1. Cancer Biology
  2. Cell Biology

Slap restricts oncogenic Src-family kinase signaling to maintain colonic epithelial homeostasis

  1. Dana Naim
  2. Zouheir Houhou
  3. Florent Cauchois
  4. Kevin Espie
  5. Valerie Simon
  6. Yvan Boublik
  7. Francina Langa Vives
  8. Zeinab Homayed
  9. Conception Paul
  10. Morgan Maillard
  11. Michael Hahne
  12. Julie Pannequin
  13. Julie Nguyen
  14. Audrey Sirvent  Is a corresponding author
  15. Serge Roche  Is a corresponding author
  1. CRBM, Univ. Montpellier, CNRS, France
  2. Equipe labellisée FRM2023, CRBM, Univ. Montpellier, CNRS, France
  3. Equipe labellisée LIGUE2020, CRBM, Univ. Montpellier, CNRS, France
  4. Institut Pasteur, Mouse Genetics Engineering Center, Université Paris Cité, France
  5. IGF, Univ. Montpellier, CNRS, INSERM, France
  6. Equipe labellisée LIGUE2022, IGMM, Univ. Montpellier, CNRS, France
  7. IRCM, Univ. Montpellier, INSERM, France
https://doi.org/10.7554/eLife.110324.3
Share this article
Cite this article
  1. Dana Naim
  2. Zouheir Houhou
  3. Florent Cauchois
  4. Kevin Espie
  5. Valerie Simon
  6. Yvan Boublik
  7. Francina Langa Vives
  8. Zeinab Homayed
  9. Conception Paul
  10. Morgan Maillard
  11. Michael Hahne
  12. Julie Pannequin
  13. Julie Nguyen
  14. Audrey Sirvent
  15. Serge Roche
(2026)
Slap restricts oncogenic Src-family kinase signaling to maintain colonic epithelial homeostasis
eLife 15:RP110324.
https://doi.org/10.7554/eLife.110324.3
  2. Download BibTeX
  3. Download .RIS

eLife Assessment

This is an important study on the role of Slap in restricting Src activity and proliferation of colonic cells in vivo. The authors present solid evidence that an EPHB2-SRC signaling axis stimulates the proliferation of colon precursors and is controlled by the Src-binding protein SLAP, whose loss promotes tumorigenesis.

https://doi.org/10.7554/eLife.110324.3.sa0

Abstract

Src-family kinases (SFKs) regulate proliferation in colonic epithelial cells (CECs), but the mechanisms that restrain their activity remain poorly defined. We identify Src-like adaptor protein (SLAP), a negative regulator of receptor tyrosine kinase signaling, as a key suppressor of SFK activity in the colon. Constitutive and inducible epithelial-specific Slap deletion using a villin-CreERT2 model increases CEC proliferation and accelerates tumorigenesis in the azoxymethane/dextran sodium sulfate model. Slap deficiency also enhances SFK-dependent expansion of normal and tumor-derived colonic organoids. Mechanistically, we identify the receptor tyrosine kinase EPHB2 as a critical upstream activator of SFKs and a direct target of SLAP-mediated regulation. Loss of Slap increased EphB2 protein abundance and tyrosine phosphorylation, and enhanced its association with active SRC. Pharmacological inhibition of EPHB2 suppressed SRC activation and reversed the hyperproliferative phenotype induced by Slap deficiency. Together, these findings uncover a non-genetic mechanism driving SFK activation during colonic transformation and establish SLAP as a tumor suppressor that constrains oncogenic EPHB2–SFK signaling in the colonic epithelium.

Introduction

The membrane-anchored tyrosine kinase (TK) SRC plays important roles in intestinal homeostasis and tumorigenesis. In particular, SRC and other members of its family (i.e. FYN and YES) drive intestinal stem/progenitor cell proliferation, tissue regeneration, and tumorigenesis in Drosophila and mouse models (Cordero et al., 2014; Imada et al., 2016; Kohlmaier et al., 2015; Sirvent et al., 2020). SRC is also an oncogene in human colorectal cancer (CRC). Aberrant SRC expression and activity in CRC (50% of CRC patients) is a marker of poor clinical prognosis, a promoter of therapeutic resistance, and a potent driver of metastasis (Sirvent et al., 2012; Summy and Gallick, 2003; Yang et al., 2022). This tumor activity is associated with cancer stem cell and epithelial-to-mesenchymal transition features. However, SRC is rarely mutated in CRC and the mechanisms underlying its oncogenic function remain elusive (Irby et al., 1999; Sirvent et al., 2012; Summy and Gallick, 2003). Consistently, SRC inhibitors developed for the clinic have failed in CRC due to ineffective signaling inhibition and inadequate patient selection (Daud et al., 2012; Parseghian et al., 2017; Reddy et al., 2015). Elucidating the mechanisms underlying this persistent signaling may reveal essential non-genetic mechanisms by which TKs promote tumorigenesis and allow the development of effective TK-based therapies in CRC.

During evolution, TK activities have come under the tight control of small adaptor proteins that exert negative regulatory functions (Naudin et al., 2016). The best example is the SOCS regulation of JAK/STAT inflammatory pathways. We discovered that SRC signaling is under the control of such an inhibitory mechanism through the membrane-anchored adaptor SLAP (Src-like adaptor protein), which displays high sequence homology with SRC N-terminus (Manes et al., 2000; Pandey et al., 1995; Roche et al., 1998; Sirvent et al., 2008). Mechanistically, SLAP promotes degradation or prevents SRC binding to upstream receptors, resulting in inhibition of SRC signaling (Dragone et al., 2006a; Dragone et al., 2006b; Kazi and Rönnstrand, 2012; Myers et al., 2006; Myers et al., 2005; Roche et al., 1998; Sirvent et al., 2008; Wybenga-Groot and McGlade, 2015). Slap-deficient mice revealed an essential function for this adaptor in controlling lymphocyte development and activation, where it is highly expressed (Sosinowski et al., 2001). We additionally reported an unsuspected tumor suppressor function of SLAP in CRC (Naudin et al., 2014). Notably, SLAP was found to be abundantly expressed in the intestinal epithelium. SLAP levels were reduced in 50% of CRC samples analyzed, and SLAP silencing in experimental CRC models promoted tumor formation and liver metastasis. Mechanistically, SLAP promotes degradation of SRC signaling RTK EPHA2 (Naudin et al., 2014) and destabilization of the mTORC2 complex, resulting in AKT signaling inhibition (Dragone et al., 2006a; Mevizou et al., 2026). Although this observation suggests an important mechanism in the control of SRC function in the colon, genetic evidence for this mechanism is lacking. Here, we developed Slap-deficient mice models showing that Slap regulates SFK colonic epithelial function during homeostasis and tumorigenesis.

Results

Constitutive Slap inactivation increases CEC proliferation

To investigate SLAP function in the colon, we generated constitutive Slap-deficient mice by inserting a LacZ cassette into the Slap gene (Slap-/- mice) (Figure 1A). β-Galactosidase activity staining revealed a gradient of Slap expression toward the top of the crypts throughout the colonic epithelium (Figure 1—figure supplement 1A). This expression pattern was confirmed at the protein level by immunofluorescence staining using a Slap-specific antibody (Figure 1A). Loss of Slap led to increased colon thickness in 3-month-old mice, characterized by elongated crypts (Figure 1A). This epithelial hyperplasia was accompanied by elevated cell (CEC) proliferation (Figure 1A) and an increased number of goblet cells (Figure 1—figure supplement 1B), indicating that Slap regulates both CEC proliferation and differentiation.

Figure 1 with 1 supplement see all
Download asset Open asset
Murine Slap inactivation induces colonic epithelial hyperplasia.

(A) Constitutive Slap deletion. Top: Hematoxylin and eosin (H&E) staining of transverse colon sections. Crypt thickness was measured and quantified as mean ± SEM from 25 to 40 crypts per mouse (n=6 female mice per group). Middle: Immunohistochemistry (IHC) for the proliferation marker Ki67, with quantification of Ki67-positive colonic epithelial cells (CECs). (mean ± SEM from 20 to 40 crypts per mouse; n=5–6 mice per group). Bottom: RNAscope analysis of Lgr5 to identify colonic stem cells, combined with E-cadherin immunofluorescence to delineate crypt architecture. Inset, higher (×4) magnification highlighting Lgr5 expression. Lgr5 RNA particles were quantified and are shown as mean ± SEM from 20 to 40 crypts per mouse (n=5–6 mice per group). ***p<0.001, ****p<0.0001 Mann–Whitney test. (B) Inducible epithelial-specific Slap deletion (villin-CreERT2). Top: H&E staining of transverse colon sections with quantification of crypt thickness (mean ± SEM from 25 to 40 crypts per mouse, n=6 mice/group). Middle: IHC for Ki67 with quantification of Ki67-positive CECs (mean ± SEM from 20 to 40 crypts per mouse; n=5–6 mice per group). Bottom: RNAscope analysis of Lgr5 combined with E-cadherin immunofluorescence; Inset, higher (×4) magnification highlighting Lgr5 expression. Lgr5 RNA particles were quantified (mean ± SEM from 20 to 40 crypts per mouse, n=5–7 mice per group). Mice were analyzed at 3 months of age, 10 days after tamoxifen induction. ***p<0.001, ****p<0.0001 Mann–Whitney test.

RNAscope analysis of Lgr5, a marker of colonic epithelial stem cells (CSCs) (Barker et al., 2007), showed increased expression at crypt bases in Slap-deficient mice (Figure 1A), suggesting enhanced CSC traits. Given the role of SFKs in regulating colonic stem/progenitor proliferation (Cordero et al., 2014; Imada et al., 2016; Kohlmaier et al., 2015; Sirvent et al., 2020), we assessed whether Slap modulates SFK activity. Immunohistochemical analysis of an antibody detecting the activated form of Src (pSRC), which also cross-reacts with other p-SFKs, revealed increased SFK activity throughout the crypts of Slap-deficient mice (Figure 1—figure supplement 1B). This suggests that SLAP plays a role in regulating intestinal epithelial homeostasis, in addition to its well-established function in lymphocyte development (Sosinowski et al., 2001).

Cell-autonomous role of Slap in CEC proliferation

To determine if Slap functions in a cell-autonomous manner, we generated an inducible, intestinal-specific Slap-deficient mouse model by crossing Slap flox/flox mice with villin-CreERT2 mice (Slap f/f Villin CreERT2). Tamoxifen (TAM) treatment for 10 days efficiently deleted Slap in the epithelium, as confirmed by a marked reduction in Slap immunofluorescence staining in the intestinal epithelium, while resident immune cells retained Slap expression (Figure 1—figure supplement 1B). Colonic Slap depletion recapitulated the phenotype of constitutive Slap-deficient mice, including increased colon thickness, enhanced CEC proliferation (Figure 1B), elevated goblet cell numbers (Figure 1—figure supplement 1C), and increased CSC activity (Figure 1B). To further investigate the cell-autonomous role of Slap in regulating CEC proliferation, we performed ex vivo analyses using isolated colonic crypts. Organoids derived from Slap-deficient epithelium were more numerous and larger than those from controls (Figure 2A).

Figure 2 with 1 supplement see all
Download asset Open asset
Intestinal Slap inactivation enhances colonic organoid development through SFK activation.

(A) Slap-dependent colonic organoid development. Representative images of colon-derived organoids from Slap f/f and Slap f/f Villin-CreERT2 mice cultured in Matrigel for 2 days. Quantification of organoid number and area is shown as mean ± SEM from 100 to 200 organoids per mouse (n=8 mice per group). ****p<0.0001 Mann–Whitney test. (B) Intestinal Slap deletion increases SFK activity and global protein tyrosine phosphorylation in colonic crypts. Representative immunoblots (right) and quantification (left) of phospho-SFK (pSRC) and total phospho-tyrosine levels in lysates from isolated colonic crypts of the indicated genotypes. Data are presented as mean ± SEM from n=4–5 mice per group. *p<0.05; **p<0.001 t test. (C) Slap-dependent colonic organoid expansion requires SFK activity. Representative images and quantification of colon-derived organoids from Slap f/f and Slap f/f Villin-CreERT2 mice cultured for 2 days in the presence or absence of the SRC-family kinase inhibitor eCF506 (100 nM). Data are shown as mean ± SEM from 100 to 200 organoids per mouse, n=4 mice per group. ***p<0.001, ****p<0.0001 Mann–Whitney test.

Figure 2—source data 1

PDF file containing original western blots for Figure 2, indicating the relevant bands.

https://cdn.elifesciences.org/articles/110324/elife-110324-fig2-data1-v1.pdf
Figure 2—source data 2

Original files for western blot analysis displayed in Figure 2.

https://cdn.elifesciences.org/articles/110324/elife-110324-fig2-data2-v1.zip

Consistent with a role for Slap in restraining SFK signaling, Slap-deficient colonic crypts exhibited a two- to threefold increase in SFK activity and global cellular protein tyrosine phosphorylation (pTyr) levels (Figure 2B). An increase in protein tyrosine phosphorylation was also observed in organoids derived from Slap-deficient CECs and was reduced following treatment with the selective SFK inhibitor eCF506 (SRCi) (Fraser et al., 2016). Consistently, SRCi treatment decreased pSRC levels, confirming effective SFK inhibition (Figure 2—figure supplement 1). Functionally, the enhanced growth of Slap-deficient organoids was abolished by eCF506 treatment, demonstrating that the proliferative phenotype was SFK-dependent (Figure 2C). Together, these findings establish SLAP as a cell-autonomous suppressor of SFK-driven CEC proliferation.

Inducible Slap inactivation in the colon promotes colon tumorigenesis

We next evaluated Slap’s role in colon tumorigenesis using the azoxymethane/dextran sulfate sodium (AOM/DSS) model of colitis-associated cancer, in which a single injection of the carcinogen AOM is followed by repeated cycles of DSS-induced colonic inflammation, leading to the development of colorectal tumors that recapitulate key features of inflammation-driven CRC (Fazio et al., 2011; Figure 3A). In the inducible Slap knockout model, Slap deletion was initiated by TAM administration 10 days before AOM treatment and maintained by a second TAM administration at day 45 to ensure sustained Slap inactivation throughout tumor development (Nguyen et al., 2025). Under these conditions, Slap-deficient mice developed significantly more tumors and exhibited increased SFK activity within tumors compared with control animals (Figure 3B). Furthermore, tumoroids generated from these mice also showed enhanced growth, which was abolished by SFK kinase inhibition (Figure 3C), further supporting an SFK-dependent oncogenic mechanism. Interestingly, pharmacological SFK inhibition had no effect on tumoroids derived from control AOM/DSS-treated mice, consistent with previous reports that AOM/DSS-induced carcinogenesis involves oncogenic RAS mutations (Takahashi and Wakabayashi, 2004) and chronic inflammation. These findings suggest that while RAS-driven transformation can occur independently of SFK activity, Slap loss unleashes a parallel, SFK-dependent oncogenic pathway. The human relevance of this SLAP anti-oncogenic function was confirmed by modulating SLAP expression in CRC cells. In human SLAP-low HT29 and SW620 cell-lines, SLAP overexpression inhibited aldehyde dehydrogenase (ALDH) activity (Figure 3—figure supplement 1A), a well-established marker of CRC stem cells, as well as tumoroid growth (Figure 3—figure supplement 1B). Together, these results establish SLAP as a critical suppressor of SFK-driven colon tumorigenesis and cancer stem cell activity.

Figure 3 with 1 supplement see all
Download asset Open asset
Inducible Slap intestinal inactivation drives colon tumorigenesis and promotes SFK-dependent tumoroid growth.

(A) Experimental workflow of AOM/DSS-induced colon tumorigenesis. Mice received tamoxifen, followed 10 days later by a single azoxymethane (AOM) injection to induce mutagenesis and one cycle of dextran sodium sulfate (DSS) administered for 7 consecutive days. A second AOM injection was then performed, followed by two additional DSS cycles (7 days each). Mice were sacrificed at day 80. (B) Epithelial Slap loss accelerates colon tumor development. Left, representative H&E-stained sections showing transformed regions. Right, quantification of epithelial lesion area (mean ± SEM; n=11–15 mice per group). Statistical analysis is shown (Mann–Whitney test). (C) Slap depletion increases SFK activation in colonic tumors. Left, representative immunohistochemistry for phosphorylated SFK (pSRC) in transformed epithelium. Right, quantification of p-SFK–positive cells per mm² (mean ± SEM; n=7–9 mice per group; ****p<0.0001, Mann–Whitney test). (D) Tumoroids derived from Slap f/f and Slap f/f Villin-CreERT2 mice were cultured in 3D Matrigel in the presence or absence of SRC inhibitor (SRCi) and imaged at day 3. Tumoroid area (µm²) was quantified following SRCi treatment (mean ± SEM; 150–250 organoids per mouse, n=4 mice per group; ns: p>0.05; ****p<0.0001, Mann–Whitney test).

Slap target EphB2 to restrict SFK proliferative function in CEC

To investigate the Slap-dependent mechanism driving this phenotype, we hypothesized that Slap targets an upstream SFK activator within the RTK family that regulates colonic stem cells and CEC proliferation. Among RTKs expressed in colonic crypts, EphB2 and EphB3 are highly enriched in the CSC compartment and promote kinase-dependent CEC proliferation (Batlle et al., 2002; Genander et al., 2009; Holmberg et al., 2006). SFKs have also been reported as interactors and downstream effectors of EPHB2 signaling (Chang et al., 2024; Georgakopoulos et al., 2006; Leroy et al., 2009; Pasquale, 2024; Zisch et al., 1998). Supporting this model, western blotting analysis revealed elevated EphB2 protein levels in isolated Slap-deficient colonic crypts (Figure 4A), which was further confirmed by IHC analysis showing increased EphB2 expression throughout the colonic crypts of Slap-deficient mice (Figure 4B). This effect was recapitulated in CRC cells where enforced SLAP expression in SLAP-low HT29 cells decreased EPHB2 protein abundance. Interestingly, SLAP overexpression did not alter EPHB2 mRNA levels (Figure 3—figure supplement 1A), in accordance with a posttranslational mechanism involved in this process, as reported for EPHA2 (Naudin et al., 2014). Co-expression experiments in HEK293T cells revealed that EPHB2 associates with SLAP (Figure 4C), and this interaction required the SLAP SH2 and SH3 domains, as it was reduced with a SLAP mutant harboring inactive point mutations in the SH2 and SH3 domains (SLAP-mut; Figure 4C; Mevizou et al., 2026). The interaction also depended on phosphorylation of the juxta-membrane Tyr596 and Tyr602, which mediates SRC-SH2 binding (Zisch et al., 1998), because mutation of these residues to phenylalanine (YF EPHB2) diminished SLAP-EPHB2 binding (Figure 4C). Endogenous EPHB2 similarly interacted with SLAP in SLAP-expressing HT29 cells, confirming this association in CRC cells (Figure 4—figure supplement 1B). Consistent with enhanced EphB2 signaling, isolated Slap-deficient colonic crypts displayed increased EphB2 tyrosine phosphorylation together with elevated levels of associated phosphorylated SFKs (Figure 4A). Collectively, these findings identify EPHB2 as a novel SLAP interactor and target, supporting a role for SLAP in the regulation of EPHB2/SFK signaling.

Figure 4 with 1 supplement see all
Download asset Open asset
Slap targets EphB2 to restrict SFK proliferative signaling in CEC.

(A) Intestinal Slap deletion increases EphB2 expression, EphB2 tyrosine phosphorylation, and its association with active SRC (pSRC) in colonic crypts. Left, quantification; right, representative immunoblots of EphB2 levels, EphB2 tyrosine phosphorylation, and associated pSRC following EphB2 immunoprecipitation from isolated colonic crypt lysates of the indicated mouse strains. Mean ± SEM; n=3–5 mice per group; *p<0.05, Student’s t-test. (B) IHC analysis of EphB2 expression in colonic crypts from control and Slap-deficient mice. Left, representative images; right, quantification (mean ± SEM; n=3 mice per group; ****p<0.0001, Mann–Whitney test). (C) SLAP–EPHB2 interaction in HEK293T cells. Co-immunoprecipitation of the indicated SLAP-FLAG constructs (wild-type, WT; or SH3*SH2* mutant, SLAP mut) and EPHB2-MYC constructs (wild-type, WT; or Y596F/Y602F mutant, YF) transfected into HEK293T cells. Expression levels of SLAP and EPHB2 and relative quantification of SLAP-EPHB2 interaction are shown (representative example of three independent experiments). (C) Slap-dependent colon organoid expansion requires EphB2 activity. Representative images and quantification of colon-derived organoids from Slap f/f and Slap f/f Villin-CreERT2 mice treated with the indicated EPH inhibitors (EPHB2i: 200 nM, pan-EPH2i: 100 nM, or DMSO control) and analyzed at day 2 (mean ± SEM; 150–200 organoids per mouse; n=4 mice per group; ns: p>0.05; ****p<0.0001, Mann–Whitney test).

Figure 4—source data 1

PDF file containing original western blots for Figure 4, indicating the relevant bands.

https://cdn.elifesciences.org/articles/110324/elife-110324-fig4-data1-v1.pdf
Figure 4—source data 2

Original files for western blot analysis displayed in Figure 4.

https://cdn.elifesciences.org/articles/110324/elife-110324-fig4-data2-v1.zip

We next asked whether EphB2 contributes to the Slap-dependent regulation of colonic organoid growth by inhibition of EphB2 kinase activity with the selective inhibitor ALW-II-49–7 (EPHB2i; Choi et al., 2009; Noberini et al., 2012; Zhang et al., 2026). While EPHB2i had no effect on the growth of wild-type organoids, it markedly suppressed the enhanced growth observed in Slap-deficient organoids (Figure 4C). Treatment with the pan-EPH kinase inhibitor ALW-II-41–27 (pan-EPHi; Amato et al., 2014; Choi et al., 2009; Ferrao Blanco et al., 2024) produced a similar reduction (Figure 4C), supporting a role for EphB2 kinase activity in the Slap-dependent phenotype. Of note, EPHB2i did not alter the kinase activity of SRC expressed in HEK293T cells in contrast to EPHB2, arguing against a direct off-target effect on SFK (Figure 3—figure supplement 1B). Moreover, pEPHi reduced both the elevated phosphotyrosine levels and SFK activation induced by Slap deletion in colonic organoids (Figure 2—figure supplement 1), demonstrating that SFK hyperactivation in Slap-deficient CECs is dependent upon EphB2 signaling. Together, these data show that Slap limits colonic organoid growth by restricting EphB2-dependent activation of Src and reveal an EphB2-SFK signaling axis as a key driver of the hyperproliferative phenotype associated with Slap-deficiency (Figure 4—figure supplement 1C). Notably, a similar mechanism was observed in human CRC cells. Pharmacological inhibition of EPHB2 reduced tumoroid growth in a CRC model expressing low levels of SLAP, whereas this inhibitory effect was largely abolished upon SLAP overexpression. Importantly, a SLAP mutant (SLAP mut) that is unable to interact with EPHB2 fails to suppress tumoroid growth and restores sensitivity to EPHB2 inhibition, indicating that the tumor-suppressive activity of SLAP depends on its interaction with EPHB2 (Figure 5A–C). Collectively, these findings indicate that SLAP restrains the tumor-promoting activity of EPHB2 and suggest that the SLAP–EPHB2–SRC signaling axis is conserved between normal CECs and CRC.

Figure 5 with 1 supplement see all
Download asset Open asset
SLAP suppresses EPHB2-dependent tumoroid development of CRC cells and is associated with improved prognosis in MSS CRC.

(A) SLAP expression in SW620 CRC cells transduced with empty vector (mock), wild-type SLAP, or an EPHB2-binding-defective SLAP mutant (SLAP Mut). (B) Representative tumoroid images from SW620 cells expressing mock, SLAP, or SLAP m and treated with indicated EPHB2 inhibitors (EPHB2i: 200 nM, pan-EPH2i: 100 nM, or DMSO control). (C) Quantification of tumoroid size from (B) (mean ± SEM; 150–200 tumoroids; n=3; ns: p>0.05; **p<0.001; ***p<0.0005; ****p<0.0001, Mann–Whitney test). (D) Disease-free relapse analysis of TCGA MSS and MSI CRC patients stratified according to combined EPHB2, SLAP, and SLA2 expression. High SLAP/SLA2 and EPHB2 co-expression is associated with improved prognosis in MSS patients.

Figure 5—source data 1

PDF file containing original western blots for Figure 5, indicating the relevant bands.

https://cdn.elifesciences.org/articles/110324/elife-110324-fig5-data1-v1.pdf
Figure 5—source data 2

Original files for western blot analysis displayed in Figure 5.

https://cdn.elifesciences.org/articles/110324/elife-110324-fig5-data2-v1.zip

Finally, we sought additional evidence supporting SLAP-EPHB2 signaling in CRC patients. We observed a weak but significant inverse correlation between SLAP expression and the colorectal CSC-like activity score in TCGA tumors (Figure 5—figure supplement 1A). In addition, although expression of EPHB2, SLAP, or the SLAP-related gene SLA2 alone was not associated with disease-free relapse in microsatellite-stable (MSS) CRC patients (Figure 5—figure supplement 1B), co-expression of SLAP and SLAP2 with EPHB2 was associated with improved prognosis (Figure 5D). Notably, this association was specific to MSS tumors, which are characterized by low immune infiltration, and was not observed in microsatellite instability (MSI) CRC, which displays high immune infiltration (Figure 5D). Together, these findings suggest that SLAP expression in tumor cells may contribute to the regulation of EPHB2-dependent CSC signaling in CRC.

Discussion

SFKs are potent drivers of intestinal stem cell proliferation and CRC, yet how their activity is restrained in normal epithelium remains unclear. Here, we identify the adaptor protein SLAP as a key epithelial-intrinsic regulator of SFK signaling in the colon. Epithelial loss of Slap increases proliferation, expands the stem cell compartment, and elevates SFK activation. Complementary organoid studies demonstrate that this requirement is cell autonomous. Importantly, pharmacologic SFK inhibition fully rescues the hyperproliferative phenotype of Slap-deficient organoids and tumoroids, revealing a crypt-intrinsic proliferative program that is SFK-dependent and normally constrained by Slap.

Mechanistically, our findings identify EPHB2 as a critical upstream activator of SRC signaling that is negatively regulated by SLAP. EPHB2 is highly expressed in intestinal stem and progenitor cells, where it contributes to crypt homeostasis and colorectal tumorigenesis (Batlle et al., 2005; Genander et al., 2009; Holmberg et al., 2006). We show that genetic loss of Slap results in elevated EPHB2 expression, increased SRC activation, and enhanced epithelial proliferation, whereas pharmacological inhibition of EPHB2 suppresses SRC activation and completely reverses the growth advantage of Slap-deficient organoids. Furthermore, EPHB2 inhibition selectively impairs the growth of CRC tumoroids expressing low levels of SLAP, supporting the existence of a conserved SLAP-EPHB2-SRC signaling axis in both normal and transformed intestinal epithelium.

Although the precise molecular mechanism remains to be established, SLAP may restrain EPHB2 signaling through several non-mutually exclusive mechanisms. SLAP has been shown to promote the ubiquitin-dependent downregulation of multiple RTKs through interactions with E3 ubiquitin ligases, including CBL family proteins, UBE4A, and UBE3C (Mevizou et al., 2026; Myers et al., 2006; Naudin et al., 2014; Sirvent et al., 2008; Zutshi et al., 2024). Alternatively, SLAP may limit productive SRC recruitment and activation downstream of EPHB2 through its SH2 and SH3 domains (Roche et al., 1998). Future studies will be required to determine how SLAP controls EPHB2 abundance and signaling output in intestinal stem cells. In addition, other RTKs known to activate SFKs, including members of the EGFR family (Cordero et al., 2014; Wong et al., 2012), may also contribute to the phenotype associated with SLAP loss. Moreover, Slap loss may affect EphB2’s role in cell positioning (Genander et al., 2009; Holmberg et al., 2006), contributing further to excessive proliferation.

Together, these findings establish SLAP as an epithelial tumor suppressor that limits SFK-driven stem cell proliferation and reveal a non-genetic mechanism of SRC oncogenic activation in CRC involving RTK hyperactivation (Leroy et al., 2009). More broadly, they suggest that SLAP loss may define CRC subsets with heightened dependence on SFK signaling, offering opportunities for therapeutic stratification and refinement of SRC-targeted interventions.

Materials and methods

Key resources table
Reagent type (species) or resourceDesignationSource or referenceIdentifiersAdditional information
Strain, strain background (Mus musculus)Slap tm1a miceKOMP RepositorySlaptm1a (KOMP); RRID:MMRRC_075158-UCDC57BL/6 N background; LacZ reporter; FRT- and loxP-modified allele
Strain, strain background (Mus musculus)Slap -/- miceThis studyFunctional gene inactivation by LacZ cassette insertion
Strain, strain background (Mus musculus)Slap f/fl miceThis studyGenerated after FlpO-mediated recombination
Strain, strain background (Mus musculus)Tg(CAG-flpo)1AfstKranz A et al., 2010MGI:4453967; RRID:MMRRC_036512-UCDFlp deleter mouse in C57Bl/6 based on Flpo recombinase
Strain, strain background (Mus musculus)Tg(Vil1-cre/ERT2)23Syrel Marjou et al., 2004MGI:3053826; RRID:MGI:3053826Tamoxifen-inducible Cre expression in intestinal epithelial cells
Strain, strain background (Mus musculus)Slap f/f Villin CreERT2 miceThis studyConditional epithelial SLA knockout induced by tamoxifen
Cell line (human)HT29ATCCHTB-38; RRID:CVCL_0320Human colorectal adenocarcinoma
Cell line (human)SW620ATCCCCL-227; RRID:CVCL_0547Human colorectal adenocarcinoma
Cell line (human)HEK293TATCCCRL-3216, RRID:CVCL_0063Human embryonic kidney cells used for transient transfection
Transfected construct (M. musculus)SLAP-FLAG (WT)Naudin et al., 2014FLAG-tagged wild-type SLAP expression plasmid
Transfected construct (M. musculus)SLAP-FLAG (SH3/SH2 mutant)Naudin et al., 2014FLAG-tagged SH3/SH2-deficient SLAP mutant expression plasmid
Transfected construct (human)EPHB2-mycNarayanan et al., 2023Myc-tagged human EPHB2 expression plasmid
Transfected construct (human)EPHB2 Y596F/Y602F mutantThis studyMyc-tagged human EPHB2 YF mutant expression plasmid
Sequence-based reagentMm-LGR5-C2Bio-TechneCatalog # 312178RNAscope probe for detection of mouse LGR5
AntibodyAnti-Myc (mouse monoclonal)Cell Signaling Technologysc-2276S; RRID:AB_331783WB (1:1000), IP (1:250)
AntibodyAnti-EPHB2 (rabbit monoclonal)Cell Signaling Technologysc-83029WB (1:1000), IP (1:50)
AntibodyAnti-EPHB2 (goat polyclonal)R&D SystemsCat#AF467; RRID:AB_355375IHC (1:100)
AntibodyAnti-FLAG M2 (mouse monoclonal)Sigma-AldrichClone M2; RRID:AB_262044WB (1:1000), IP (1:250)
AntibodyAnti-HA (mouse monoclonal)InvitrogenCat#26183; RRID:AB_10978021WB (1:1000)
AntibodyAnti-β-actin (mouse monoclonal)Sigma-AldrichCat#A2228; RRID:AB_476697WB (1:2000),
(loading control)
AntibodyAnti-phosphotyrosine (4G10) (mouse monoclonal)Gift from P. MangeatClone 4G10; RRID:AB_2891016WB (1:1000)
AntibodyAnti-SLAP (goat polyclonal)Santa Cruz Biotechnologysc-1215WB (1:1000)
AntibodyAnti-phospho-SRC (rabbit polyclonal)InvitrogenPA5-97366; RRID:AB_2809160WB (1:1000)
AntibodyAnti-phospho-SRC (rabbit polyclonal)Cell Signaling TechnologyCat#2101; RRID:AB_331697IHC (1:100)
AntibodyAlexa Fluor 488-conjugated secondary antibody (donkey polyclonal)Jackson ImmunoResearchCat#711-545-152; RRID:AB_2340621Fluorescence IHC (1:500)
AntibodyCy3-conjugated secondary antibody (donkey polyclonal)Jackson ImmunoResearchCat#711-165-152; RRID:AB_2307443Fluorescence IHC
(1:500)
Peptide, recombinant proteinRecombinant human R-spondin-1PeproTechCat#78213Organoid culture supplement
Peptide, recombinant proteinRecombinant human EGFBio-Techne236-EG-200Organoid culture supplement
Peptide, recombinant proteinRecombinant mouse NogginStemCell TechnologiesCat#78061Organoid culture supplement
Peptide, recombinant proteinRecombinant mouse WNT3AThermo Fisher ScientificCat#315–20Organoid culture supplement
Commercial assay or kitALDEFLUOR KitStemCell TechnologiesCat#01700ALDH activity assay
Commercial assay or kitRNeasy Plus Mini KitQiagenCat#74134RNA extraction
Commercial assay or kitSuperScript VILO cDNA Synthesis KitThermo Fisher ScientificCat#11754050Reverse transcription
Commercial assay or kitRNAscope Multiplex Fluorescent Reagent KitBio-TechneCat#323100RNA in situ hybridization assay for FFPE tissues
Commercial assay or kitQuickChange Site-Directed Mutagenesis KitAgilentCat#200519Site-directed mutagenesis
Commercial assay or kitTumor Dissociation Kit, MouseMiltenyi BiotecCat#130-096-730Tumor dissociation
Commercial assay or kitBIOXALLVector LaboratoriesSP-6000–100Endogenous Peroxidase and Alkaline Phosphatase Blocking Solution
Commercial assay or kitDABVector LaboratoriesSK-4100Chromogenic detection of HRP activity
Chemical compound, drugTamoxifenMerckCat#5648–1 GCreERT2 activation
Chemical compound, drugAzoxymethane (AOM)Sigma-AldrichCat#A5486Colon carcinogenesis model induction
Chemical compound, drugDextran sodium sulfate (DSS)TdB Labs ABDB001Colitis induction
Chemical compound, drugX-galSigma-AldrichCat#71077–3β-Galactosidase staining
Chemical compound, drugeCF506MedChemExpressCat#HY-112096SRC inhibitor
Chemical compound, drugALW-II-49–7MedChemExpressCat#HY-18833EPHB2 inhibitor
Chemical compound, drugALW-II-41–27MedChemExpressCat#HY-18007Pan-Eph inhibitor
Chemical compound, drugY-27632 dihydrochlorideSigma-AldrichCat#Y0503Rock inhibitor
Chemical compound, drugCHIR-99021Tebu-BioCat#10–1279GSK3 inhibitor
Chemical compound, drugN-acetyl-L-cysteineSigma-AldrichCat#A9165Organoid culture supplement
OtherMatrigel GFR phenol-red freeCorningREF 356231Basement Membrane Matrix for organoids and tumoroids
OtherAdvanced DMEM/F12GibcoCat#12634010Basal culture medium
OtherB27 SupplementGibcoCat#17504044Serum-free supplement
OtherN2 SupplementGibcoCat#17502048Serum-free supplement
OtherGlutaMAXGibcoCat#35050061Cell culture supplement
Software, algorithmGraphPad PrismGraphPad SoftwareVersion 9.3.1Statistical analysis
Software, algorithmImageJNIHRRID:SCR_003070Image processing and quantification
Software, algorithmNovoExpressAgilentFlow cytometry analysis
Software, algorithmZENZeissMicroscope image acquisition
Software, algorithmNDP.view2HamamatsuU12388-01Image viewing
Software, algorithmQuPathBankhead et al., 2017RRID:SCR_018257IHC quantification
Software, algorithmGEPIA2Tang et al., 2019http://gepia2.cancer-pku.cnTCGA gene expression and survival analyses

Generation of genetically modified mouse models

Request a detailed protocol

All mouse experiments were conducted in strict accordance with the European Community guidelines (86/609/EEC) and the French National Committee for the care and use of laboratory animals (87/848), complied with the ARRIVE guidelines, and were approved by the French Ministry of Higher Education, Research and Innovation (APAFIS#2022031511382008). All procedures were performed in the institutional animal facility (agreement #F3417216). Mice were housed in temperature-controlled ventilated cages (20–22 °C) under a 12 hr light/dark cycle, with relative humidity maintained between 45% and 55%, and were kept under pathogen-free conditions. Slaptm1a(KOMP) mice were generated from JM8A1.N3 embryonic stem cells (C57BL/6 N genetic background) produced by the trans-NIH KnockOut Mouse Project (KOMP) and obtained from the KOMP Repository (https://www.komp.org/). Genotyping was performed by PCR analysis of genomic DNA isolated from mouse tail biopsies. The Slaptm1a(KOMP), Tg(CAG-flpo)1Afst, and Tg(Vil1-cre/ERT2)23Syr mouse lines, as well as compound lines, were maintained on a C57BL/6 background and bred in a specific opportunistic pathogen-free (SOPF) facility, and experiments were conducted in a specific pathogen-free (SPF) facility.

Slap-inactivated mice (Slap -/-) were generated by insertion of a LacZ reporter cassette into the Slap locus, resulting in functional gene inactivation. The LacZ cassette was flanked by FRT sites, allowing recombination upon crossing with FlpO deleter mice. FlpO-mediated recombination generated the recombined Slap allele, whereas FlpO-negative littermates retaining the unrecombined LacZ allele were used as controls.

Inducible Slap knockout mice were generated by crossing Slap floxed mice with CreERT2 transgenic mice. TAM treatment induced Cre-mediated excision of the floxed Slap allele, resulting in gene inactivation. To activate CreERT2, control and experimental mice received two intraperitoneal injections of TAM (2 mg per injection).

Mice genotyping

Request a detailed protocol

Mice tail biopsies underwent alkaline lysis and incubation at 92 °C for 20 min, followed by reaction neutralization. PCR amplification was conducted with the ready mix MyTAQRed mix (meridian). Resulting products were run on a 2% ethidium-bromide agarose gel (Sigma–Aldrich), using a 1 kb DNA ladder (Thermo Fisher Scientific), and imaged with a ChemiDoc MP system (Bio-Rad). The following primers were used: CSD-lacF: GCTACCATTACCAGTTGGTCTGGTGTC; CSD-neoF: GGGATCTCATGCTGGAGTTCTTCG; CSD-loxF: GAGATGGCGCAACGCAATTAATG; CSD-Sla-R: TCTCTGAGATGCCCCATTTTACCCC; CSD-Sla-ttR: GTTTCTTGGCACTGACTAGAGCAGG; CSD-Sla-F: GTTAACAACACACCTACCCCTTGGC.

Chemical induction of tumorigenesis by AOM/DSS

Request a detailed protocol

Inducible epithelial SLAP knockout mouse model was treated with TAM to induce Slap depletion. DSS and AOM/DSS treatment was performed essentially as described in Nguyen et al., 2025; Paul et al., 2022. Briefly, 10 days following TAM treatment, a first AOM injection was performed. Shortly after the first round of DSS at 2% was given to the mice for 7 consecutive days. A week later another AOM injection was performed followed by two other rounds of DSS treatments two weeks apart. The mice were then sacrificed at day 80. Colons or tumors were then excised for tumoroids formation, cryopreservation or fixation followed with IHC analysis.

β-Galactosidase activity

Request a detailed protocol

To visualize the activity of the Slap promoter driving lacZ expression, we used 5-bromo-4-chloro-3-indolyl-beta-D-galactopyranoside (X-gal, Sigma-Aldrich) as described in Nguyen et al., 2025. Organs were cryopreserved and 10 μm tissue sections were prepared. Sections were treated with 0.5% glutaraldehyde for 10 min at room temperature (RT) followed by overnight incubation at 37 °C in a staining solution containing 1 mg/ml X-gal, 5 mM potassium ferricyanide (K3Fe(CN)6), 5 mM potassium ferrocyanide (K4Fe(CN)6), and 2 mM MgCl2, 0.1% Triton in PBS-1X. The synthetic substrate X-gal gives an insoluble blue precipitate when cleaved by β-galactosidase. Samples were washed in PBS-1X for 5 min and rinsed briefly with dH2O before mounting with aqueous mounting medium (Sigma-Aldrich).

Immunohistochemistry of paraffin-embedded tissues

Request a detailed protocol

Fluorescent and bright-field immunohistochemistry on paraffin-embedded tissue. Intestinal tissues were fixed in neutral-buffered formalin for 24 hr at RT, embedded in paraffin, and tissue sections (4 μm) were prepared with a microtome (MICROM). Sections were incubated in successive baths of xylene and ethanol, and antigen retrieval was performed by boiling the sections with 10 mM sodium citrate (pH 6.4) or Tris‐EDTA buffer (pH 9) for 20 min. Tissues were treated with TBS‐1X2% serum, 0.1% Triton to block non-specific binding. Samples were then incubated with primary antibodies overnight at 4 °C. In the case of bright-field immunohistochemistry, sections were treated with BIOXALL (Vector Laboratories) for 10 min before blocking and incubation with primary antibodies. Secondary reagent staining was revealed using DAB (Vector Laboratories), and sections were counterstained with hematoxylin (Sigma-Aldrich) and then mounted with aqueous mounting medium (Sigma-Aldrich). As for fluorescence immunohistochemistry, sections were incubated in the presence of secondary antibodies conjugated to Alexa‐488 or cyanin3 (Jackson ImmunoResearch Laboratories) and Hoechst (2 µg/ml, Sigma–Aldrich) and mounted with aqueous mounting medium (Sigma-Aldrich). For histological analysis, the tissue sections were deparaffinized and stained with hematoxylin, eosin, and Alcian blue.

RNA in situ hybridization

Request a detailed protocol

ISH for Lgr5 was performed with the RNAscope FFPE assay kit (Bio-techne) according to the manufacturer’s instructions. Briefly, 4 μm formalin-fixed, paraffin-embedded tissue sections were pretreated with heat and protease digestion and then hybridized with a target probe for Lgr5 (Probe - Mm-LGR5-C2, Biotechne). Thereafter, a fluorophore signal amplification system was hybridized to the target probe.

RNA extraction and qPCR

Request a detailed protocol

Total RNA was extracted using RNeasy Plus Mini Kit columns (Qiagen). First-strand cDNA synthesis was performed with 1 µg of purified RNA using SuperScript VILO cDNA synthesis KIT (Thermo Fisher Scientific) according to the manufacturer’s instructions. qRT-PCR experiments were performed using LightCycler 480 SYBR Green I Master (Roche Diagnostics) on the LightCycler 480 system using the following primers: EHPB2_F 5'-CGGCTGCATGTCCCTCATC-3', EHPB2_R 5'-GTCCCCGTTACAGTAGAGCTT-3'; GAPDH_F 5'-TCTCCTCTGACTTCAACAGCGAC-3' & GAPDH_R 5'-CCCTGTTGCTGTAGCCAAATTC-3'. Relative expression was determined using the threshold cycle relative quantification method. Data were normalized to the expression levels of GAPDH.

ALDH analysis

Request a detailed protocol

The ALDH assay was performed as described in Nguyen et al., 2025 and according to the protocol of the ALDEFLUORTM kit (#01700, Stemcell). FACS analysis was performed through the Novocyte ACEA 2 fluorescence-activated cell sorting flow cytometer, and data were analyzed using NovoExpress software.

Antibodies and reagents

Request a detailed protocol

Antibodies used for biochemistry: anti‐Myc (#2276 S, CST), anti-EphB2 D2X2 I (#83029, CST), anti-EphB2 (for IHC, # AF467 R&D Systems), anti‐FLAG (M2 antibody, Sigma-Aldrich), anti‐HA (Invitrogen, # 26183), anti‐Actin (Sigma-Aldrich, #A2228), anti‐pTyr 4G10 (gift from P. Mangeat, CRBM, Montpellier, France), and anti-SLAP clone C-19 (Santa Cruz Biotechnology, sc-1215). SFK activity was assessed using an anti-phospho-SRC antibody (Invitrogen, PA5-97366 for WB, and #2101 from CST for IHC), which also cross-reacts with other p-SFKs, revealed increased SFK activity. All antibodies utilized in IHC were used according to supplier protocols. SFK activities were revealed with the help of SignalStain Boost IHC Detection Reagent. Inhibitors used in this study: SRCi eCF506 (MedChemExpress, #HY‐112096), EPHB2 inhibitor ALW-II-49–7 (EPHB2i, MedChemExpress, #HY-18833), Pan Eph inhibitor ALW-II-41–27 (pan-EPHi, MedChemExpress, # HY-18007). SLAP-FLAG (WT and SH3*SH2* mutant, mut) constructs were described in Naudin et al., 2014. EPHB2-myc construct was from Narayanan et al., 2023. EPHB2 Y596F/Y602F mutant (YF mutant) was obtained by QuickChange Site-Directed Mutagenesis Kit (Agilent) using the following oligonucleotides: 5′-gaccccaggcatgaagatctTcatcgatcctttcacctTcgaggaccccaacgaggcag-3′ and 5′-ctgcctcgttggggtcctcgAaggtgaaaggatcgatgAagatcttcatgcctggggtc-3′. Other reagents: Advanced DMEM/F12 (Gibco), B27 supplement (Thermo Fisher Scientific), N2 supplement (Thermo Fisher Scientific), GlutaMAX (Thermo Fisher Scientific), Hepes (Thermo Fisher Scientific), N-acetyl cysteine (Sigma-Aldrich), CHIR-99021 (Tebu-BIO), Recombinant human R-spondin-1 (Peprotech). TAM (Merck group), Azoxymlethane (Sigma-Aldrich).

Cell culture and transfections

Request a detailed protocol

HT29, SW620, and HEK293T cell lines were directly obtained from ATCC (Rockville, MD), expanded from early-passage frozen stocks, and used for experiments within six months after thawing. HT29 and SW620 cells stably expressing SLAP (or mock as a control) were described in Mevizou et al., 2026; Naudin et al., 2014. Cells were cultured at 37 °C and 5% CO2 in a humidified incubator in Dulbecco’s modified Eagle’s medium (DMEM) GlutaMAX (Invitrogen) supplemented with 10% fetal calf serum (FCS), 100 U/ml of penicillin, and 100 µg/ml of streptomycin, and were routinely tested (once a week) for Mycoplasma using MycoAlert Mycoplasma detection kit (Lonza, #LT07-318). Transient plasmid transfections in HEK293T cells were performed with the jetPEI reagent (Polyplus-transfection) according to the manufacturer’s instructions.

Biochemistry

Request a detailed protocol

Co‐immunoprecipitation and western blotting (WB) were described in Mevizou et al., 2026; Naudin et al., 2014. Cells or isolated colonic crypts were lysed on ice using lysis buffer (20 mM Hepes pH 7.5, 150 mM NaCl, 0.5% Triton X-100, 6 mM β-octylglucoside), supplemented with complete mini EDTA-free protease and phosphatase inhibitor cocktail tablets (Roche). Protein lysates (15–35 µg) were resolved by SDS-PAGE, transferred to LF/PVDF membranes using the Trans-Blot Turbo system (Bio-Rad), and incubated overnight at 4 °C with the appropriate primary antibody (1:1000). For immunoprecipitation (IP), antibodies were used at 1:100. Membranes were then incubated for 45 min with the HRP-conjugated secondary antibody (Cell Signaling, 1:4000). Signals were detected using ECL Plus (Amersham Biosciences) and imaged with the Amersham Imager 600 (GE Healthcare Life Sciences). Signal quantification and analysis were carried out using ImageJ software. For SLAP-EPHB2 association experiments, HEK293T cells were co-transfected for 48 hr with the indicated FLAG-tagged and EPHB2 constructs either WT or the YF EPHB2 mutant. Endogenous EPHB2 association experiments were performed in HT29 cells stably expressing SLAP-FLAG. Cell‐lysates were subjected to SLAP‐FLAG immunoprecipitation using anti‐FLAG magnetic beads (#A3697, Pierce). EPHB2-myc was immunoprecipitated using MYC-Tag (9B11) mouse monoclonal antibody (#2276, CST) and protein G sepharose beads (Thermo Fisher Scientific).

Organoids derived from colonic crypts

Request a detailed protocol

Inducible epithelial Slap knockout models were sacrificed 10 days after TAM induction. Organoids were performed as described in Nguyen et al., 2025. Briefly, the colons were collected and washed with PBS containing antibiotics. They were then cut open and further dissected into small pieces, then washed with a wash buffer containing PBS 1 x, penicillin, streptomycin (Gibco), and Fungin (Invivo Gen) until the supernatant is clear. These pieces were then incubated in a crypt isolation buffer on ice for 30 min (wash buffer, 1% BSA fraction, and 25 mM EDTA). Crypt fractions were then isolated after thorough pipetting, centrifuged at 300 × g, 4 °C for 5 min. 500 crypts were resuspended in M1 medium mixture Advanced DMEM/F12 supplemented with 1% Penstrep, 1% Fungin, 10 mM Hepes, 1% GlutaMAX, N‐2, B‐27, 1 Mm N‐acetyl cysteine, and Matrigel (Corning; ratio 1:2). The mixture was plated in a 24-well plate. After Matrigel polymerization, 500 µl of M2 medium M1 media supplemented with EGF (50 ng/ml, Bio‐techne), Noggin (100 ng/ml, Stem cell technologies), R‐spondin1 (500 ng/ml, Stem cell technologies), Y27 (10 µM, Sigma-Aldrich), CHIR‐99021 (3 µM, Tebu‐Bio), and WNT3a (50 n/ml, Thermo Fisher Scientific) was added to each well containing or not the SRC inhibitor eCF506 (100 nM, Medchem express) and in other cases the EphB inhibitors EPHB2i (ALW-II-49–7, 200 nM) and the pan-EPH inhibitor pan-EPHi (ALW-II-41–27, 100 nM, Medchem express). For organoids derived from AOM/DSS transformed CECs, tumors were excised from mice treated with AOM/DSS at day 80. They were dissociated using the Tumor Dissociation Kit mouse (Miltenyi Biotec). The dissociation was then stopped by DMEM medium containing 10% SVF. The mixture was then centrifuged, and the pellet was resuspended in DMEM F12 without factors. Cells were counted and plated at almost 10,000 cells per well in a 24-well plate in a mixture containing 3D Matrigel. After 30 min of incubation, a complete F12 medium was added to the solidified domes containing or not the SRC inhibitor eCF506 (100 nM) (Fraser et al., 2016).

Tumoroids-derived from CRC cells

Request a detailed protocol

2000–5,000,000 human CRC cells were resuspended in Advanced DMEM/F12 supplemented with 1% Penstrep, 2 mM L-glutamine, N-2, and Matrigel (Corning) (1:2 ratio) prior to plating in 24-well plates. After polymerization of Matrigel, 0.5 ml Advanced DMEM/F12 supplemented with EGF (20 ng/ml, Biotechne) and FGF (10 ng/ml, Biotechne) was added. Tumoroids were cultured at 37 °C and 5% CO2 in a humidified incubator.

Microscopy and imaging

Request a detailed protocol

Histological slides were digitized using a Nanozoomer scanner (Hamamatsu) with a ×40 objective and viewed with NDP.view2 software (Hamamatsu). Fluorescence images were captured using an AxioImager Z2 microscope (Zeiss) operated with Zen software. Image processing was performed in ImageJ.

TCGA COAD analysis

Request a detailed protocol

Gene expression and clinical data from the TCGA colon adenocarcinoma (COAD) cohort were analyzed using GEPIA2 (http://gepia2.cancer-pku.cn/). Kaplan–Meier disease-free survival analyses were performed using the GEPIA2 Survival Analysis module, with patients stratified into high- and low-expression groups based on the median expression value. Stem cell-like signature scores were calculated using the GEPIA2 Signature Score module (Merlos-Suárez et al., 2011) from the indicated gene set, and associations with disease-free survival were assessed by log-rank testing.

Statistical analysis

Request a detailed protocol

All analysis was performed using GraphPad Prism (9.3.1). Data are presented as the mean ± SEM. The Mann-Whitney test was used. The statistical significance level is illustrated with p values: *p≤0.05, **p≤0.01, ***p≤0.001, **** p≤0.0001 (t-test).

Data availability

Data supporting the findings of this study are all included in the manuscript, figures, figure supplements, and source data files.

References

    1. Sirvent A
    2. Benistant C
    3. Roche S
    (2012)
    Oncogenic signaling by tyrosine kinases of the SRC family in advanced colorectal cancer
    American Journal of Cancer Research 2:357–371.

Article and author information

Author details

  1. Dana Naim

    1. CRBM, Univ. Montpellier, CNRS, Montpellier, France
    2. Equipe labellisée FRM2023, CRBM, Univ. Montpellier, CNRS, Montpellier, France
    3. Equipe labellisée LIGUE2020, CRBM, Univ. Montpellier, CNRS, Montpellier, France
    Contribution
    Resources, Data curation, Formal analysis, Investigation, Visualization, Methodology
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-4982-8381

  2. Zouheir Houhou

    1. CRBM, Univ. Montpellier, CNRS, Montpellier, France
    2. Equipe labellisée FRM2023, CRBM, Univ. Montpellier, CNRS, Montpellier, France
    Contribution
    Investigation, Methodology
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0009-0009-0535-0505

  3. Florent Cauchois

    1. CRBM, Univ. Montpellier, CNRS, Montpellier, France
    2. Equipe labellisée FRM2023, CRBM, Univ. Montpellier, CNRS, Montpellier, France
    Contribution
    Investigation, Methodology
    Competing interests
    No competing interests declared

  4. Kevin Espie

    1. CRBM, Univ. Montpellier, CNRS, Montpellier, France
    2. Equipe labellisée FRM2023, CRBM, Univ. Montpellier, CNRS, Montpellier, France
    Contribution
    Investigation, Methodology
    Competing interests
    No competing interests declared

  5. Valerie Simon

    CRBM, Univ. Montpellier, CNRS, Montpellier, France
    Contribution
    Resources, Methodology
    Competing interests
    No competing interests declared

  6. Yvan Boublik

    1. CRBM, Univ. Montpellier, CNRS, Montpellier, France
    2. Equipe labellisée FRM2023, CRBM, Univ. Montpellier, CNRS, Montpellier, France
    3. Equipe labellisée LIGUE2020, CRBM, Univ. Montpellier, CNRS, Montpellier, France
    Contribution
    Resources, Methodology
    Competing interests
    No competing interests declared

  7. Francina Langa Vives

    Institut Pasteur, Mouse Genetics Engineering Center, Université Paris Cité, Paris, France
    Contribution
    Resources
    Competing interests
    No competing interests declared

  8. Zeinab Homayed

    IGF, Univ. Montpellier, CNRS, INSERM, Montpellier, France
    Contribution
    Investigation, Methodology
    Competing interests
    No competing interests declared

  9. Conception Paul

    Equipe labellisée LIGUE2022, IGMM, Univ. Montpellier, CNRS, Montpellier, France
    Contribution
    Investigation, Methodology
    Competing interests
    No competing interests declared

  10. Morgan Maillard

    IRCM, Univ. Montpellier, INSERM, Montpellier, France
    Contribution
    Resources, Formal analysis
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0003-0062-2507

  11. Michael Hahne

    Equipe labellisée LIGUE2022, IGMM, Univ. Montpellier, CNRS, Montpellier, France
    Contribution
    Conceptualization, Resources
    Competing interests
    No competing interests declared

  12. Julie Pannequin

    IGF, Univ. Montpellier, CNRS, INSERM, Montpellier, France
    Contribution
    Resources, Methodology
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-9956-373X

  13. Julie Nguyen

    1. CRBM, Univ. Montpellier, CNRS, Montpellier, France
    2. Equipe labellisée FRM2023, CRBM, Univ. Montpellier, CNRS, Montpellier, France
    3. Equipe labellisée LIGUE2020, CRBM, Univ. Montpellier, CNRS, Montpellier, France
    Contribution
    Supervision, Investigation, Methodology
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-8361-0204

  14. Audrey Sirvent

    1. CRBM, Univ. Montpellier, CNRS, Montpellier, France
    2. Equipe labellisée FRM2023, CRBM, Univ. Montpellier, CNRS, Montpellier, France
    3. Equipe labellisée LIGUE2020, CRBM, Univ. Montpellier, CNRS, Montpellier, France
    Contribution
    Conceptualization, Resources, Data curation, Formal analysis, Supervision, Validation, Investigation, Visualization, Methodology, Writing – review and editing
    Contributed equally with
    Serge Roche
    For correspondence
    audrey.sirvent@crbm.cnrs.fr
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0003-4555-6312

  15. Serge Roche

    1. CRBM, Univ. Montpellier, CNRS, Montpellier, France
    2. Equipe labellisée FRM2023, CRBM, Univ. Montpellier, CNRS, Montpellier, France
    3. Equipe labellisée LIGUE2020, CRBM, Univ. Montpellier, CNRS, Montpellier, France
    Contribution
    Conceptualization, Formal analysis, Supervision, Funding acquisition, Validation, Investigation, Methodology, Writing – original draft, Project administration, Writing – review and editing
    Contributed equally with
    Audrey Sirvent
    For correspondence
    serge.roche@crbm.cnrs.fr
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0003-3413-3859

Funding

Fondation pour la Recherche Médicale (FRM2023)

  • Dana Naim
  • Zouheir Houhou
  • Florent Cauchois
  • Kevin Espie
  • Yvan Boublik
  • Julie Nguyen
  • Audrey Sirvent
  • Serge Roche

La Ligue Contre le Cancer (LIGUE2020)

  • Dana Naim
  • Yvan Boublik
  • Julie Nguyen

La Ligue Contre le Cancer (LIGUE2022)

  • Conception Paul
  • Michael Hahne

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

Acknowledgements

We thank the PCEA, ZEFI, Centre d’Ingénierie Génétique Murine, and RHEM platforms animal facilities, immunohistochemistry analyses, Montpellier Rio Imaging (MRI) platform, Valérie PINET, Ethan ALBERT, Hahne’s and PANNEQUIN’s teams, and our colleagues for discussion and technical support. This work was supported by La Ligue Nationale Contre le Cancer (LNCC) through the Labelling Team programs 2017 and 2020, La Fondation pour la Recherche Médicale through the Labelling Team program 2023 and ARC charity. Additional support was provided by the Montpellier SIRIC grant “INCa-DGOS-Inserm 6045,” CNRS, and the University of Montpellier. The MRI platform, a member of the national infrastructure France-BioImaging (https://ror.org/01y7vt929) is supported by the French National Research Agency (ANR-24-INBS-0005 FBI BIOGEN). The RHEM facility is supported by the SIRIC Montpellier Cancer grant INCa_Inserm_DGOS_12553, the European Regional Development Fund and the Occitanie region (FEDER-FSE 2014–2020 Languedoc-Roussillon), and La Ligue Contre le Cancer for processing animal tissues and histology. DN was supported by the Montpellier University and LNCC. SR is an INSERM investigator.

Ethics

Mouse experiments were conducted in strict accordance with the European Community guidelines (86/609/EEC) and the French National Committee for the care and use of laboratory animals (87/848), complied with the ARRIVE guidelines, and were approved by the French Ministry of Higher Education, Research, and Innovation (APAFIS#2022031511382008).

Version history

  1. Preprint posted:
  2. Sent for peer review:
  3. Reviewed Preprint version 1:
  4. Reviewed Preprint version 2:
  5. Version of Record published:

Cite all versions

You can cite all versions using the DOI https://doi.org/10.7554/eLife.110324. This DOI represents all versions, and will always resolve to the latest one.

Copyright

© 2026, Naim et al.

This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.

Metrics

  • 383
    views
  • 16
    downloads
  • 1
    citation

Views, downloads and citations are aggregated across all versions of this paper published by eLife.

Citations by DOI

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Open citations (links to open the citations from this article in various online reference manager services)

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

  1. Dana Naim
  2. Zouheir Houhou
  3. Florent Cauchois
  4. Kevin Espie
  5. Valerie Simon
  6. Yvan Boublik
  7. Francina Langa Vives
  8. Zeinab Homayed
  9. Conception Paul
  10. Morgan Maillard
  11. Michael Hahne
  12. Julie Pannequin
  13. Julie Nguyen
  14. Audrey Sirvent
  15. Serge Roche
(2026)
Slap restricts oncogenic Src-family kinase signaling to maintain colonic epithelial homeostasis
eLife 15:RP110324.
https://doi.org/10.7554/eLife.110324.3

Share this article

https://doi.org/10.7554/eLife.110324

Categories and tags

Research organisms