1. Cell Biology
  2. Immunology and Inflammation

Allosteric disulfide control of ligand binding and endocytosis of KIR2DL4, the natural killer cell receptor for HLA-G

  1. Sumati Rajagopalan
  2. Joyce Chiu
  3. Priyanka Chaurasia
  4. Jinghua Lu
  5. George M Mastorakos
  6. Saurav Majumder
  7. Kristof T Nolan
  8. Jan Petersen
  9. Erin J Adams
  10. Peter D Sun
  11. Jamie Rossjohn
  12. Philip J Hogg
  13. Eric O Long  Is a corresponding author
  1. Molecular and Cellular Immunology Section, Laboratory of Immunogenetics, National Institute of Allergy and Infectious Diseases, National Institutes of Health, United States
  2. Centenary Institute, The University of Sydney, Australia
  3. Infection and Immunity Program and Department of Biochemistry and Molecular Biology, Biomedicine Discovery Institute, Monash University, Australia
  4. Structural Immunology Section, Laboratory of Immunogenetics, National Institute of Allergy and Infectious Diseases, National Institutes of Health, United States
  5. Department of Biochemistry and Molecular Biology, University of Chicago, United States
  6. School of Life Sciences, University of Technology Sydney, Australia
https://doi.org/10.7554/eLife.111018.3
Share this article
Cite this article
  1. Sumati Rajagopalan
  2. Joyce Chiu
  3. Priyanka Chaurasia
  4. Jinghua Lu
  5. George M Mastorakos
  6. Saurav Majumder
  7. Kristof T Nolan
  8. Jan Petersen
  9. Erin J Adams
  10. Peter D Sun
  11. Jamie Rossjohn
  12. Philip J Hogg
  13. Eric O Long
(2026)
Allosteric disulfide control of ligand binding and endocytosis of KIR2DL4, the natural killer cell receptor for HLA-G
eLife 15:RP111018.
https://doi.org/10.7554/eLife.111018.3
  2. Download BibTeX
  3. Download .RIS

eLife Assessment

This important study provides new insights into how extracellular-domain disulfide configurations regulate ligand binding and endocytosis of the natural killer cell receptor KIR2DL4, identifying a conformational switch that provides a mechanistic framework for receptor trafficking. The evidence supporting the main conclusions is solid, with complementary biochemical, structural, and functional approaches providing strong support for alternative disulfide configurations and their role in regulating receptor behavior. The work will be of interest to researchers studying natural killer cell biology, immune receptor signaling, and protein disulfide regulation.

https://doi.org/10.7554/eLife.111018.3.sa0

Abstract

Human Leukocyte Antigen (HLA)-G is selectively expressed by fetal trophoblast cells that encounter maternal natural killer (NK) cells early in pregnancy. In response to HLA-G, the endosomal NK cell receptor KIR2DL4 induces a transcriptional program to support placental development. Structural features of KIR2DL4 that control HLA-G binding and endocytosis are unclear. Random mutagenesis revealed that three cysteines in the first immunoglobulin domain of KIR2DL4 regulate endocytosis and uptake of HLA-G. The atypical Cys10–Cys28 disulfide bond in the KIR2DL4 structure is an allosteric disulfide with potential to switch to a conventional Cys28–Cys74 bond. KIR2DL4 in human cells exists in both disulfide-bonded states, as shown by mass spectrometry analysis. The Cys10–Cys28 bond in a Cys74Ser KIR2DL4 mutant was reduced by protein disulfide isomerase (PDI) in vitro. Inhibition of PDI prevented HLA-G uptake by KIR2DL4 in NK cells. Mutants in the Cys10–Cys28 configuration endocytosed spontaneously but did not bind HLA-G. Conversely, KIR2DL4 with a Cys28–Cys74 bond was detectable at the plasma membrane and internalized soluble HLA-G. A purified Cys10Leu KIR2DL4 mutant bound HLA-G with micromolar affinity in a peptide-dependent manner. Thus, allosteric disulfide-mediated conversion from an inactive to an HLA-G binding form regulates KIR2DL4 trafficking and a functional response that promotes fetal development.

Introduction

Human NK cells play an important role in immune defense and reproduction (Parham and Guethlein, 2018; Cerwenka and Lanier, 2016; Parham and Moffett, 2013). They respond to alterations in healthy cells caused by cellular stress, infection, and malignancy by killing these aberrant cells and producing cytokines and chemokines (Cerwenka and Lanier, 2016). In the context of pregnancy, NK cells, the most abundant lymphocytes at the maternal–fetal interface, are not killers. Instead, they play a constructive role by interacting with and responding to fetal trophoblast cells. Data suggest that a secretory response by NK cells promotes remodeling of the maternal vasculature to support a successful pregnancy (Rajagopalan and Long, 2012a; Vento-Tormo et al., 2018; Li et al., 2024).

NK cells express an array of receptors to sense their environment. Integration of signals from both activatory and inhibitory receptors that interact with ligands on target cells determines NK cell responses (Long et al., 2013). The killer-cell immunoglobulin (Ig)-like receptors (KIR), most of which recognize Human Leukocyte Antigen (HLA) class I molecules, regulate NK cell activation through expression of both inhibitory and activatory KIR family members. KIR2DL4 is a unique member of the KIR family whose expression, unlike other KIR, occurs in most NK cells and is higher in decidual NK cells in early pregnancy (Vento-Tormo et al., 2018; Koopman et al., 2003). KIR2DL4 has two Ig-like domains (termed D0 and D2) and activates a secretory response after engagement by a soluble agonist antibody or by soluble HLA-G (Rajagopalan and Long, 2012b). KIR2DL4 resides mainly in early endosomes and binds soluble HLA-G to stimulate a broad transcriptional response, including an interferon-stimulated gene (ISG) response in primary NK cells that may protect NK cells from pathogens (Rajagopalan et al., 2026). These responses are relevant in the context of early pregnancy where HLA-G expression by fetal trophoblast cells is controlled spatially and temporally as they invade the maternal decidua following implantation of the embryo (Vento-Tormo et al., 2018).

Despite evidence of an endosomal signaling pathway initiated by a KIR2DL4–HLA-G interaction (Rajagopalan, 2010), direct binding of HLA-G to KIR2DL4 protein has not been reported, and previous findings showed no biomolecular interaction (Moradi et al., 2015). Even though KIR2DL4 is required for responses to HLA-G and an agonist antibody to KIR2DL4 is sufficient for activation (Rajagopalan et al., 2001; Rajagopalan et al., 2006), the requirement for a coreceptor for HLA-G-mediated activation of NK cells was not excluded. We recently reported a strong correlation in the transcriptional response of primary NK cells stimulated with soluble HLA-G with their response to the agonist monoclonal antibody #33 (mAb #33), consistent with direct engagement of KIR2DL4 with HLA-G (Rajagopalan et al., 2026). To examine how KIR2DL4 interacts with HLA-G, we chose a random mutagenesis approach and mapped residues in the extracellular domain that are required for a physical and functional interaction with HLA-G. Several independent mutations implicated three cysteine residues in the D0 domain that controlled binding of HLA-G and endocytosis of KIR2DL4. We provide evidence for an allosteric disulfide switch between these three cysteines that regulates both endocytosis and ligand binding. Consistent with this, we show that a purified cysteine mutant of KIR2DL4 in the functional Cys28–Cys74 configuration does in fact bind HLA-G in vitro in a peptide-dependent manner.

Results

Random mutagenesis of KIR2DL4 to map its interaction with HLA-G

Random mutagenesis of a cDNA fragment that encodes the KIR2DL4 extracellular domain was performed using a low-fidelity PCR reaction calibrated to generate approximately 1–2 base changes per 1000 bp (Figure 1—figure supplement 1A). HA-tagged KIR2DL4 with single or double amino acid changes (n = 293) were transfected individually in 293T cells and examined for their ability to bind HLA-G (Figure 1A, Figure 1—figure supplement 1B). Transfected cells were incubated for 2 hr at 37°C with Alexa-594 coupled to an anti-HA-tag antibody and with soluble HLA-G coupled to Alexa-647 (Figure 1—figure supplement 1B). HLA-G had been refolded with the single peptide KGPPAALTL, which was the most abundant peptide eluted from HLA-G obtained from placenta (Walpole et al., 2010; Ishitani et al., 2003). The distribution of KIR2DL4 and of HLA-G was determined by confocal microscopy (Figure 1B). As shown previously (Rajagopalan et al., 2006), soluble HLA-G was endocytosed along with KIR2DL4 into endosomes. As controls, soluble HLA-E coupled to Alexa-647 was not bound nor internalized into KIR2DL4+endosomes, and HLA-G-647 was not internalized in 293T cells expressing an HA-tagged 2B4 (CD244) receptor (Figure 1B). Out of 216 clones with interpretable images of distribution at the plasma membrane or in intracellular vesicular compartments (vesicles), 153 (71%) had a phenotype that resembled wild-type KIR2DL4. The remaining 63 mutants had distinct non-wild-type phenotypes (Figure 1C).

Figure 1 with 1 supplement see all
Download asset Open asset
Random mutagenesis screen.

(A) Soluble HLA-G (sG) is internalized with HA-tagged KIR2DL4 into endosomes, as shown by incubation for 2 hr at 37°C with anti-HA coupled to Alexa-594 and soluble HLA-G coupled to Alexa-647. The loading assay was performed with 293T cells transfected with HA-tagged KIR2DL4. (B) Confocal microscopy showing the location of internalized KIR2DL4 (red) and soluble HLA-G (green). An overlay is shown in the right panel (Merge). As control, HLA-G was replaced by HLA-E, also coupled to Alexa-647 (middle panels). 293T cells transfected with HA-tagged receptor 2B4 were also incubated with HLA-G coupled to Alexa-647 (bottom panels). 2B4 (CD244) resides at the plasma membrane. Scale bar is 10 μm. (C) The loading assay was used to screen KIR2DL4 mutants and test for HLA-G binding. The main parameter measured was presence or absence of HLA-G and location of detectable HLA-G. Confocal images representative of the five categories of mutants are shown. A DIC image is shown in the upper right panel. Scale bar is 10 μm. The parameters indicated under the images include HLA-G presence and location, location of KIR2DL4, the number of mutants in each of the five categories, and an example of a mutation for each category.

The main objective was to identify KIR2DL4 mutants that did not bind HLA-G and were otherwise in vesicles, similar to wild-type KIR2DL4 in the absence of HLA-G (Rajagopalan et al., 2006). Only 7 mutants (out of 63) had that phenotype (Figure 1C, first panel, Source data 1). The more common phenotype of KIR2DL4 mutants that did not bind HLA-G (30 out of 37) was an even distribution at the plasma membrane (Figure 1C, second panel). Mutations with that phenotype were distributed throughout the D0 and D2 Ig domains (Source data 1), consistent with internalization that is controlled by the KIR2DL4 extracellular domain (Rajagopalan et al., 2010).

Two distribution patterns were observed among the 26 mutants that bound HLA-G. Six mutants displayed a hybrid phenotype: colocalization of HLA-G with KIR2DL4 in vesicles, like wild-type, but with some KIR2DL4 remaining at the plasma membrane (Figure 1C, fourth panel), suggesting that internalization of these six mutants was facilitated by HLA-G. To test this, the same mutants were examined in the absence of HLA-G. Results showed that, indeed, they remained at the plasma membrane (Figure 1—figure supplement 1C). The other 20 mutants were detected at the plasma membrane along with HLA-G (Figure 1C, rightmost panel). Overall, these results showed that 50 out of the 63 mutants that had a non-wild-type phenotype (Source data 1) failed to internalize, reinforcing the evidence that KIR2DL4 internalization is controlled by the extracellular domain (Rajagopalan et al., 2010).

The KIR2DL4 D0 domain includes three cysteines at positions 10, 28, and 74. Among the 7 mutants that did not bind HLA-G but resided in vesicles, two included a mutation at Cys74, such as C74W (Figure 1C). This suggested that KIR2DL4 with a Cys10–Cys28 disulfide bond, as seen in the KIR2DL4 crystal structure (Moradi et al., 2015), does not bind HLA-G but is otherwise distributed in vesicles like wild-type KIR2DL4 (Rajagopalan et al., 2006). Conversely, out of the six mutants with a hybrid phenotype, namely distribution at the plasma membrane and in vesicles but colocalization with HLA-G in vesicles only, one had a mutation at Cys10 (C10R). This observation showed that KIR2DL4 with the canonical Ig domain disulfide bond Cys28–Cys74 is detectable at the plasma membrane in the absence of HLA-G (Figure 1—figure supplement 1C, left). This C10R mutant was at the plasma membrane only, demonstrating that its internalization was facilitated by soluble HLA-G. Conversely, we tested if KIR2DL4 mutants retained at the plasma membrane with bound HLA-G, such as P48S (Figure 1C), could internalize on their own. In the absence of HLA-G, mutant P48S was in vesicles (Figure 1—figure supplement 1C, right), showing that, in this case, HLA-G binding caused retention at the plasma membrane.

Several targeted mutations were generated to confirm these results. The phenotypes of mutants C74W and C10R (Figure 1C) were reproduced with targeted mutations C74A and C10S, respectively (Figure 1—figure supplement 1D, and Table 1). These mutations also supported the conclusion that KIR2DL4 with a Cys28–Cys74 bond is detectable at the plasma membrane in the absence of HLA-G. Conversely, HLA-G prevented the internalization of some KIR2DL4 mutants, such as P48S, which otherwise endocytosed spontaneously (Figure 1—figure supplement 1C).

Table 1
Cysteine mutants in the D0 domain of KIR2DL4 and their impact on the distribution of KIR2DL4 and its interaction with HLA-G.

V = vesicular; PM = plasma membrane.

KIR2DL4 Cys mutantsKIR2DL4 locationKIR2DL4 location upon sHLA-G loadsHLA-G locationDisulfide bonds in D0 domain
WTVVV3 possible
C10SPMPM and VVC28–C74
C10APMPM and VV
C10RPMPM and VV
C28SPMPMNoneC10–C74
C28APMPMNone
C28RPMPMNone
C74SVVFew VC10–C28
C74AVVNone
C74RVVFew V
C74WVVNone

An allosteric disulfide bond in KIR2DL4

The impact of cysteine mutations on the localization of KIR2DL4 led us to compare its sequence with that of other D0 domain found in KIR2DL5 and the KIR3DL family (Figure 2A). The cysteine at position 10 of KIR2DL4 is absent in these other KIRs, which have a conserved leucine at that position. The single disulfide bond in those D0 domains is a canonical Ig domain trans-beta sheet bond (Chiu and Hogg, 2019), comparable to the Cys28–Cys79 bond in the D1 Ig domain of KIR2DL1 (Figure 2A, B). Of the three potential disulfide bonds (Cys10–Cys28, Cys28–Cys74, and Cys10–Cys74), the one visible in the KIR2DL4 crystal structure (Moradi et al., 2015) is Cys10–Cys28, leaving a free Cys at position 74 (Figure 2C).

Figure 2
Download asset Open asset
A stressed disulfide bond typical of an allosteric bond in the crystal structure of KIR2DL4.

(A) The KIR2DL4 D0 domain has a third Cys residue not found in other D0 domains. Sequence alignment of D0 domains with Cys residues indicated by an arrow and shown in red. (B) Solvent accessibility of disulfide bonds visible in crystal structures of the first Ig domain of KIRs was determined by the DSSP (define secondary structure of proteins) algorithm. The first Ig domain of KIR2DL4 and KIR3DL1 is a D0 domain, whereas the first Ig domain of KIR2DL1 is a D1 domain. (C) Position of the three Cys residues in the crystal structure of KIR2DL4 (3WYR). Cys10, Cys28, and Cys74 are on the A strand, B strand, and F strand, respectively, as indicated. (D) The disulfide bond configuration in the KIR2DL4 D0 domain corresponds to an –RHstaple.

Disulfide bonds that contribute to protein folding and stabilization tend to be inert and are referred to as structural bonds (Chiu and Hogg, 2019). Labile disulfide bonds that can switch to a reduced form and back to the oxidized bond regulate protein function or localization and are referred to as allosteric bonds (Chiu and Hogg, 2019). Such bonds may be stressed and prone to cleavage (Zhou et al., 2014). Formation of disulfide bonds may be reversed in reducing conditions or by the enzymatic activity of protein disulfide isomerases (PDI). Examination of the Cys10–Cys28 bond in the D0 domain of KIR2DL4, visible in the crystal structure (Moradi et al., 2015), revealed that the second cysteine, Cys28, was partially exposed to solvent (~10A2) (Figure 2B), compatible with a propensity for thiol disulfide exchange mediated by a PDI. By comparison, the disulfide bond in the KIR3DL1 D0 domain (Figure 2B) has low solvent accessibility (~3A2), according to the crystal structure (Vivian et al., 2011). Given that KIR2DL4 may be regulated by an allosteric disulfide bond, we examined the configuration of the Cys10–Cys28 disulfide (Figure 2C). Among the 20 possible disulfide bond conformations, as determined by the geometry of the five dihedral angles that describe the cysteine residue, three of them are characteristic of allosteric bonds (Chiu and Hogg, 2019; Schmidt et al., 2006). The Cys10–Cys28 bond in the KIR2DL4 structure has an archetypal –RHstaple allosteric conformation (Figure 2D), which is characterized by high tensile pre-stress due to stretching of the S–S bond and neighboring α angles (Pijning et al., 2018).

Analysis of disulfide bonds in KIR2DL4

As cysteine mutations in the D0 domain of KIR2DL4 had an impact on internalization and cellular distribution, we determined what disulfide bond out of the three possible (Figure 3A) existed in recombinant KIR2DL4 produced in insect cells. Cysteine pairings for disulfide bonds in recombinant KIR2DL4 were mapped using disulfide-linked peptides and mass spectrometry. The conserved Cys123–Cys172 bond in domain D2 (Figure 3A) served as a reference. In wild-type KIR2DL4, peptides linked by disulfides Cys10–Cys28, Cys10–Cys74, Cys28–Cys74 from D0, and Cys123–Cys172 from D2 were identified and quantified (Figure 3B; Figure 3—figure supplement 1). Cys10–Cys28 was the more abundant bond in D0 and, as expected, was abundant in the C74S mutant and absent in the C10S mutant (Figure 3B). The recovery of the reference Cys123–Cys172 bond in the D2 domain was lower (approximately one third of those in the D0 domain) but, as expected, its abundance was virtually identical in the 3 isoforms of KIR2DL4 (wild-type, C10S, and C74S). The Cys28–Cys74 bond in D0 was detected at a lower abundance than Cys10–Cys28, and as expected, was more abundant in the C10S mutant (Figure 3B). The Cys10–Cys74 bond was detected at a low abundance and was completely absent in the C10S and the C74S mutants (Figure 3B). In conclusion, wild-type purified KIR2DL4 existed in both configurations, Cys10–Cys28 and Cys28–Cys74, representing independent isoforms distinguished by their disulfide bond in the D0 domain (Figure 3B).

Figure 3 with 1 supplement see all
Download asset Open asset
Detection and quantification of disulfide bonds in KIR2DL4 isolated from cells.

(A) Disulfide bonds in KIR2DL4. The Cys10–Cys28 disulfide bond and the unpaired Cys74 in the D0 domain and the stable Cys123–Cys172 disulfide bond in the D2 domain are shown in yellow in the ribbon structure of KIR2DL4. PDB identifier is 3WYR. (B) Quantification of disulfide-linked peptides in recombinant KIR2DL4 by mass spectrometry. Peptide abundance was expressed relative to the peptide linked by Cys123 and Cys172 in the D2 domain. (C) Protocol to determine the redox state of KIR2DL4 disulfide bonds, as measured by differential cysteine alkylation and mass spectrometry. Reduced disulfide bond cysteines in KIR2DL4 were alkylated with 12C-IPA and the oxidized cysteine thiols with 13C-IPA following reduction with dithiothreitol (DTT). The ratio of 12C-IPA to 13C-IPA alkylation represents the proportion of the disulfide bonds in the population that are in the reduced state. (D) Quantification of cysteine redox states in recombinant KIR2DL4 by differential cysteine alkylation and mass spectrometry. (E) Human cell-derived KIR2DL4 was found in both Cys10–Cys28 and Cys28–Cys74 redox states. The redox state of disulfide Cys123–Cys172 served as control. (F) Incubation of purified KIR2DL4 with three different protein disulfide isomerases (PDIs). Reduction of the Cys10–Cys28 bond occurred with PDI at a PDI:KIR2DL4 molar ratio of 2 and 10. The redox state of cysteines was quantified by differential cysteine labeling and mass spectrometry. The error bars (SD) were derived from measurements of two to four peptides. ***p ≤ 0.005 as assessed by unpaired, two-tailed Student's t-test.

Figure 3—source data 1

KIR2DL4 peptides analyzed to determine disulfide bond redox state.

Peptides were detected by Byonic analysis software, confirmed by MS/MS and have errors <6 ppm. Only peptides with peak areas >10 million for a given Cys were included in the analysis. *Cys was labeled with 12C-iodoacetanilide or 13C-iodoacetanilide and is in bold. #Peptide score calculated by Byonic analysis software is a primary indicator of peptide-spectrum matches.

https://cdn.elifesciences.org/articles/111018/elife-111018-fig3-data1-v1.docx
Figure 3—source data 2

Source data for experiments shown in Figure 3B, D, F .

https://cdn.elifesciences.org/articles/111018/elife-111018-fig3-data2-v1.xlsx

The redox state of cysteines in KIR2DL4 purified from insect cells was then determined by differential cysteine alkylation and mass spectrometry (Figure 3C; Figure 3—source data 1). Unpaired or reduced cysteines were first labeled with the cysteine alkylator 12C-IPA. Disulfide bonds were then reduced by dithiothreitol followed by cysteine alkylation with 13C-IPA. The fraction of reduced disulfide bonds was measured from the relative ion abundance of peptides containing 12C-IPA or 13C-IPA (Figure 3C). By this approach, the relative abundance of reduced cysteines in wild-type KIR2DL4 was 32.3%, 4.5%, and 74.3% for Cys10, Cys28, and Cy74, respectively (Figure 3D). Based on these measurements, the calculated abundance of Cys10–Cys28 and Cys28–Cys74 was 67.7% and 25.7%, respectively. This data demonstrated that these two disulfide forms exist in the D0 domain.

Next, we tested if the Cys10–Cys28 and Cys28–Cys74 disulfide pairs existed in KIR2DL4 obtained from human cells, using the same protocol as in Figure 3C, D with the following modifications. Unpaired cysteines on intact 293T-2DL4-gfp cells were first labeled with 12C-IPA, followed by cell lysis, pull-down of KIR2DL4 via the GFP tag, and a second labeling with 12C-IPA prior to elution. Eluted proteins were separated by gel electrophoresis and those with an approximate mass of 75 kDa were isolated. Disulfide bonds were then reduced and the new unpaired cysteines alkylated, this time with 13C-IPA (Figure 3C). The redox states of cysteines were quantified by mass spectrometry analysis. The fraction of reduced disulfide bonds was calculated from the relative ion abundance of peptides containing 12C-IPA and 13C-IPA (Figure 3C). The Cys10–Cys28 and the Cys28–Cys74 forms of KIR2DL4 were detected at a 48.15% and 35.04% relative abundance, respectively (Figure 3E). A KIR2DL4 in the Cys10–Cys74 configuration was not detected, consistent with the very low abundance of reduced Cys28 in recombinant KIR2DL4 (Figure 3D). The structural Cys123–Cys172 bond in the D2 Ig domain was present at an 82.96% relative bonded state, equivalent to the total bonded state of the D0 domain (48% + 35%). We concluded that wild-type KIR2DL4 expressed in human cells exists in both disulfide forms (Cys10–Cys28 and Cys28–Cys74), supporting the possibility of an allosteric transition between the two.

PDI controls endocytosis of KIR2DL4

Given that the disulfide-bonded Cys28 in the KIR2DL4 crystal structure is partially exposed to solvent (Figure 2B), we tested if it was sensitive to cleavage by thiol isomerases. Purified recombinant KIR2DL4 isolated from insect cells was incubated with the three reduced thiol isomerases PDIA1 (P4HB), Erp57 (PDIA3), and thioredoxin (TXN). Major reduction of the Cys10–Cys28 bond but not the Cys28–Cys74 bond was observed in the presence of PDI, but not the other two isomerases (Figure 3F). Therefore, reduction of Cys10–Cys28 by PDI revealed a selectivity at two levels. One is that the Cys28–Cys74 was resistant, suggesting that the Cys10–Cys28 bond is more accessible to PDI. Second, the lack of reduction by the other two isomerases, Erp57 and thioredoxin, suggested that accessibility of the Cys10–Cys28 bond to these isomerases is limited.

So far, our results, including data obtained with an unbiased mutagenesis screen, pointed to a major role of disulfide bonds in the D0 domain of KIR2DL4 for trafficking, and to their regulation by the activity of PDI. Several PDI inhibitors were used to examine the cellular distribution of HA-tagged KIR2DL4 in 293T cells incubated with soluble HLA-G coupled to a fluorophore. Two types of inhibitors were used. The first consisted of two thiol blockers that interact irreversibly with free and exposed thiol groups (DTNB and pCMPS). In untreated cells, KIR2DL4 was found mostly in endocytic vesicles together with soluble HLA-G (Figures 1B and 4A–D). In transfected 293T cells that express a high level of KIR2DL4, some KIR2DL4 was detected. at the plasma membrane. With increasing concentrations of DTNB (Figure 4A) or pCMPS (Figure 4B), the proportion of cells exhibiting KIR2DL4 at the plasma membrane increased. Uptake of HLA-G was sensitive to DTNB and, to a lesser extent, to pCMPS. Incubation with Rutin (quercetin-3-rutinoside), a selective inhibitor of PDI at a concentration that does not inhibit other extracellular thiol isomerases present in the vasculature (Jasuja et al., 2012), had a similar effect as thiol blockade (Figure 4C). Blocking of PDI with a specific antibody inhibited internalization of KIR2DL4 but not as efficiently as thiol blockers (Figure 4D). Thus, blocking the activity of PDI with inhibitors and PDI blockade with an antibody reduced the endocytosis of KIR2DL4 and the amount of HLA-G bound to KIR2DL4.

Figure 4
Download asset Open asset
Location of KIR2DL4 and HLA-G after inhibition of protein disulfide isomerase (PDI).

Confocal microscopy images of 293T cells transfected with HA-KIR2DL4 (anti-HA coupled to Alexa 594, red) and loaded with labeled HLA-G (green) for 2 hr in the presence of DTNB (A), pCMPS (B), Rutin (C), and anti-PDI antibody (D), at the indicated concentrations. The time 0 image in (A) and (B) is the same, and so is the time 0 image shown in (C) and (D). The distribution of KIR2DL4 in vesicles or on the cell surface was determined by scoring at least 200 cells per condition. For images in (A) to (D), scale bar is 10 μm. (E) Confocal microscopy images of primary resting human NK cells loaded with labeled HLA-G (green) for 2 hr in the presence of 1 mM DTNB or 30 μM Rutin. The number of HLA-G positive cells was scored in multiple fields (11–18 fields/condition). (F) Enlarged image of (E) (bottom left) with vesicular localization of HLA-G. Scale bar is 10 μm. (G) Quantification of data obtained from analyzing experiments using NK cells from three different donors.

Figure 4—source data 1

Source data for experiments shown in Figure 4G.

https://cdn.elifesciences.org/articles/111018/elife-111018-fig4-data1-v1.xlsx

We then examined the impact of PDI on HLA-G loading by KIR2DL4 in primary NK cells. Resting, freshly isolated NK cells from three different donors were tested for the effect of PDI inhibition using the thiol blocker DTNB and the inhibitor Rutin at 30 μM, a concentration that is selective for PDI (PDIA1) (Jasuja et al., 2012). Cells were pretreated with inhibitors for 1 hr prior to incubation with soluble HLA-G-Alexa-647 for 2 hr in the continued presence of inhibitor and counted by confocal microscopy for cells that had endocytosed HLA-G (Figure 4E). The fraction of NK cells containing a signal for HLA-G in vesicles (as shown in Figure 4F) was counted in multiple fields for each condition (Figure 4G). Treatment of cells with DTNB resulted in a significant decrease in intracellular HLA-G, as compared to untreated cells. Treatment with Rutin resulted in even stronger inhibition of soluble HLA-G loading (Figure 4G). Thus, inhibition of PDI prevented HLA-G uptake by KIR2DL4 in both transfected 293T cells and in primary NK cells.

Disulfide bonds in KIR2DL4 regulate HLA-G binding, endocytosis, and function

To further evaluate the role of alternative disulfide bonds in the D0 domain and for a comparison of the same cysteine substitutions, each one of the three cysteines in the D0 domain was replaced with a serine. The C10S and the C28S mutants remained mostly at the plasma membrane (Figure 5A), indicating that a Cys28–Cys74 configuration or a Cys10–Cys74 configuration (if it were to exist) did not internalize into vesicles. Conversely, the C74S mutant, which is limited to a Cys10–Cys28 bond, was distributed in intracellular vesicles like wild-type KIR2DL4 (Figure 5A).

Figure 5 with 3 supplements see all
Download asset Open asset
Cysteine mutants in KIR2DL4 tested for their impact on KIR2DL4 distribution.

(A) Distribution (vesicles or plasma membrane) of WT and of the indicated cysteine mutants of KIR2DL4 in transfected 293T cells. (B) Distribution of HLA-G in 293T cells transfected with KIR2DL4 wild-type and with mutations at Cys10. HLA-G was scored for presence or absence in KIR2DL4+ vesicles. (C) Close-up view of the trio of cysteines in the D0 domain of KIR2DL4, as reported in the crystal structure (3WYR, left) and as predicted by AlphaFold (right). (D) Quantitative PCR analysis of IFI44L expression in response to HLA-G stimulation of 293T cells with stable expression of WT, C10S, or C74S KIR2DL4. Baseline IFI44L transcription in untreated cells was set at 1. Data are represented as mean ± SD and are from 8 to 15 independent experiments depending on the cell line. ****p ≤ 0.001; ns, p > 0.05 by Wilcoxon test. (E) Reactivity of the antibodies anti-HA tag, mAb #33, and mAb 2238 with wild-type and the three cysteine mutants of KIR2DL4. (F) Flow cytometry analysis of primary NK cells pretreated with DTNB (1 mM) or Rutin (30 μM) for 1 hr at 37°C and stained for surface expression of KIR2DL4 using mAb 2238 at 4°C in the presence of inhibitor for 30 min, followed by staining with goat anti-mouse secondary antibodies coupled to APC at 4°C for 30 min. Data are represented as median fluorescence units and were acquired with NK cells from five donors tested separately.

Figure 5—source data 1

Source data for experiments shown in Figure 5D.

https://cdn.elifesciences.org/articles/111018/elife-111018-fig5-data1-v1.xlsx

Considering that HLA-G bound to KIR2DL4 in a Cys28–Cys74 configuration, several mutants of Cys10 were tested for their ability to bind and internalize HLA-G. Three substitutions of Cys10 in HA-KIR2DL4 (C10S, C10A, and C10R) transfected into 293T cells were able to bind HLA-G and to internalize as well as wild-type (Figure 5B). There was very little internalization of HA-KIR2DL4 into vesicles without concomitant uptake of HLA-G (Figure 5B), as was seen with wild-type KIR2DL4 (Figure 1B). Therefore, KIR2DL4 with a Cys28–Cys74 disulfide bond behaved as wild-type, as far as HLA-G binding and transport to intracellular vesicles was concerned but failed to internalize on its own. A summary of cysteine mutants and their impact on KIR localization and interaction with HLA-G is shown in Table 1. Each one of the three cysteines was mutated to Ser, Ala, and Arg, which resulted in consistent phenotypes for C10 mutants (internalization induced by soluble HLA-G) and C28 mutants (no HLA-G binding, no internalization), whereas C74 mutants, which included also a Cys to Trp mutation, had either a clear-cut phenotype (internalization and no HLA-G binding with C74W and C74A), or an intermediate phenotype (some HLA-G internalization with C74S and C74R).

The X-ray crystal structure of a KIR2DL4 that had been produced and purified from human cells (Moradi et al., 2015) revealed an unexpected cross-β strand Cys10–Cys28 bond in D0, rather than the canonical cross-β sheet Cys28–Cys74 (Figure 5C). By comparison, AlphaFold 2, a deep learning-based prediction tool to model a protein 3D structure from its amino acid sequence (Varadi et al., 2024; Jumper et al., 2021), predicted a KIR2DL4 structure with a Cys28–Cys74 bond (Figure 5C), loosely supporting the notion that KIR2DL4 can exist in both configurations and consistent with an allosteric transition between two disulfide bonded states.

To determine which of the two configurations of KIR2DL4 is functional, we examined the ability of the C10S and the C74S mutants of KIR2DL4 expressed in 293T cells to generate functional outcomes in response to soluble HLA-G. Recently, single cell transcriptomics of primary NK cells stimulated with HLA-G revealed the induction of an ISG response in the absence of type I interferon (Rajagopalan et al., 2026). This response was recapitulated in HEK293 reporter cells transfected with KIR2DL4 (Rajagopalan et al., 2026). We generated 293T cells stably expressing HA-tagged wild-type (WT), C10S, and C74S KIR2DL4 with a comparable expression level (Figure 5—figure supplement 1). Stimulation of these cells with soluble HLA-G for 16 hr showed that IFI44L transcription was induced in cells expressing WT and C10S but not in cells expressing the C74S mutant (Figure 5D). Therefore, a functional response to soluble HLA-G, such as ISG induction, is triggered by KIR2DL4 with a Cys28–Cys74 bond.

Our agonist mAb #33 and the commercial mAb MAB2238 (mAb 2238) to KIR2DL4 were tested for binding to KIR2DL4 carrying each of the three different Cys mutations. As control, an antibody to the HA-tag fused to the extracellular N-terminus of KIR2DL4 was used (Figure 5E, Figure 5—figure supplement 2). Neither mAb #33 nor mAb 2238 bound to the C28S mutant, presumably misfolded due to the lack of a Cys10–Cys74 disulfide bond, as shown by mass spectrometry (Figure 3E). While they both bound to the C74S mutant, limited to a Cys10–Cys28 bond, only mAb 2238 bound to the C10S mutant, limited to a Cys28–Cys74 bond (Figure 5E). Therefore, mAb #33 does not recognize KIR2DL4 in a Cys28–Cys74 configuration and binds selectively to the Cys10–Cys28 disulfide bonded state (Figure 5E, Figure 5—figure supplement 2).

We tested the binding of mAb #33 and mAb 2238 to KIR2DL4 on primary resting NK cells (Figure 5—figure supplement 3). There was no detectable cell surface staining by mAb #33, indicating that the receptor in the Cys10–Cys28 configuration does not remain at the plasma membrane, but is rapidly endocytosed. This is consistent with our previous work showing that labeled antibody is endocytosed into early endosomes where KIR2DL4 resides (Rajagopalan et al., 2006). In contrast, upon staining with mAb 2238, which recognizes both disulfide forms, a subpopulation of primary NK cells expressed KIR2DL4 at the cell surface, presumably in the Cys28–Cys74 configuration. To test if the cell surface level of receptors in this configuration is sensitive to inhibition of PDI by DTNB and Rutin, we pretreated primary NK cells with inhibitors for 1 hr, followed by staining for cell surface KIR2DL4 using mAb 2238 (Figure 5F). Inhibition of PDI resulted in decreased surface staining of KIR2DL4 by mAb 2238. Since PDI targets the Cys10–Cys28 bond (Figure 3F), our data is consistent with the interpretation that inhibition of PDI prevents the switch from Cys10–Cys28 to the Cys28–Cys74 form, detectable with mAb 2238 only.

Impact of cysteine mutants on KIR2DL4 oligomerization

KIR2DL4, unlike other members of the KIR family, forms dimers and higher-order oligomers in solution (Moradi et al., 2015). Structural analysis of KIR2DL4 revealed distinct intermolecular interfaces that mediate both dimerization and oligomerization. Moreover, the presence of three internal cysteine residues within the KIR2DL4 D0 domain (Cys10, Cys28, and Cys74) resulted in the formation of the non-canonical disulfide bond Cys10–Cys28 (instead of Cys28–Cys74) (Moradi et al., 2015). This alternative disulfide bond arrangement was associated with conformational changes in D0 residues, which are widely conserved in KIR3D D0 domains, suggesting a potential role in regulating KIR2DL4 assembly (Moradi et al., 2015). To investigate this, we tested the consequences of alternative disulfide bonding in the cysteine triad of KIR2DL4. To promote canonical or non-canonical disulfide bonding, respectively, we expressed and purified the KIR2DL4 point mutants C10L and C74S. Notably, both mutants were expressed at similar levels and purified via immobilized metal affinity chromatography (IMAC). However, while wild-type KIR2DL4 eluted as a mixture of oligomers during size exclusion chromatography, KIR2DL4(C10L) behaved as a KIR2DL4 dimer. In contrast, KIR2DL4(C74S) formed soluble aggregates (Figure S6). These observations indicate that the cysteine triad within the KIR2DL4 D0 domain may promote higher-order oligomer formation.

KIR2DL4 binds to the HLA-GVLPH epitope

To investigate HLA-G recognition by KIR2DL4, we conducted surface plasmon resonance (SPR) experiments to measure interactions between KIR2DL4 and HLA-G bound to peptide VLPHETRLL (HLA-GVLPH epitope). While a previous study showed that KIR2DL4 did not interact with the epitopes HLA-GRIIPRHLQL or HLA-GRLPKDFRIL (Moradi et al., 2015), we observed that KIR2DL4 bound to immobilized HLA-GVLPH epitope with an equilibrium dissociation constant (KD) of 19.4 ± 4.00 μM (Figure 6A) but did not interact with the HLA-GVFPTKDVAL or HLA-GRIIP epitope, the latter of which was consistent with our previous report (Figure 6B). These data suggest that KIR2DL4 binds HLA-G epitopes in a peptide-specific manner with binding affinities comparable to those reported for KIR3DL1–HLA interactions (Vivian et al., 2011). We subsequently investigated the ability of oligomerization-deficient KIR2DL4(Cys10Leu) to recognize HLA-GVLPH epitope and measured binding of KIR3DL1 as a negative control.

Figure 6 with 1 supplement see all
Download asset Open asset
Surface plasmon resonance (SPR) affinity measurements.

(A) Representative sensorgrams from single dilution series of KIR2DL4, KIR2DL4 (C10L), and KIR3DL1 binding to HLA-GVPLH (top panel) and interaction analysis of this binding (bottom panel). (B) Analysis of KIR2DL4 and KIR2DL4(C10L) interaction with non-binding epitopes of HLA-G refolded with two other peptides. Error bars denote standard deviation. Equilibrium dissociation constants KD were determined using a 1:1 binding model from two independent experiments performed in duplicate.

Figure 6—source data 1

Summary of surface plasmon resonance (SPR) measurements.

KIR binding to the immobilized HLA-G epitopes was measured in two independent experiments. KD was calculated from all data using one site-specific binding model. N.B., no binding.

https://cdn.elifesciences.org/articles/111018/elife-111018-fig6-data1-v1.docx

Moreover, since native HLA-G forms disulfide-linked dimers, we further examined KIR2DL4(C10L) interactions with the monomeric C42S mutant HLA-G(C42S)VLPH along with wild-type HLA-G (Figure 6A). Our data showed that KIR2DL4(C10L) bound both wild-type HLA-GVLPH and HLA-G(C42S)VLPH with markedly higher affinity than wild-type KIR2DL4, with KD values of 1.59 ± 0.08 and 1.65 ± 0.07 μM, respectively (Figure 6A). However, KIR2DL4(C10L) did not bind to HLA-GVFPT or HLA-GRIIP, showing that KIR2DL4 recognizes the HLA-GVLPH epitope in a peptide-specific manner (Figure 6—source data 1). As previously shown, KIR2DL4 is expressed as a broad distribution of dimers and readily forms higher-order oligomers in a concentration-dependent manner. In contrast, our present data show that the KIR2DL4(C10L) mutant abrogated the formation of higher-order oligomers. Together with its enhanced affinity for HLA-G, these results suggest that oligomerization of KIR2DL4 competes with ligand engagement and may regulate receptor availability for HLA-G recognition.

HLA-G binding is controlled by an allosteric disulfide in the KIR2DL4 D0 domain

Wild-type KIR2DL4 is in the Cys10–Cys28 configuration in the crystal structure (Moradi et al., 2015), whereas a structure predicted by AlphaFold 2 (Varadi et al., 2024; Jumper et al., 2021) is in the Cys28–Cys74 disulfide-bonded form (Figure 7A). When given a C74R mutant of KIR2DL4, AlphaFold predicted a structure similar to that of the crystal (Figure 7—figure supplement 1A). An overlay of the PDB 3WYR structure (purple) and the AlphaFold prediction for wild-type (blue) showed that a loop between the β-strand C and the short α helix in D0 may be different (Figure 7A, blue arrow, and Figure 7B). The side chains of V45 and P46 would be shifted by 5.3 and 5.4 Å, respectively, between the two predicted structures (Figure 7B). Predictions of KIR2DL4 docking with HLA-G by AlphaFold 3 suggested that the side chains of the V45 to P48 loop in the Cys10–Cys28 crystal structure may be too distant to make contacts with HLA-G (Figure 7C), whereas an interaction between HLA-G and KIR2DL4 in the Cys28–Cys74 configuration is more likely (Figure 7D). The structure predicted for a C10R mutant (limited to a Cys28–Cys74 bond) is similar to that obtained for wild-type KIRDL4 (Figure 7—figure supplement 1B). Structures of KIR2DL4–HLA-G complexes obtained experimentally are required to determine how HLA-G distinguishes the D0 domain in the two alternative disulfide bond configurations.

Figure 7 with 1 supplement see all
Download asset Open asset
Predicted outcome of an allosteric disulfide switch on the conformation of KIR2DL4 and its predicted interaction with HLA-G.

(A) Overlay of the crystal structure (3WYR; purple) and the structure predicted by AlphaFold DB (blue). The allosteric disulfide Cys10–Cys28 is in yellow and the Cys28–Cys74 structural disulfide is in green. The region indicated with a blue arrow corresponds to the loop highlighted in B. (B) D0 domain shown with the Pro46–Pro48 loop facing up and pointing toward the predicted HLA-G-binding site. The position of Val45 and Pro46 in the crystal structure (C10–C28; yellow) is overlaid with that in the AlphaFold-predicted structure (C28–C74; green). The distance between Val45 and Pro46 in the crystal structure and their counterpart in the predicted structure of a Cys28–Cys74 KIR2DL4 is 5.3 and 5.4 Å, respectively. (C) Docking of the KIR2DL4 crystal structure (3WYR, pink) with HLA-G (blue), as predicted by AlphaFold 3. (D) Docking of the KIR2DL4 structure predicted by AlphaFold 2 (green) with HLA-G (blue), as predicted by AlphaFold 3. In the Cys28–Cys74 KIR2DL4 bonded form, the Val45–Pro48 loop is in a different orientation, suggesting potential contacts with Met76 and Glu19 of HLA-G.

The conformation of the D2 domain is not predicted to be affected by the disulfide switch in D0, as seen in an overlay of D2 domains for all four structures, the crystal structure (3WYR) and the predicted structures of wild-type, C74R, and C10R KIR2DL4 (Figure 7—figure supplement 1C). Thus, the D2 domain contacts may be preserved regardless of the disulfide bond used in the D0 domain. Taken together with the quantitative and direct binding data, these results support the interpretation that a distant allosteric change – induced by the switch from a Cys10–Cys28 disulfide bond to a canonical Cys28–Cys74 bond in KIR2DL4 – is required for binding of HLA-G.

Discussion

Transcription of HLA-G is turned on in fetal extravillous trophoblast (EVT) cells as they migrate to the fetal–maternal interface and invade the decidua during early pregnancy (Vento-Tormo et al., 2018). The abundant maternal NK cells in the decidua are distinct from those in the blood (Male and Moffett, 2023) and have a unique transcriptional signature, including elevated transcription of KIR2DL4 (Vento-Tormo et al., 2018). As expected for cellular processes that support human reproduction, the encounter of EVT cells with decidual NK cells (dNK) at the maternal-fetal interface is well orchestrated (Vento-Tormo et al., 2018; Moffett and Shreeve, 2023). High transcription of KIR2DL4 in dNK cells is matched by high and selective transcription of HLA-G in EVT cells (Vento-Tormo et al., 2018). EVT cells also upregulate transcription of several matrix metalloprotease genes (Vento-Tormo et al., 2018), including MMP2, which promotes shedding of soluble HLA-G from the plasma membrane (Rizzo et al., 2013; Park et al., 2004). Uptake of soluble HLA-G into NK cells depends on KIR2DL4 and both colocalize in Rab5+ early endosomes from where signaling occurs (Rajagopalan et al., 2006; Rajagopalan et al., 2001; Rajagopalan et al., 2014).

Transmembrane, full-length HLA-G at the cell surface is a ligand for the inhibitory receptor LILRB1 (Shiroishi et al., 2003; Shiroishi et al., 2006), which is selectively expressed by the dNK1 subset of decidual NK cells (Vento-Tormo et al., 2018). Thus, HLA-G at the plasma membrane serves to protect EVT cells from cytotoxic dNK1 cells. A second protective role of HLA-G occurs by the release of a peptide from its signal sequence, which binds HLA-E to form a strong ligand for the inhibitory receptor NKG2A–CD94 (Llano et al., 1998; Lee et al., 1998; Borrego et al., 1998). Therefore, inhibitory signaling through LILRB1–HLA-G and NKG2A–HLA-E interactions together protect EVT cells from NK-mediated killing. At the same time, when EVT cells invade the decidua, soluble HLA-G shed from EVT cells by the activity of MMPs can be taken up by KIR2DL4 into endosomes of dNK cells, thereby bypassing the inhibition by LILRB1 at the plasma membrane. Soluble HLA-G promotes a secretory response in NK cells to support vascular remodeling, and a broad transcriptional response with a clear ISG signature (Rajagopalan and Long, 2012a; Rajagopalan et al., 2026).

To investigate how KIR2DL4 interacts with HLA-G, a random mutagenesis approach was chosen to generate a library of KIR2DL4 mutants that were then tested for their ability to endocytose soluble HLA-G. This analysis revealed that binding and uptake of soluble HLA-G into endosomes was regulated by a trio of cysteine residues in the first Ig domain of KIR2DL4, called D0. In addition to the Cys28–Cys74 disulfide bond typical of Ig domains, such as the D0 domains of KIR2DL5 and KIR3DL1, a third cysteine is present at position 10 in KIR2DL4. The only KIR2DL4 structure reported so far has the atypical Cys10–Cys28 bond, leaving a free cysteine at position 74 (Moradi et al., 2015). The purified receptor containing this bond did not bind HLA-G (Moradi et al., 2015). KIR2DL4 mutations at Cys10, which leave the D0 domain with the Cys28–Cys74 bond as the only option, remained at the plasma membrane and internalized in response to soluble HLA-G. Thus, proper KIR2DL4 function depends on a switch from one disulfide bond to another (Cys10–Cys28 to Cys28–Cys74), keeping Cys28 as a partner for either Cys10 or Cys74.

We noticed that the Cys10–Cys28 bond in the KIR2DL4 crystal structure (Moradi et al., 2015) has a –RHstaple conformation, which is a signature of allosteric bonds having an inherent high bond stress that predisposes them to cleavage (Pijning et al., 2018). KIR2DL4 in human cells was found to exist in both disulfide configurations, and the allosteric Cys10–Cys28 bond was reduced in vitro by the thiol disulfide oxidoreductase PDI. As expected, if PDI activity is required to maintain a pool of Cys28–Cys74 KIR2DL4 at the plasma membrane (by reducing Cys10–Cys28 bonds), thiol blockade with membrane impermeable DTNB or inhibition of PDI with Rutin or a PDI-specific mAb did prevent HLA-G binding. AlphaFold predictions of KIR2DL4 folding suggest that a switch from Cys10–Cys28 to a Cys28–Cys74 disulfide bond may cause an allosteric change at a distant loop in D0 (Val45 to Pro48). In the Cys10–Cys28 configuration of KIR2DL4, the Val45 to Pro48 stretch may be oriented in a way not suited for HLA-G binding. Conversely, KIR2DL4 in the Cys28–Cys74 configuration is predicted to have the Val45 to Pro48 loop closer to HLA-G. The previously reported lack of binding of purified KIR2DL4 with HLA-G in vitro (Moradi et al., 2015) may be explained by the incompatibility of a Cys10–Cys28 bonded KIR2DL4 with HLA-G binding.

Direct binding of HLA-G to KIR2DL4 was demonstrated by SPR with purified soluble KIR2DL4 and HLA-G associated with peptide VLPHETRLL. However, binding was undetectable with two other peptides tested, suggesting a strong dependence of KIR2DL4 on the sequence of the peptide used to refold HLA-G. Wild-type KIR2DL4 bound to HLA-GVLPHETRLL with a KD of 19 μM. Consistent with the KIR2DL4 mutagenesis study, stronger binding, with a KD of 1.6 μM, was achieved with a purified Cys10Leu KIR2DL4 mutant (in a Cys28–Cys74 configuration). In addition, homo-dimerization of HLA-G via the free Cys42 was not required for binding to KIR2DL4, since a monomeric HLA-G with the Cys42Ser mutation that prevents dimer formation bound KIR2DL4 just as well as wild-type HLA-G.

Of interest, the peptide KGPPAALTL associated with HLA-G for our cellular assays was the most abundant peptide eluted from HLA-G from the placenta (Ishitani et al., 2003). It is derived from the protein encoded by EBI3, itself one of the strongly upregulated genes in invading EVT cells (Vento-Tormo et al., 2018). A structure of HLA-GKGPPAALTL showed a peptide bound in a linear manner with a relatively low solvent accessibility (Walpole et al., 2010). Rules that dictate HLA-G binding to KIR2DL4 await further studies and structures of KIR2DL4–HLA-G complexes.

The regulation of a KIR2DL4–HLA-G interaction by an allosteric disulfide that controls protein conformation provides yet another example of disulfide bonds serving as switches in protein function. Allosteric disulfides regulate diverse biological processes, such as hemostasis (tissue factor F3, platelet fibrinogen receptor integrin αIIb-β3, and von Willebrand factor) and viral infection (HIV-1 gp120) (Chiu and Hogg, 2019). Allosteric disulfide bonds specifically targeted by extracellular PDI at the cell surface have been identified in proteins such as GP1bα, tissue factor (F3), integrin αvβ3 during thrombosis, and HIV-1 envelope gp120 when bound to CD4 during viral entry (Chiu et al., 2015; Matthias et al., 2002).

KIR2DL4, the only KIR gene family member expressed by all human NK cell subsets, with a high transcription rate in dNK cells, joins the list of proteins whose function is controlled by a labile disulfide bond acting as a switch, but here in the context of early pregnancy. In response to fetal HLA-G, NK cells endocytose soluble HLA-G bound to KIR2DL4, which signals from endosomes for a secretory response that leads to a sustained secretion of factors to support vascular remodeling and fetal development (Rajagopalan and Long, 2012a; Rajagopalan et al., 2010). In addition, NK cells mount an ISG transcriptional response upon endocytosis of HLA-G, which could protect them from viral infection during pregnancy (Rajagopalan et al., 2026). In this unique environment at the maternal–fetal interface, the allosteric disulfide bond regulates KIR2DL4 localization, binding to HLA-G, and signaling to enable the supportive role of NK cells for a successful pregnancy.

Materials and methods

Materials availability statement

Request a detailed protocol

All materials can be shared through a material transfer agreement.

Cells and reagents

Request a detailed protocol

HEK293T cells (here called 293T), negative for mycoplasma contamination, were obtained directly from the American Type Culture Collection, and cultured in Iscoves Modified Dulbecco’s medium (IMDM) containing 10% fetal calf serum. KIR2DL4*001 with a single polymorphism in residue Glu101 to Gly (GenBank accession number DQ266438) was used in this study (unless otherwise indicated). KIR2DL4 and receptor 2B4 (CD244) were tagged at the N-terminus with the HA-tag peptide YPYDVPDYA present in the pDisplay expression vector. 293T–2DL4-gfp cells were generated as described (Rajagopalan et al., 2006). Briefly, 293T–2DL4-gfp cells were made by transfecting 293T cells using LipofectAMINE 2000, with a KIR2DL4 cDNA fused to green fluorescence protein (GFP) in the vector pBABE (puro) CMV+ using SalI and BamH1 sites. Transfected cells were selected and maintained in IMDM containing puromycin at 2 μg/ml. Primary NK cells from healthy human donors were isolated as follows: Peripheral blood samples from deidentified healthy US adults were obtained from the NIH Department of Transfusion Medicine under an NIH Institutional Review Board-approved protocol (99-CC-0168) with informed consent. Peripheral blood mononuclear cells were isolated by separating lymphocytes with Lymphocyte Separation Medium (MP Biomedical), after which non-NK cells were removed using the NK cell isolation kit (STEMCELL Technologies) supplemented with anti-CD3 beads. The purity of isolated resting NK cells was determined by flow cytometry. Cells that were >95% CD3−, CD14−, CD16+, CD56+, CD69−, ILT2−, and NKp46+ were used. Primary NK cells were stimulated with HLA-G (2 μM) for 16 hr at 37°C. Recombinant HLA-G and HLA-E were obtained from the Immune Monitoring Services, Fred Hutchinson Cancer Center (Seattle, WA). Briefly, MHC heavy chain protein and β2-microglobulin (β2m) were produced in E. coli and purified from inclusion bodies. The HLA-G heavy chain and β2m proteins were refolded in vitro in the presence of peptide KGPPAALTL into a monomeric peptide-MHC complex. For HLA-E, refolding was done in the presence of peptide VMAPRTLFL. Monomers of the refolded p-MHC were purified by FPLC size exclusion chromatography and concentrated to 1 mg/ml. Soluble HLA-G and HLA-E were labeled using the Alexa Fluor 647 Protein Labeling Kit (Cat #: A20173, Molecular Probes, Thermo Fisher). mAb #33 was produced in our laboratory (Rajagopalan et al., 2001) and MAB2238 was obtained from RnD Systems.

Random mutagenesis screen

Request a detailed protocol

Random mutagenesis of the KIR2DL4 sequence spanning amino acids 1–208, consisting of the Ig domains D0 and D2 and a portion of the stem was carried out using the Diversify PCR Random Mutagenesis kit (Clontech, Cat#630703) according to the manufacturer’s instructions. HA-tagged KIR2DL4 expressed in pDisplay served as the DNA template. The primers used at 10 mM for PCR were as follows: sense: CCTGCTATGGGTACTGCTGCTCTGGGTTCC; antisense: GAAGGGGAGGATGGTGAAGAGGATGATGGC. Mn2+at 80 mM and dGTP at 40 mM were used to obtain the desired mutation rate of 1–2 mutations per kb of DNA. Thermal cycling conditions consisted of denaturation at 94° for 30 s, followed by annealing at 94°C for 30 s and extension at 68°C for 1 min for a total of 25 cycles. Mutated KIR2DL4 was cloned back into pDisplay, and clones were sequenced to select for single or double amino acid substitutions and remove frame shifts and stop codons. One μg of each mutant plasmid was transiently transfected into 293T cells using LipofectAMINE 2000 according to manufacturer’s instructions. After 36 hr, cells were trypsinized and plated at a density of 7 × 104 cells/well in 8-well coverglass slides (Nunc Lab-Tek, Thermo Fisher Scientific) 18 hr prior to loading with anti-HA antibody or HLA-G. Cells were incubated with 0.03 mM anti-HA Ab coupled to Alexa 594 (Biolegend) and 0.04 mM HLA-G coupled to Alexa 647 for 2 hr at 37°C. Cells were then washed in PBS and viewed by microscopy using a Zeiss 780 confocal microscope. The majority of mutants behaved like the wild-type KIR2DL4. Every mutant with a distinct phenotype was tested again, as above, after a new transfection, to confirm their phenotype.

Confocal microscopy

Request a detailed protocol

Image acquisition was performed using a LSM 780 confocal laser scanning microscope (Zeiss) fitted with a LD C-Apochromat 40×/1.1 W Corr objective. Cells were incubated at 37°C in 5% CO2 for the entire image acquisition duration. The HFT 543 and 633 nm main beam splitters were used to detect signals from fluorophores Alexa-Fluor 594 and 647, respectively. Parameters were set to acquire at a fixed pixel density of 512 × 512, 16-bit pixel depth, and pinhole size of 100 μm. Images were processed, and colocalization coefficients were calculated using Zeiss ZEN software. Quantification of receptor and ligand localization was performed as follows. In transfected 293T cells expressing fluorescently tagged proteins, cells were viewed in a series of multiple fields using the LSM 780. Cells in each field were counted and categorized based on the location and ligand colocalization status of the expressed receptor. Counts were averaged over two to four experiments, and the number of cells counted per sample ranged from 100 ≤ n ≤ 430. In a typical transfection with wild-type KIR2DL4, approximately 80% of the transfected cells had clear signals for internalized HLA-G and KIR2DL4 in the same intracellular, punctate compartments, and the remaining 20% had low but detectable KIR2DL4 at the plasma membrane but no HLA-G. Primary NK cells, loaded with recombinant soluble HLA-G labeled with Alexa 647 for 2 hr were viewed in multiple fields, and HLA-G positive NK cells were counted as a fraction of all the NK cells in the field. The percentage of HLA-G loaded cells/field was calculated using NK cells from three different donors tested separately.

Thiol blockade and PDI inhibition assays

Request a detailed protocol

In 8-well coverglass slides, 293T cells transfected with HA-2DL4 were preincubated in IMDM containing DTNB (5,5′-Dithiobis 2-nitrobenzoic acid; Sigma), pCMPS (para-chloromercuriphenylsulfonate; Carbosynth), Rutin (Sigma), or anti-PDI antibody RL90 (Thermo Fisher) at varying concentrations for 1 hr at 37°C. Anti-HA-594 and HLA-G-647 were then added and incubated for 2 hr in the continued presence of inhibitor at 37°C. Cells were then washed twice with PBS and analyzed by confocal microscopy as described above. Primary NK cells were placed in eight well coverglass slides and preincubated in IMDM containing 1 mM DTNB or 30 μM Rutin for 1 hr at 37C. HLA-G-Alexa 647 was then added and incubated for 2 hr in the continued presence of inhibitor at 37°C. Cells were then washed twice with PBS and analyzed by confocal microscopy as described above. Primary NK cells were also tested by flow cytometry for the effect of DTNB and Rutin (pretreated as described above for 1 hr at 37°C) on surface expression of KIR2DL4 by staining with primary antibodies mAb #33 and mAb 2238 at 4°C, followed by staining with secondary goat anti-mouse antibodies coupled to Alexa 488 at 4°C. Stained cells were analyzed on a Cytoflex flow cytometer (Beckman).

Quantification of cysteine redox states

Request a detailed protocol

GFP-tagged KIR2DL4 expressed in 293T cells was immunoprecipitated from cell lysates using ChromTek-GFP Trap Agarose (Proteintech). Free thiols were labeled with 2-iodo-N-phenylacetamide (12C-IPA) followed by cell lysis, immunoprecipitation of KIR2DL4-GFP, and a second 12C-IPA labeling of proteins prior to elution. KIR2DL4-GFP immunoprecipitated from cells was analyzed on SDS–PAGE. Proteins within the size range of KIR2DL4-GFP (75 kDa) were excised from the gel area, reduced with dithiothreitol, and reduced thiols were alkylated with 13C-IPA. The redox states of cysteines were quantified by mass spectrometry analysis. Reactions were stopped by adding 5% (vol/vol) formic acid, and peptides were eluted from the gel slices with 5% formic acid and 50% (vol/vol) acetonitrile. Peptides were desalted using Ziptip (Millipore), dried, and reconstituted in 0.1% formic acid. Using a Thermo Fisher Scientific Ultimate 3000, peptides were injected and resolved on a 35 cm × 75 mm C18 reverse phase analytical column with integrated emitter using a 2–35% acetonitrile over 22 min with a flow rate of 300 nl/min. The peptides were ionized by electrospray ionization at +2.0 kV. Tandem mass spectrometry analysis was carried out on a Q-Exactive Plus mass spectrometer (Thermo Fisher Scientific) using Higher-energy Collisional Dissociation fragmentation. The data-dependent acquisition method acquired MS/MS spectra of the top 5 most abundant ions at any one point during the gradient. The data was searched using Mascot (Matrix Science) against Uniprot database. Search parameters were as follows: precursor tolerance of 6 ppm and product ion tolerances of ±0.4 Da. Oxidized Met, pyro-Glu, and pyro-Gln were selected as variable modifications with full chymotryptic cleavage of up to three missed cleavages. To calculate ion abundance of peptides, extracted ion chromatograms were generated using the XCalibur Qual Browser software (v2.1.0; Thermo Scientific). The area was calculated using the automated peak detection function built into the software. Abundance of disulfide-linked peptides was expressed as a ratio relative to disulfide-linked peptide between Cys123–Cys172 in the D2 domain. Disulfide bond analysis was performed using the Disulfide bond Analysis Tool (http://52.142.47.78/disulfideanalysis/).

Recombinant KIR2DL4 protein (WT, C10S, and C74S) was produced in insect cells and purified by His-tag affinity chromatography. The extracellular domain of KIR2DL4*001 (residues 1–195) was subcloned into the pAC insect expression vector in frame with an N-terminal 8× HisTag and a 3C protease cleavage site. The KIR2DL4 expression vector was then transfected with BestBac 2.0 linearized DNA (Expression Systems) into Sf9 cells to generate P1 virus. Virus was amplified by shaking culture in Sf9 cells prior to expression. KIR2DL4 was then expressed in BTI-Tn-5B1-4 insect cells (High Five) and purified using Ni-NTA affinity purification followed by Superdex 200 size exclusion into 10 mM HEPES, 150 mM NaCl, pH 7.2. Fractions containing the purified protein were verified by SDS–PAGE. Recombinant thiol isomerases PDI (PDIA1), ERp57 (PDIA3), and thioredoxin (TXN) were expressed in E. coli and purified by His-tag affinity chromatography. The thiol isomerases were then reduced with final 10 mM dithiothreitol for 30 min at 25°C and desalted into PBS using a Zeba spin column (Thermo Fisher Scientific). KIR2DL4 (3 mg) was treated with either a two- or a tenfold molar excess of each thiol isomerase for 30 min at 25°C. Free thiols in KIR2DL4 were alkylated with 5 mM 2-iodo-N-phenylacetamide (12C-IPA), and the protein was resolved on non-reducing SDS–PAGE, stained with Bio-Safe Coomassie stain, and destained in deionized water. Bands corresponding to KIR2DL4 were excised, dried, incubated with 40 mM dithiothreitol, and washed. The fully reduced proteins were alkylated with 5 mM 13C-IPA. The gel slices were washed and dried before digestion of proteins with 12 ng/ml of chymotrypsin (Roche) in 25 mM NH4CO2 containing 10 mM CaCl2 overnight at 25°C. Peptides were eluted from the slices with 5% formic acid and 50% acetonitrile. Peptides were desalted using Ziptips (Merck Millipore). Liquid chromatography, mass spectrometry, and data analysis were performed as described (Chiu, 1967; Passam and Chiu, 2019). The fraction of reduced disulfide bond was measured from the relative ion abundance of peptides containing 12C-IPA and 13C-IPA. To calculate ion abundance of peptides, extracted ion chromatograms were generated using the XCalibur Qual Browser software (v2.1.0; Thermo Fisher Scientific). The area was calculated using the automated peak detection function built into the software. The ratio of 12C-IPA and 13C-IPA alkylation represents the fraction of the cysteine in the population that is in the reduced state (Chiu, 1967). The mass spectrometry proteomics data have been deposited to the ProteomeXchange Consortium via the PRIDE partner repository (Perez-Riverol et al., 2025) with the dataset identifier PXD083525.

Site-directed mutagenesis

Request a detailed protocol

Engineered mutations of KIR2DL4 in the pDisplay vector were carried out using the QuikChange site-directed mutagenesis kit (Stratagene) according to the manufacturer’s instructions and verified by sequencing. Stable transfections of cysteine mutants of KIR2DL4 were carried out using Lipofectamine 2000 according to the manufacturer’s instructions and selected using 1 μg/ml puromycin. Transfected cells were sorted by flow cytometry to select transfectants with uniform expression of the HA-tag.

q-PCR analysis

Request a detailed protocol

Total RNA was extracted using RNeasy Plus Micro Kit from QIAGEN (Cat#74034). 1 μg of total RNA was used to prepare cDNA using iScript cDNA Synthesis Kit (Bio-Rad Cat# 1708891). Each RT-q-PCR assay was done in triplicate with 10 ng of cDNA/assay and detected in CFX Connect Real-Time System from Bio-Rad using the manufacturer’s recommended standard thermal cycling protocol. Briefly, polymerase activation and DNA denaturation was done at 95°C for 3 min, denaturation at 95°C for 10 s, and annealing/extension at 55°C for 30 s. Amplification of IFI44L gene was done for 39 cycles. ACTB was used as the housekeeping reference gene. Relative expression was calculated using 2^(average housekeeping gene – average experimental gene), and results are presented as fold induction (HLA-G-stimulated/untreated control).

Protein production and surface plasmon resonance measurements

Request a detailed protocol

DNA sequences encoding KIR2DL4*001, KIR2DL4*001(Cys10Leu), and KIR3DL1*001 and an N-terminal His6-Tag were cloned into the pHLsec vector and expressed in Human Embryonic Kidney (HEK) Expi293F cells (Gibco). Culture supernatants were dialyzed against HBS500 buffer (10 mM HEPES pH 7.5, 500 mM NaCl), and proteins were subsequently purified via IMAC and size exclusion chromatography as previously described (Moradi et al., 2015; Vivian et al., 2011). Wild-type and Cys42Ser mutant of HLA-G were produced and purified as previously described (Clements et al., 2005). Briefly, wild-type HLA-G and HLA-G(Cys42Ser) alpha chain with C-terminal BirA biotinylation signal, as well as human β2M, were separately expressed and isolated from E. coli as inclusion bodies. HLA-G complexes were obtained by refolding HLA-G BirA alpha chains, β2M, along with CMV pp65 protein epitopes pp65-2 (VLPHETRLL) and pp65-6 (VFPTKDVAL) (Lenfant et al., 2003), and H2A peptide (RIIPRHLQL) (Clements et al., 2005) under the denaturing conditions at 4°C for 2 days. Proteins were dialyzed against 10 mM Tris, pH 8.0, and purified using DEAE and Hitrap-Q ion-exchange chromatography. Purified HLA-G complexes were concentrated and biotinylated using BirA ligase and further purified via S200 size-exclusion chromatography. SPR measurements were performed on a BIAcore T200 instrument (GE Healthcare) at 25°C in 10 mM HEPES (pH 7.5), 300 mM NaCl, 0.005% surfactant P20, as described (Chaurasia et al., 2021). Wild-type and Cys42Ser HLAG-BirA loaded with pp65-VLPHETRLL epitope and HLA-A2S269–277 as negative control were immobilized at a flow rate of 5 μl/min on a streptavidin sensor chip (Cytiva). Binding interactions were determined by passing serial dilutions of KIR protein with a maximum concentration of 100 μM over immobilized HLA complexes at a flow rate of 10 μl/min for 60 s, followed by 300 and 120 s dissociation time for wild-type KIR2DL4 and KIR2DL4 (Cys10Leu) or KIR3DL1, respectively. Two independent experiments with two replicates were performed for each KIR, and equilibrium dissociation constants KD were determined by fitting a single-site binding model to the data.

Data availability

The mass spectrometry proteomics data have been deposited to the ProteomeXchange Consortium via the PRIDE partner repository with the dataset identifier PXD083525. All other data generated or analyzed during this study are included in the manuscript and supporting files; source data files have been provided for the relevant figures.

The following data sets were generated
    1. Chiu J
    2. Hogg P
    (2026) PRIDE
    ID PXD083525. Allosteric disulfide control of ligand binding and endocytosis of KIR2DL4, the natural killer cell receptor for HLA-G.
    https://www.ebi.ac.uk/pride/archive/projects/PXD083525

References

    1. Lee N
    2. Goodlett DR
    3. Ishitani A
    4. Marquardt H
    5. Geraghty DE
    (1998)
    HLA-E surface expression depends on binding of TAP-dependent peptides derived from certain HLA class I signal sequences
    Journal of Immunology 160:4951–4960.

Article and author information

Author details

  1. Sumati Rajagopalan

    Molecular and Cellular Immunology Section, Laboratory of Immunogenetics, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Rockville, United States
    Contribution
    Conceptualization, Formal analysis, Supervision, Investigation, Methodology, Writing – original draft, Writing – review and editing
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0009-0002-7690-2767

  2. Joyce Chiu

    Centenary Institute, The University of Sydney, Sydney, Australia
    Present address
    Hematology Research Center, School of Clinical Medicine, University of New South Wales, Sydney, Australia
    Contribution
    Formal analysis, Investigation, Methodology, Writing – review and editing
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0001-8910-8664

  3. Priyanka Chaurasia

    Infection and Immunity Program and Department of Biochemistry and Molecular Biology, Biomedicine Discovery Institute, Monash University, Clayton, Australia
    Contribution
    Investigation, Writing – review and editing
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-3755-159X

  4. Jinghua Lu

    Structural Immunology Section, Laboratory of Immunogenetics, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Rockville, United States
    Contribution
    Data curation, Visualization
    Competing interests
    No competing interests declared

  5. George M Mastorakos

    Molecular and Cellular Immunology Section, Laboratory of Immunogenetics, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Rockville, United States
    Present address
    Scienza Health, Inc, Newport Beach, United States
    Contribution
    Formal analysis, Investigation, Methodology
    Competing interests
    No competing interests declared

  6. Saurav Majumder

    Molecular and Cellular Immunology Section, Laboratory of Immunogenetics, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Rockville, United States
    Present address
    Center for Blood Oygen Transport and Hemostasis, University of Maryland School of Medicine, Baltimore, United States
    Contribution
    Investigation
    Competing interests
    No competing interests declared

  7. Kristof T Nolan

    Department of Biochemistry and Molecular Biology, University of Chicago, Chicago, United States
    Present address
    AstraZeneca, Gaithersburg, United States
    Contribution
    Resources, Investigation
    Competing interests
    No competing interests declared

  8. Jan Petersen

    Infection and Immunity Program and Department of Biochemistry and Molecular Biology, Biomedicine Discovery Institute, Monash University, Clayton, Australia
    Contribution
    Supervision, Writing – review and editing
    Competing interests
    No competing interests declared

  9. Erin J Adams

    Department of Biochemistry and Molecular Biology, University of Chicago, Chicago, United States
    Contribution
    Supervision, Funding acquisition
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-6271-8574

  10. Peter D Sun

    Structural Immunology Section, Laboratory of Immunogenetics, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Rockville, United States
    Contribution
    Supervision, Funding acquisition
    Competing interests
    No competing interests declared

  11. Jamie Rossjohn

    Infection and Immunity Program and Department of Biochemistry and Molecular Biology, Biomedicine Discovery Institute, Monash University, Clayton, Australia
    Contribution
    Supervision, Funding acquisition, Project administration, Writing – review and editing
    Competing interests
    No competing interests declared

  12. Philip J Hogg

    1. Centenary Institute, The University of Sydney, Sydney, Australia
    2. School of Life Sciences, University of Technology Sydney, Sydney, Australia
    Contribution
    Supervision, Funding acquisition, Methodology, Writing – review and editing
    Competing interests
    No competing interests declared

  13. Eric O Long

    Molecular and Cellular Immunology Section, Laboratory of Immunogenetics, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Rockville, United States
    Contribution
    Conceptualization, Supervision, Funding acquisition, Writing – original draft, Project administration, Writing – review and editing
    For correspondence
    elong@nih.gov
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-7793-3728

Funding

National Institutes of Health (ZIA AI000525)

  • Eric O Long

National Institute of Allergy and Infectious Diseases (RO1 AI170952)

  • Erin J Adams

NSW Cardiovascular Research Capacity Program (Senior Researcher Grant)

  • Philip J Hogg

National Health and Medical Research Council (2008981)

  • Jamie Rossjohn

National Health and Medical Research Council (2026631)

  • Philip J Hogg

National Heart Foundation of Australia (110585-2025)

  • Joyce Chiu

St George and Sutherland Medical Research Foundation (RG254054)

  • Joyce Chiu

The funders had no role in study design, data collection, and interpretation, or the decision to submit the work for publication.

Acknowledgements

We thank the Department of Transfusion Medicine at NIH for blood samples and Joseph Brzostowski at the Twinbrook Imaging Center (NIAID) for assistance with confocal microscopy. This research was supported by grant ZIA AI000525 (EOL) from the Intramural Research Program (IRP) of the National Institutes of Health (NIH). It was also supported by grant RO1 AI170952 (EJA) from NIAID, NIH; the National Health and Medical Research Council of Australia grants 2008981 (JR) and 2026631 (PJH); a Senior Researcher Grant from the NSW Cardiovascular Research Capacity Program (PJH); the Heart Foundation Vanguard Grant 110585-2025 (JC), and St George and Sutherland Research Medical Foundation Standard Grant RG254054 (JC). The contributions of the NIH authors were made as part of their official duties as NIH federal employees, are in compliance with agency policy requirements, and are considered Works of the United States Government. However, the findings and conclusions presented in this paper are those of the authors and do not necessarily reflect the views of the NIH or the U.S. Department of Health and Human Services.

Ethics

Peripheral blood samples from deidentified healthy adults were obtained from the National Institutes of Health (NIH) Department of Transfusion Medicine under an NIH Institutional Review Board approved protocol (99-CC-0168) with informed consent.

Version history

  1. Sent for peer review:
  2. Preprint posted:
  3. Reviewed Preprint version 1:
  4. Reviewed Preprint version 2:
  5. Version of Record published:

Cite all versions

You can cite all versions using the DOI https://doi.org/10.7554/eLife.111018. This DOI represents all versions, and will always resolve to the latest one.

Copyright

This is an open-access article, free of all copyright, and may be freely reproduced, distributed, transmitted, modified, built upon, or otherwise used by anyone for any lawful purpose. The work is made available under the Creative Commons CC0 public domain dedication.

Metrics

  • 497
    views
  • 37
    downloads
  • 0
    citations

Views, downloads and citations are aggregated across all versions of this paper published by eLife.

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Open citations (links to open the citations from this article in various online reference manager services)

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

  1. Sumati Rajagopalan
  2. Joyce Chiu
  3. Priyanka Chaurasia
  4. Jinghua Lu
  5. George M Mastorakos
  6. Saurav Majumder
  7. Kristof T Nolan
  8. Jan Petersen
  9. Erin J Adams
  10. Peter D Sun
  11. Jamie Rossjohn
  12. Philip J Hogg
  13. Eric O Long
(2026)
Allosteric disulfide control of ligand binding and endocytosis of KIR2DL4, the natural killer cell receptor for HLA-G
eLife 15:RP111018.
https://doi.org/10.7554/eLife.111018.3

Share this article

https://doi.org/10.7554/eLife.111018

Categories and tags

Research organism