gomez-Cabrero D
    84. Hillert J
    85. Jagodic M
    86. Lindén M
    87. Piehl F
    88. Jelčić I
    89. Martin R
    90. Sospedra M
    91. Baker A
    92. Ban M
    93. Hawkins C
    94. Hysi P
    95. Kalra S
    96. Karpe F
    97. Khadake J
    98. Lachance G
    99. Molyneux P
    100. Neville M
    101. Thorpe J
    102. Bradshaw E
    103. Caillier SJ
    104. Calabresi P
    105. Cree BAC
    106. Cross A
    107. Davis M
    108. de Bakker PWI
    109. Delgado S
    110. Dembele M
    111. Edwards K
    112. Fitzgerald K
    113. Frohlich IY
    114. Gourraud P-A
    115. Haines JL
    116. Hakonarson H
    117. Kimbrough D
    118. Isobe N
    119. Konidari I
    120. Lathi E
    121. Lee MH
    122. Li T
    123. An D
    124. Zimmer A
    125. Madireddy L
    126. Manrique CP
    127. Mitrovic M
    128. Olah M
    129. Patrick E
    130. Pericak-Vance MA
    131. Piccio L
    132. Schaefer C
    133. Weiner H
    134. Lage K
    135. Compston A
    136. Hafler D
    137. Harbo HF
    138. Hauser SL
    139. Stewart G
    140. D’Alfonso S
    141. Hadjigeorgiou G
    142. Taylor B
    143. Barcellos LF
    144. Booth D
    145. Hintzen R
    146. Kockum I
    147. Martinelli-Boneschi F
    148. McCauley JL
    149. Oksenberg JR
    150. Oturai A
    151. Sawcer S
    152. Ivinson AJ
    153. Olsson T
    154. De Jager PL
    155. International Multiple Sclerosis Genetics Consortium
    156. ANZgene
    157. IIBDGC
    158. WTCCC2
    (2019) Multiple sclerosis genomic map implicates peripheral immune cells and microglia in susceptibility
    Science 365:eaav7188.
    https://doi.org/10.1126/science.aav7188

Article and author information

Author details

  1. Conor J Howard

    Octant, Inc, Emeryville, United States
    Contribution
    Conceptualization, Data curation, Formal analysis, Validation, Investigation, Visualization, Methodology, Writing – original draft, Project administration, Writing – review and editing
    Competing interests
    is affiliated with Octant, Inc. The author has no other competing interests to declare
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0001-5375-6248
  2. Nathan S Abell

    Octant, Inc, Emeryville, United States
    Contribution
    Conceptualization, Data curation, Software, Formal analysis, Validation, Investigation, Visualization, Methodology, Writing – original draft, Writing – review and editing
    Competing interests
    is affiliated with Octant, Inc. The author has no other competing interests to declare
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0003-1098-5395
  3. Robert R Warneford-Thomson

    Octant, Inc, Emeryville, United States
    Contribution
    Conceptualization, Data curation, Formal analysis, Validation, Investigation, Visualization, Methodology, Writing – original draft, Writing – review and editing
    Competing interests
    is affiliated with Octant, Inc. The author has no other competing interests to declare
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-4521-0568
  4. Eden Mahdavi

    Octant, Inc, Emeryville, United States
    Present address
    Department of Molecular and Cell Biology, University of California, Berkeley, Berkeley, United States
    Contribution
    Validation, Investigation, Visualization, Methodology
    Competing interests
    is affiliated with Octant, Inc. The author has no other competing interests to declare
  5. Alan L Su

    Octant, Inc, Emeryville, United States
    Present address
    Department of Chemical and Systems Biology, Stanford University, Stanford, United States
    Contribution
    Conceptualization, Data curation, Formal analysis, Investigation, Visualization, Methodology
    Competing interests
    is affiliated with Octant, Inc. The author has no other competing interests to declare
  6. Carmen Resnick

    Octant, Inc, Emeryville, United States
    Contribution
    Validation, Investigation, Methodology
    Competing interests
    is affiliated with Octant, Inc. The author has no other competing interests to declare
  7. Nabil Mohammed

    Octant, Inc, Emeryville, United States
    Present address
    Department of Bioinformatics, University of California, Los Angeles, Los Angeles, United States
    Contribution
    Software, Formal analysis, Investigation, Visualization
    Competing interests
    is affiliated with Octant, Inc. The author has no other competing interests to declare
  8. Erin M Thompson

    Octant, Inc, Emeryville, United States
    Contribution
    Conceptualization, Investigation, Methodology
    Competing interests
    is affiliated with Octant, Inc. The author has no other competing interests to declare
  9. Emily R Holzinger

    Bristol-Myers Squibb, New York, United States
    Contribution
    Data curation, Formal analysis, Investigation, Visualization, Methodology, Writing – original draft, Writing – review and editing
    Competing interests
    is affiliated with Bristol Myers Squibb. The author has no other competing interests to declare
  10. Katrina Catalano

    Bristol-Myers Squibb, New York, United States
    Contribution
    Data curation, Formal analysis, Investigation, Visualization, Methodology, Writing – original draft, Writing – review and editing
    Competing interests
    is affiliated with Bristol Myers Squibb. The author has no other competing interests to declare
  11. Abhay Hukku

    Bristol-Myers Squibb, New York, United States
    Contribution
    Data curation, Formal analysis, Investigation, Visualization, Methodology, Writing – original draft, Writing – review and editing
    Competing interests
    is affiliated with Bristol Myers Squibb. The author has no other competing interests to declare
  12. Gabriel A Mintier

    Bristol-Myers Squibb, New York, United States
    Contribution
    Resources, Writing – review and editing
    Competing interests
    is affiliated with Bristol Myers Squibb. The author has no other competing interests to declare
  13. Morgan MacKenzie

    Octant, Inc, Emeryville, United States
    Contribution
    Resources, Investigation, Methodology
    Competing interests
    is affiliated with Octant, Inc. The author has no other competing interests to declare
  14. Bryan L Jiang

    Octant, Inc, Emeryville, United States
    Contribution
    Resources, Validation
    Competing interests
    is affiliated with Octant, Inc. The author has no other competing interests to declare
  15. Dora Barbosa Rabago

    Octant, Inc, Emeryville, United States
    Contribution
    Resources, Methodology
    Competing interests
    is affiliated with Octant, Inc. The author has no other competing interests to declare
  16. Angela Chan

    Bristol-Myers Squibb, New York, United States
    Contribution
    Resources
    Competing interests
    is affiliated with Bristol Myers Squibb. The author has no other competing interests to declare
  17. Carolindah Ntimi

    Bristol-Myers Squibb, New York, United States
    Contribution
    Resources
    Competing interests
    is affiliated with Bristol Myers Squibb. The author has no other competing interests to declare
  18. Kaitlyn N Weiler

    Bristol-Myers Squibb, New York, United States
    Contribution
    Resources
    Competing interests
    is affiliated with Bristol Myers Squibb. The author has no other competing interests to declare
  19. Stephen C Wilson

    Bristol-Myers Squibb, New York, United States
    Contribution
    Conceptualization, Supervision, Funding acquisition, Project administration, Writing – review and editing
    Competing interests
    is affiliated with Bristol Myers Squibb. The author has no other competing interests to declare
  20. Joseph C Maranville

    Bristol-Myers Squibb, New York, United States
    Contribution
    Conceptualization, Supervision, Funding acquisition, Project administration, Writing – review and editing
    Competing interests
    is affiliated with Bristol Myers Squibb. The author has no other competing interests to declare
  21. Payal R Sheth

    Bristol-Myers Squibb, New York, United States
    Contribution
    Supervision, Funding acquisition, Project administration, Writing – review and editing
    Competing interests
    is affiliated with Bristol Myers Squibb. The author has no other competing interests to declare
  22. Robert M Plenge

    Bristol-Myers Squibb, New York, United States
    Contribution
    Conceptualization, Supervision, Funding acquisition, Project administration, Writing – review and editing
    Competing interests
    is affiliated with Bristol Myers Squibb. The author has no other competing interests to declare
  23. Sriram Kosuri

    Octant, Inc, Emeryville, United States
    Contribution
    Conceptualization, Supervision, Funding acquisition, Methodology, Writing – review and editing
    Competing interests
    is affiliated with Octant, Inc. The author has no other competing interests to declare
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-4661-0600
  24. Diane E Dickel

    Octant, Inc, Emeryville, United States
    Contribution
    Conceptualization, Supervision, Investigation, Visualization, Methodology, Writing – original draft, Project administration, Writing – review and editing
    For correspondence
    diane@octant.bio
    Competing interests
    is affiliated with Octant, Inc. The author has no other competing interests to declare
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0001-5497-6824

Funding

Bristol Myers Squibb

  • Sriram Kosuri

This work was funded by Bristol Myers Squibb (BMS) as part of a collaborative partnership project with Octant, Inc.. BMS employees are listed as co-authors and contributed to study design, data collection and analysis, interpretation of results, and preparation of the manuscript.

Acknowledgements

Molecular graphics and analyses were performed with UCSF ChimeraX, developed by the Resource for Biocomputing, Visualization, and Informatics at the University of California, San Francisco.

Ethics

Human subjects: This work involved use of UK Biobank data, which was approved under application #26041.

Version history

  1. Sent for peer review:
  2. Preprint posted:
  3. Reviewed Preprint version 1:
  4. Version of Record published:

Cite all versions

You can cite all versions using the DOI https://doi.org/10.7554/eLife.110149. This DOI represents all versions, and will always resolve to the latest one.

Copyright

© 2026, Howard et al.

This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.

Metrics

  • 2,480
    views
  • 180
    downloads
  • 0
    citations

Views, downloads and citations are aggregated across all versions of this paper published by eLife.

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Open citations (links to open the citations from this article in various online reference manager services)

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

  1. Conor J Howard
  2. Nathan S Abell
  3. Robert R Warneford-Thomson
  4. Eden Mahdavi
  5. Alan L Su
  6. Carmen Resnick
  7. Nabil Mohammed
  8. Erin M Thompson
  9. Emily R Holzinger
  10. Katrina Catalano
  11. Abhay Hukku
  12. Gabriel A Mintier
  13. Morgan MacKenzie
  14. Bryan L Jiang
  15. Dora Barbosa Rabago
  16. Angela Chan
  17. Carolindah Ntimi
  18. Kaitlyn N Weiler
  19. Stephen C Wilson
  20. Joseph C Maranville
  21. Payal R Sheth
  22. Robert M Plenge
  23. Sriram Kosuri
  24. Diane E Dickel
(2026)
Deep mutational scanning reveals pharmacologically relevant insights into TYK2 signaling and disease
eLife 15:RP110149.
https://doi.org/10.7554/eLife.110149.2

Share this article

https://doi.org/10.7554/eLife.110149