SETD6-mediated methylation of PPARγ establishes a transcriptional feedback circuit promoting lipid accumulation in liver-derived cells
eLife Assessment
This manuscript presents important new findings showing that the transcription factor and regulator of lipid and glucose metabolism PPARγ is methylated by the enzyme SETD6. The data convincingly demonstrate that methylation of PPARγ by SETD6 regulates its function in controlling transcription of lipid storage and metabolism genes and thereby modulates lipid accumulation in liver cells. This work uncovers a new role for post-translational modulation by lysine methylation in controlling transcription factor activity and lipid metabolism in a relevant physiological context.
https://doi.org/10.7554/eLife.111542.3.sa0Important: Findings that have theoretical or practical implications beyond a single subfield
- Landmark
- Fundamental
- Important
- Valuable
- Useful
Convincing: Appropriate and validated methodology in line with current state-of-the-art
- Exceptional
- Compelling
- Convincing
- Solid
- Incomplete
- Inadequate
During the peer-review process the editor and reviewers write an eLife Assessment that summarises the significance of the findings reported in the article (on a scale ranging from landmark to useful) and the strength of the evidence (on a scale ranging from exceptional to inadequate). Learn more about eLife Assessments
Abstract
Peroxisome proliferator-activated receptor gamma (PPARγ) is a key transcriptional regulator of genes mediating adipogenesis (fat-cell differentiation), and lipid storage in several cell types like hepatocytes. As such, its regulation is crucial for cell and organismal physiology. Indeed, PPARγ’s activity is regulated by multiple mechanisms, including post-transcriptional modifications, which, when dys-coordinated, may contribute to the pathogenesis of various states, including obesity, insulin resistance, and fatty liver disease. Here, we demonstrate that SETD6 binds to and methylates PPARγ at lysine 170 (K170) both in vitro and in liver-derived cells. This methylation event, in turn, is required for PPARγ-mediated activation of SETD6 transcription via promoter binding, forming a positive feedback regulatory loop. RNA-sequencing revealed that both SETD6 and PPARγ methylation at K170 are required for full induction of lipid metabolism genes’ expression, manifesting functionally in lipid droplet biogenesis in liver-derived cells. Together, our findings uncover a novel role for lysine methylation of PPARγ in the regulation of lipid synthesis and lipid droplet biogenesis, thereby identifying putative new therapeutic targets for lipid overproduction diseases, including metabolic dysfunction-associated fatty liver disease and obesity.
Introduction
PPAR family members are ligand-activated nuclear receptors that function as transcription factors. The family consists of three PPAR isotypes: PPARα, PPARβ/δ, and PPARγ, with highly conserved DNA- and ligand-binding domains (Evans et al., 2004; Wang, 2010). The DNA-binding domain enables the binding to consensus DNA sequences called peroxisome proliferator response elements (PPREs), usually found in the promoter region of genes (Li et al., 2022). Despite their similar domain structure and mechanism of action, PPARs are encoded by different genes and activated by different ligands. PPARα is highly expressed in oxidative tissues, such as the liver, skeletal muscle, brown adipose tissue, heart, and kidney (Wang et al., 2020). It mainly participates in the fasting state and regulates the transcription of rate-limiting enzymes required for peroxisomal and mitochondrial beta-oxidation (Wang et al., 2020). PPARβ/δ is ubiquitously expressed and has mainly been studied in skeletal muscle (Manickam and Wahli, 2017). Similar to PPARα, it has been shown to have anti-inflammatory effects (Zingarelli et al., 2010). PPARγ has two main isoforms – PPARγ1 and PPARγ2 (Lee et al., 2018). PPARγ – and specifically PPARγ2 (from here on referred to as PPARγ) – appears to be a major driver of adipogenesis (fat-cell differentiation) (Forman et al., 1995; Banks et al., 2015), and is the major isoform expressed in hepatocytes, driving transcriptional programs for fatty acid uptake, lipogenesis, and lipid droplet biogenesis.
Lysine methylation, among other well-studied post-translational modifications (PTMs), is a critical player in the regulation of many cellular signaling pathways. The methylation of lysine residues is performed by protein lysine (K) methyltransferases (PKMTs), which can selectively catalyze mono-, di-, or tri-methylation (Albert and Helin, 2010). There are over 60 members of this enzyme family, the vast majority of which contain a conserved SET domain responsible for the enzymatic activity (Albert and Helin, 2010; Shi and Whetstine, 2007). The mono-methyltransferase SET domain-containing protein 6 (SETD6) catalyzes the methylation of various non-histone proteins involved in regulating, among others, the NFκB pathway, oxidative stress response, WNT signaling, cell cycle, and embryonic stem cell self-renewal (Chopra et al., 2025). Many of these pathways and processes have been linked to metabolism in general, and to fatty liver diseases. However, the role of lysine methylation and PKMTs in the regulation of non-histone proteins in lipid droplet formation and steatosis remains largely unexplored.
Here, we uncover a new role of SETD6 in the accumulation of lipid droplets in human liver-derived cells. Our findings show that SETD6 binds and methylates PPARγ on lysine K170 at chromatin. PPARγ K170 methylation positively regulates the formation of lipid droplets in liver cells through promoting PPARγ binding to its target gene promoters, thereby selectively activating genes involved in lipid droplet formation. Additionally, we demonstrate a functional positive feedback loop mechanism, in which PPARγ regulates the expression of SETD6 mRNA via a SETD6 and in a PPARγ K170 methylation-dependent manner. Together, these results highlight a novel pathway by which SETD6 contributes to steatosis progression through the methylation of PPARγ, positioning SETD6 as a critical regulator of lipid metabolism and presumably of the development of metabolic dysfunction-associated fatty liver disease (MAFLD).
Results
SETD6 is a target gene of PPARγ in HepG2 cells
PPARγ has previously been shown to bind to a PPRE in the SET7/9 promoter and enhance its transcription (Jetton et al., 2021). Interestingly, using the JASPAR CORE database (Fornes et al., 2020), we identified a significant predicted PPRE also within the promoter region of SETD6 (Figure 1A). This putative PPRE-binding site implies that PPARγ may regulate SETD6 expression through binding to the SETD6 promoter. Analysis of publicly available chromatin immunoprecipitation (ChIP)-sequencing experiments (Zheng et al., 2019) in liver-derived HepG2 cells, where PPARγ is highly expressed (Mogilenko et al., 2010), revealed that PPARγ is indeed enriched at the SETD6 promoter region in an open chromatin state (ATAC-seq), along with an enrichment for the histone marks H3K4me3 and H3K27ac in that genomic region (Figure 1B). To determine whether PPARγ binds to putative PPRE within the promoter of SETD6, we performed a chromatin immunoprecipitation (ChIP) experiment to evaluate the occupancy of PPARγ in HepG2 cells in this genomic region. Figure 1C shows a significant enrichment of Flag-PPARγ at the SETD6 promoter. Consistent with these results, overexpression of PPARγ resulted in a significant elevation in SETD6 mRNA expression level that was measured by qPCR (Figure 1D). To test the possibility that the observed occupancy on the SETD6 promoter and its activation by PPARγ is direct, we cloned the full-length SETD6 promoter upstream to a luciferase reporter gene (Kublanovsky et al., 2023), followed by transfection of this luciferase reporter construct and Flag-PPARγ in HepG2 cells. We found a significant elevation in SETD6 promoter activity after overexpression of Flag-PPARγ (Figure 1E). Jointly, these results suggest that PPARγ binds to SETD6 promoter and activates its transcription.
PPARγ binds SETD6 promoter and activates its expression.
(A) Top: Sequence logo of the PPARγ response element (PPRE) from JASPAR. Bottom: Schematic representation of PPARγ binding to a predicted PPRE site within the SETD6 promoter (B) Capture of a genome browser showing the enrichment of PPARγ at the SETD6 promoter in HepG2 cells with open chromatin state represented by H3K4me3, H3K27ac, and ATAC-seq tracks. (C) ChIP assay with Flag-PPARγ antibody or beads as negative control in HepG2 cells followed by qPCR with primers flanking the predicted binding site at the SETD6 promoter. Graphs show % input of the quantified DNA. (D) RNA was extracted from HepG2 cells transfected with control or Flag-PPARγ WT. Transcript levels of SETD6 were determined by qPCR. Error bars are SEM. Statistical analysis was performed for three experimental repeats using one-way ANOVA (*p < 0.05, ****p<0.0001). (E) Dual-luciferase assay in HepG2 cells transfected with an increasing amount of Flag-PPARγ. About 24 hr post-transfection, the whole-cell lysates were subjected to dual-luciferase assay (Promega). Relative luminescence was calculated after normalization of the firefly luciferase signal over Renilla luciferase control. Error bars are SD. Statistical analysis was performed for three experimental repeats. *p ≤ 0.03.
SETD6 binds and methylates PPARγ at K170 in vitro and in cells
We have previously shown that SETD6 methylation of the transcription factor E2F1 positively regulates the expression level of SETD6 (Kublanovsky et al., 2023). We hypothesized that a similar mechanism occurs also with SETD6 and PPARγ. To address this hypothesis, we first tested if there is a direct physical interaction between SETD6 and PPARγ. An in vitro enzyme-linked immunosorbent assay (ELISA) experiment using purified recombinant proteins confirmed a direct SETD6-PPARγ interaction. MBP-RelA served as positive control (Li and Dewey, 2011; Chang et al., 2011) and BSA and phosphate-buffered saline (PBS) were used as negative controls (Figure 2A). To determine whether SETD6 and PPARγ interact, we first examined their association under overexpression conditions. Co-expression of HA-SETD6 and Flag-PPARγ followed by FLAG immunoprecipitation from chromatin fractions demonstrated an interaction between the two proteins (Figure 2—figure supplement 1). To validate this interaction under endogenous expression level conditions, we next performed co-immunoprecipitation from RIPA lysates of HepG2 cells. Immunoprecipitation of endogenous PPARγ enriched endogenous SETD6, demonstrating an endogenous interaction between the two proteins (Figure 2B). We next examined whether such interaction at endogenous expression levels also occurs on chromatin. Reciprocal co-immunoprecipitation experiments using chromatin-enriched fractions showed that endogenous SETD6 co-immunoprecipitated with endogenous PPARγ, confirming that the two proteins interact on chromatin (Figure 2C). Finally, a proximity ligation assay (PLA) further validated the interaction in intact cells within the nuclei (Figure 2D). Notably, the catalytic inactive SETD6 mutant (Y285A) exhibited comparable proximity to PPARγ, indicating that SETD6 catalytic activity is not required for the physical association between the two proteins. Consistent with these findings, structural modeling of the SETD6–PPARγ complex predicted no major alterations in the overall interaction interface following substitution of Y285 with alanine (Figure 2—figure supplement 2), supporting a model in which SETD6 binding to PPARγ is independent of its catalytic activity.
Physical interaction between PPARγ and SETD6 in vitro and in cells.
(A) Enzyme-linked immunosorbent assay (ELISA)-based analysis of the interaction between recombinant GST-SETD6 and the indicated recombinant proteins. ****p < 0.0001. (B) Endogenous PPARγ was immunoprecipitated from RIPA lysates of HepG2 cells followed by western blot analysis using the indicated antibodies. (C) Endogenous SETD6 was immunoprecipitated using chromatin fraction isolated from HepG2 followed by western blot analysis using the indicated antibodies. (D) Left: Representative images of proximity ligation assays (PLA) between Flag-PPARγ and GFP-SETD6 WT or the catalytic inactive mutant GFP-SETD6 Y285A in HeLa cells. The negative control (NC) was performed in the absence of one primary antibody. Red dots indicate positive PLA signals. Scale bar = 10 μm. Right: Quantification of PLA signals for each sample. Statistical analysis was performed using Student’s t-test (***p < 0.001).
-
Figure 2—source data 1
Original western blots shown in Figure 2.
- https://cdn.elifesciences.org/articles/111542/elife-111542-fig2-data1-v2.zip
-
Figure 2—source data 2
Western blots shown in Figure 2, labelled.
- https://cdn.elifesciences.org/articles/111542/elife-111542-fig2-data2-v2.zip
Given the physical interaction between SETD6 and PPARγ in vitro and in cells, we hypothesized that PPARγ is methylated by SETD6. To address this hypothesis, recombinant PPARγ was subjected to an in vitro methylation reaction using His-SETD6 and 3H-labeled SAM as the methyl donor. The results show that SETD6 methylates PPARγ (Figure 3A). The methylation signal observed for SETD6 corresponds to its auto-methylation activity (Weil et al., 2018). To map the methylation site, in vitro methylation reactions were performed using non-radioactive SAM followed by mass spectrometry. The data obtained suggested that PPARγ K170 mono-methylation (located in the DNA-binding domain (DBD)) was the only methylation site identified after incubation with SETD6 (Spectra is shown in Figure 3—figure supplement 1), and a schematic illustration of the DBD of PPARγ and the estimated location of K170 is shown in Figure 3A, top panel. To validate this methylation site, we performed an in vitro methylation reaction using a PPARγ with a K170R mutation. SETD6 failed to methylate the mutant PPARγ (Figure 3A). Therefore, K170 is the major methylation site of PPARγ by SETD6. Immunoprecipitation with a pan-methyl antibody confirmed that endogenous PPARγ is methylated in HepG2 cells on chromatin (Figure 3B). To test if this methylation is SETD6-dependent, we compared the methylation of Flag-PPARγ in CRISPR control (CT) and SETD6 knockout (KO) cells. The result revealed that Flag-PPARγ is methylated in cells in a SETD6-dependent manner (Figure 3C). We next generated a site-specific antibody to detect PPARγ K170me1. Using a dot blot assay, we validated that the PPARγ K170me1 antibody specifically recognizes a PPARγ peptide mono-methylated at K170, but not the unmodified peptide (Figure 3D). To confirm that PPARγ is methylated in cells on K170 by SETD6, we immunoprecipitated endogenous PPARγ from HepG2 cells in CRISPR CT and SETD6 KO cells, followed by WB with the PPARγ K170me1 antibody. A significant decrease in PPARγ methylation was observed in the SETD6 KO cells (Figure 3E). Taken together, these results revealed that SETD6 binds and methylates PPARγ on K170 at chromatin in vitro and in cells.
SETD6 methylates PPARγ at K170 in vitro and in cells.
(A) In vitro methylation assay in the presence of 3H-labeled SAM and the indicated purified proteins. Coomassie stain of the recombinant proteins used in the reactions is shown at the bottom. Schematic representation of PPARγ domain structure. The methylated residue (K170) identified by mass spectrometry is shown in red. DBD, DNA-binding domain; LBD, ligand-binding domain. (B) Endogenous PPARγ was immunoprecipitated from HepG2 cells followed by WB with the indicated antibodies. (C) Flag-PPARγ was overexpressed followed by immunoprecipitation using pan-methyl antibody in control (CT) and SETD6 KO HeLa cells followed by western blot with indicated antibodies. (D) 0.25 µg of PPARγ peptides (unmodified and K170me1) were spotted on a PVDF membrane followed by incubation with anti-PPARγ K170me1 antibody or streptavidin–HRP. (E) Endogenous PPARγ was immunoprecipitated from control and KO SETD6 HepG2 cells followed by western blot with the indicated antibodies.
-
Figure 3—source data 1
Original western blots shown in Figure 3.
- https://cdn.elifesciences.org/articles/111542/elife-111542-fig3-data1-v2.zip
-
Figure 3—source data 2
Western blots shown in Figure 3, labelled.
- https://cdn.elifesciences.org/articles/111542/elife-111542-fig3-data2-v2.zip
PPARγ methylation at K170 regulates SETD6 promoter activation
Having demonstrated that PPARγ binds to the SETD6 promoter and activates its transcription, we hypothesized that a molecular feedback mechanism may exist whereby SETD6-mediated K170 methylation of PPARγ affects SETD6 transcription. To test this hypothesis, we performed a luciferase reporter-based assay to determine SETD6 promoter activity in control and SETD6 KO cells in the presence of overexpressed Flag-PPARγ. As shown in Figure 4A, knockout of SETD6 significantly decreased SETD6’s promoter activity. To complement these experiments, we measured SETD6 mRNA levels by qPCR in HepG2 cells stably expressing either Flag-PPARγ WT or the Flag-PPARγ K170R mutant. A significant elevation in SETD6 mRNA expression level was observed in cells overexpressing WT PPARγ compared with the PPARγ K170R mutant (Figure 4B). To determine whether the occupancy of PPARγ on the SETD6 promoter is SETD6-dependent, we performed ChIP experiments of endogenous PPARγ in HepG2 CRISPR CT and SETD6 KO cells (Figure 4C). SETD6 KO led to a significant reduction in the occupancy of PPARγ on the SETD6 promoter. To test if the occupancy of PPARγ on the SETD6 promoter is K170me1-dependent, a ChIP experiment was performed in cells stably expressing Flag-PPARγ WT and Flag-PPARγ K170R mutant (Figure 4D). The enrichment of Flag-PPARγ was significantly higher in the cells expressing PPARγ WT compared to the K170R mutant. Taken together, the results suggest that PPARγ binds to the SETD6 promoter and activates SETD6 mRNA expression in a SETD6-mediated, K170me1-dependent manner, thereby demonstrating a positive feedback loop.
PPARγ binds and activates SETD6 expression in a K170 methylation-dependent manner.
(A) Dual-luciferase assay in Control and SETD6 KO HepG2 cells. 24 hr post-transfection, the whole-cell lysates were subjected to dual-luciferase assay (Promega). Relative luminescence was calculated after normalization of the firefly luciferase signal over Renilla luciferase control. Error bars are SD. Statistical analysis was performed for three experimental repeats. ***p < 0.001. (B) Left: WB analysis with the indicated antibodies for stable cells expressing Flag-WT or Flag-K170R PPARγ. Right: Transcript levels of the SETD6 were determined by qPCR of stably expressing HepG2 cells – Empty, Flag-PPARγ WT, and Flag-PPARγ K170R mutant. mRNA levels were normalized to GAPDH and then to Empty. (C) Chromatin immunoprecipitation (ChIP) assay. The chromatin fraction of HepG2 SETD6 CRISPR CT, KO1, and KO2 cells were immunoprecipitated with magnetic beads conjugated with anti-PPARγ antibody. The bound DNA was purified and amplified by qPCR. (D) Same as C for cells stably expressing Empty, Flag-PPARγ WT, and Flag-PPARγ K170R mutant. Graphs for C and D show the percent input of the quantified DNA. Two-way ANOVA analysis was performed; error bars are SEM. *p < 0.05; **p < 0.01; ***p < 0.001; ****p < 0.0001.
-
Figure 4—source data 1
Original western blots shown in Figure 4.
- https://cdn.elifesciences.org/articles/111542/elife-111542-fig4-data1-v2.zip
-
Figure 4—source data 2
Western blots shown in Figure 4, labelled.
- https://cdn.elifesciences.org/articles/111542/elife-111542-fig4-data2-v2.zip
PPARγ K170 methylation by SETD6 regulates lipid droplet formation
To assess the global transcriptomic impact of SETD6 on human hepatocellular carcinoma cells in an unbiased manner, we performed RNA-sequencing in control HepG2 cells (two independent gRNAs) and SETD6 KO cells (derived from three independent gRNAs). The KO efficiency of SETD6 gRNAs in these cells is shown in Figure 5A. RNA-sequencing analysis identified 302 differentially expressed genes in SETD6 KO HepG2 cells compared to control cells, including 166 downregulated and 136 upregulated genes (Figure 5B). To better define the biological pathways associated with each gene set, KEGG pathway enrichment analysis was performed separately for the downregulated (Figure 5C) and upregulated genes (Figure 5D). Genes downregulated in SETD6 KO cells were significantly enriched for pathways associated with lipid metabolism, including the PPAR signaling pathway, glycerolipid metabolism, cholesterol metabolism, and fat digestion and absorption. Additional enriched pathways included TNF signaling, focal adhesion, and pluripotency-related pathways, which are consistent with previously reported roles of SETD6 in transcriptional regulation and cancer-associated signaling (Chopra et al., 2025; Figure 5C). In contrast, genes upregulated in SETD6 KO cells were enriched for pathways associated with endoplasmic reticulum function, oxidative phosphorylation, lysosomal pathways, and glycerophospholipid (Figure 5D). Together, these findings further support a functional role for SETD6 in regulating PPARγ-dependent transcriptional programs and lipid metabolic pathways in hepatocellular carcinoma cells. To phenotypically validate whether SETD6 has a role in fat accumulation, we established a live cell imaging system that allows us to quantify and study the kinetics of lipid droplet accumulation in live cells (Figure 5E). In this system, we treated HepG2 with oleic acid (OA), as the primary fatty acid source Fougerat et al., 2020 followed by staining with BODIPY 493/503, a green-fluorescent dye that stains neutral lipids (Zhao et al., 2022). Hoechst dye (Fuchs et al., 2023) was used to identify the nuclei and quantify the number of cells, enabling a calculation of mean green fluorescence over time. First, we conducted a 20-hr calibration experiment to determine the appropriate OA concentration (Figure 5—figure supplement 1). We incubated HepG2 cells with three different concentrations of OA: 300, 600, and 900 μM, and with DMSO serving as a vehicle control. OA accumulation in the cells treated with 300 and 600 μM reached a plateau over time. The DMSO-treated cells exhibited a decline in LD accumulation, indicating that the BODIPY dye is specific to neutral lipid staining. We chose to work with the 600 μM concentration of OA since it yielded optimal staining conditions and did not affect cell morphology. We next asked if depletion of SETD6 affects the formation of lipid droplets in cells. To this end, HepG2 CT and KO SETD6 cells were treated with 600 μM of OA over 24 hr, and the mean GFP signal was measured. The result shows that the CT cells accumulated significantly more lipid droplets over time compared to SETD6 KO1 and KO2 cells (Figure 5F). Representative images of HepG2 CRISPR CT, KO1, and KO2 cells at a 24-hr time point are presented (Figure 5F, top panel). To confirm that the lipid droplets accumulation is dependent on SETD6, we performed a rescue experiment wherein SETD6 KO cells were transfected with HA-SETD6 plasmid (Figure 5H; SETD6 expression is confirmed by western blot in Figure 5G). The results showed that exogenous HA-SETD6 expression reversed the effect of SETD6 knockout. These findings suggest that SETD6 positively regulates lipid droplet formation.
SETD6 positively regulates lipid droplet formation.
(A) WB analysis with the indicated antibodies for HepG2 control (two clones) and SETD6 KO cells (three clones). (B) Heatmap showing upregulated and downregulated genes identified by RNA-sequencing analysis of two SETD6 control (CT) and three SETD6 KO HepG2 independent clones. Gene expression values are displayed as normalized Z-scores. Yellow and blue colors represent relatively high and low expression levels, respectively. (C, D) KEGG pathway enrichment analysis of differentially expressed genes identified by RNA-sequencing analysis of SETD6 control (CT) and SETD6 KO HepG2 cells. (C) Pathways enriched among genes downregulated in SETD6 KO cells. (D) Pathways enriched among genes upregulated in SETD6 KO cells. Circle size represents the number of differentially expressed genes associated within each pathway, and color intensity indicates statistical significance expressed as −log10(FDR). The x-axis represents the enrichment score. (E) Illustration of the system to monitor lipid droplets accumulation over time: HepG2 cells are treated with oleic acid (OA) and stained with Hoechst (nucleus) and BODIPY (neutral lipids), followed by live cell imaging. (F) Top: Representative images of HepG2 CRISPR CT (control), KO1, and KO2 challenged with 300 mM of OA (20 hr time point) and stained with Hoechst (nucleus) and BODIPY (neutral lipids). Bottom: Mean green fluorescence was calculated as fluorescence signal divided by cell count. Data is analyzed from three beacons per well in three wells. Statistical analysis was performed using one-way ANOVA. ns: non-significant; *p < 0.05; **p < 0.01. (G) WB analysis for CT and SETD6 KO with or without overexpression of HA-SETD6. (H) Top: Representative images of HepG2 CRISPR CT (control) and SETD6 KO without or with overexpression of HA-SETD6, challenged with 300 mM of OA (20 hr time point) and stained with Hoechst (nucleus) and BODIPY (neutral lipids). Bottom: Mean green fluorescence was calculated as fluorescence signal divided by cell count. Data is analyzed from three beacons per well in three wells. Statistical analysis was performed using one-way ANOVA. ns: non-significant; ***p < 0.001; ****p < 0.0001.
-
Figure 5—source data 1
Original western blots shown in Figure 5.
- https://cdn.elifesciences.org/articles/111542/elife-111542-fig5-data1-v2.zip
-
Figure 5—source data 2
Western blots shown in Figure 5, labelled.
- https://cdn.elifesciences.org/articles/111542/elife-111542-fig5-data2-v2.zip
Given that SETD6 methylates PPARγ and positively regulates lipid droplet formation, we hypothesized that this phenotype is mediated through PPARγ K170 methylation and its transcriptional activity. To determine whether SETD6-mediated methylation of PPARγ at K170 regulates gene expression in HepG2 cells, we performed RNA-sequencing analysis using HepG2 cells stably expressing Flag-PPARγ WT or the Flag-PPARγ K170R mutant (Figure 6A). We identified 1122 differentially expressed genes, including 532 downregulated and 590 upregulated genes in the PPARγ K170R mutant cells compared to WT PPARγ-expressing cells.
PPARγ methylation at K170 positively regulates gene expression and lipid droplet formation.
(A) Heatmap showing upregulated and downregulated genes identified by RNA-sequencing analysis of HepG2 independent clones stably expressing PPARγ WT or the PPARγ K170R mutant. Gene expression values are displayed as normalized Z-scores. Yellow and blue colors represent relatively high and low expression levels, respectively. (B, C) KEGG pathway enrichment analysis of differentially expressed genes identified by RNA-sequencing analysis of HepG2 cells stably expressing PPARγ WT or the PPARγ K170R mutant. (B) Pathways enriched among genes downregulated in the PPARγ K170R mutant cells. (C) Pathways enriched among genes upregulated in the PPARγ K170R mutant cells. Circle size represents the number of differentially expressed genes associated with each pathway, and color intensity indicates statistical significance expressed as −log10(FDR). The x-axis represents the enrichment score. (D) ChIP analysis for HepG2 control and SETD6 KO cells (two clones) that were immunoprecipitated with PPARγ antibody. The bound DNA was purified and amplified by qPCR using specific primers to MOGAT1 and PLIN2 gene promoter regions. Graphs show the percent input of the quantified DNA. Two-way ANOVA analysis was performed; error bars are SEM. ****p < 0.0001. (E) Same as for panel D with HepG2 cells stably expressing Empty, Flag-PPARγ2 WT, and Flag-PPARγ2 K170R mutant that were immunoprecipitated with FLAG-conjugated magnetic beads. Error bars are SEM. ns: non-significant; *p < 0.05; **p < 0.01; ****p < 0.0001. (F) Structural model in cartoon representation of the PPARγ–RXRα heterodimer bound to DNA based on the published co-crystal structure (PDB: 3DZY). PPARγ is shown in blue, RXRα in cyan, DNA in orange, and NCOA2 peptides in gray. The boxed region indicates K170 within the PPARγ DNA-binding domain. Enlarged views in stick representation of the K170 side chain (top), the modeled K170me1 side chain (middle), and multiple modeled K170me1 rotamers (bottom) are shown. (G) Top: Representative images of HepG2 cells stably expressing Empty, PPARγ WT, or PPARγ K170R mutant, challenged with 300 mM of oleic acid (OA) (20 hr time point) and stained with Hoechst (nucleus) and BODIPY (neutral lipids). Bottom: Mean green fluorescence was calculated as the fluorescence signal divided by cell count. Data is analyzed from three beacons per well in three wells. Statistical analysis was performed using one-way ANOVA. ****p < 0.0001. (H) A schematic representation of our proposed working model.
To better characterize the biological pathways associated with PPARγ K170 methylation, KEGG pathway enrichment analysis was performed separately for the downregulated and upregulated gene sets (Figure 6B, C). Genes downregulated in the PPARγ K170R mutant cells (Figure 6B) were significantly enriched for pathways associated with lipid metabolism, including the PPAR signaling pathway, cholesterol metabolism, bile secretion, and ABC transporters. Additional enriched pathways included TNF signaling, NF-κB signaling, and IL-17 signaling pathways. In contrast, genes upregulated in the PPARγ K170R mutant cells (Figure 6C) were enriched for pathways associated with p53 signaling, ECM–receptor interaction, integrin signaling, and cell adhesion-related pathways. These findings are consistent with the enriched pathways identified by RNA-sequencing analysis of CT and SETD6 KO cells (Figure 5C), further supporting a functional role for SETD6-mediated PPARγ methylation in regulating lipid metabolic transcriptional programs. The RNA-seq results were further validated by qPCR (Figure 5—figure supplement 2). Taken together, this data demonstrates that methylation of PPARγ at K170 positively regulates the expression of genes associated with lipid droplet formation.
The fact that K170 is in the DBD of PPARγ may suggest that the methylation affects its association with target genes linked to lipid droplet formation. To test this hypothesis, we decided to focus on two PPARγ target genes that are known to be involved in the LD formation process; MOGAT1 – a rate-limiting enzyme involved in incorporating fatty acids into triglycerides and characterizes the fatty-acid esterification step (Soufi et al., 2014), and PLIN2 – a lipid droplet-associated protein involved in the storage of neutral lipids within lipid droplets (Tsai et al., 2017). ChIP experiments revealed that PPARγ is significantly more enriched at the MOGAT1 and PLIN2 loci in the SETD6 CT cell line compared to the SETD6 KO cells (Figure 6D). Consistent with these results, using HepG2 stable cell lines we observed a greater enrichment of FLAG-PPARγ WT on both MOGAT1 and PLIN2 promoter regions in comparison to the FLAG-PPARγ K170R mutant (Figure 6E). Because K170 resides within the DBD of PPARγ, we next asked whether methylation at this residue could directly influence the interaction between PPARγ and DNA. Structural modeling based on the published co-crystal structure of PPARγ bound to DNA (PDB: 3DZY) Chandra et al., 2008 demonstrates that K170me1 side chain is oriented away from the DNA interface and does not introduce steric clashes with DNA (Figure 6F). Furthermore, modeling of multiple K170me1 rotamers yielded similar results, suggesting that K170 methylation is unlikely to directly alter the DNA-binding interface through steric effects. Together with our ChIP-qPCR data, these findings support a model in which K170 methylation promotes PPARγ chromatin occupancy through indirect mechanisms, such as modulation of protein–protein interactions, cofactor recruitment, or local chromatin organization, rather than by directly affecting the DNA-binding interface.
Finally, to test whether lipid droplet formation is dependent on PPARγ methylation at K170, we subjected the cells to the live imaging system described earlier. Lipid droplet accumulation was significantly lower in cells expressing Flag-PPARγ K170R compared to Flag-PPARγ WT (Figure 6G). These results strongly suggest that K170 PPARγ methylation positively mediates lipid droplet formation. Taken together, we propose a working model in which SETD6 methylates PPARγ at lysine 170 (K170), enhancing its transcriptional activity on target genes involved in lipid droplet formation, including MOGAT1 and PLIN2. This activation promotes lipid droplet accumulation. In parallel, PPARγ K170 methylation drives SETD6 transcription, establishing a positive feedback loop that sustains the expression of LD-associated genes (Figure 6H).
Discussion
Previous studies have shown that the transcriptional activity of PPARγ is significantly regulated by various types of PTMs, including phosphorylation, acetylation, ubiquitination, and sumoylation (Małodobra-Mazur et al., 2024; Yin et al., 2022; Brunmeir and Xu, 2018; Diezko and Suske, 2013; Choi et al., 2015). Interestingly, a recent paper has shown that SMYD2-mediated mono methylation of PPARγ facilitates hypoxia-induced pulmonary hypertension and promotes mitophagy (Li et al., 2024). However, the methylation site has not been identified. Here, we identify a regulatory feed-forward circuit between PPARγ and the lysine methyltransferase SETD6, establishing SETD6 as a previously unrecognized enzymatic regulator of PPARγ transcriptional activity. We show that SETD6 mono-methylates PPARγ at K170, a lysine residue that resides within its DBD, thereby promoting PPARγ chromatin occupancy, the expression of genes involved in lipid metabolism, and lipid droplet biogenesis in HepG2 cells. Consistently, analysis of previously generated PPARγ ChIP-seq experiments (Zheng et al., 2019) revealed PPARγ occupancy at the SETD6 promoter. We demonstrate that K170 methylation enhances PPARγ occupancy at this promoter, resulting in increased SETD6 transcription and mRNA expression. Together, these findings establish a positive feed-forward regulatory loop in which SETD6 activates PPARγ, which in turn transcriptionally upregulates SETD6 expression. Our results do not only suggest that PPARγ positively regulates the expression of SETD6 but also provide evidence that it occurs in a SETD6- and a PPARγ methylation-dependent manner. Our previous work demonstrated that SETD6 methylates E2F1 at K117 (Kublanovsky et al., 2023), and that this modification promotes SETD6 gene expression, establishing a positive regulatory circuit reminiscent of the one we describe herein, involving PPARγ. Thus, SETD6 appears to participate in functional transcriptional feed-forward loops involving distinct transcription factors. Although the upstream pathways controlling SETD6 expression remain largely unknown, the recurring ability of SETD6 to regulate transcription factors that, in turn, promote its own expression suggests that tight control of SETD6 abundance and enzymatic activity is an important mechanism for coordinating context-dependent transcriptional programs.
Our RNA-sequencing analysis of stably expressing HepG2 cells with wild-type PPARγ and the PPARγ K170R mutant provided insight into the functional consequences of SETD6-mediated methylation on PPARγ in various biological processes. Specifically, we observed that methylation at lysine 170 (K170) positively regulates the expression of genes associated with lipid metabolism, particularly those involved in lipid droplet formation. These findings highlight the critical role of PPARγ methylation in modulating metabolic pathways linked to lipid storage and processing. Given that the K170 methylation site is located within the DBD of PPARγ, specifically between its two zinc-finger motifs, we investigated how this PTM affects the occupancy of PPARγ at its target gene promoters. Our analysis focused on its binding to PPREs present in the promoters of key target genes, including MOGAT1 and PLIN2 (Itabe et al., 2017; Yen et al., 2002).
Consistent results were observed in both SETD6 CRISPR knockout cells and overexpression models. PPARγ exhibited significantly greater enrichment in the promoter regions of control SETD6 CRISPR cells (in comparison to SETD6 KO) and cells stably expressing Flag-PPARγ WT cells (compared to Flag-PPAR K170R mutant). These findings demonstrate that the methylation of PPARγ at K170 by SETD6 facilitates its recruitment to the promoter region of its target genes. The increased transcriptional activity of MOGAT1 and PLIN2 likely drives their protein expression, with the functional results being enhanced lipid accumulation. A broader investigation into additional PPARγ target genes that may be affected by SETD6 expression and K170 methylation is required to further understand whether our findings reflect a more generalized phenomenon.
Lysine K170 on PPARγ is conserved among the other PPAR family members, PPARβ/δ but not in PPARα. These findings suggest that the other PPAR family members, which have other physiological roles in different tissues (Wang et al., 2024; Lamichane et al., 2018; Christofides et al., 2021), can be similarly regulated by SETD6 and methylation. Future experiments will determine whether the newly identified methylation event is redundant or is PPARγ-specific.
Although our structural modeling suggests that K170 methylation is unlikely to directly alter the DNA-binding interface through steric effects (Figure 6F), it may influence local conformational dynamics of the DBD or modulate interactions with transcriptional cofactors and chromatin-associated proteins. Given that K170 is located between the two zinc-finger motifs of the DBD, this modification may contribute to selective chromatin occupancy, promoter recognition, or stabilization of transcriptional complexes at PPARγ target genes. Future biochemical, mechanistic, and structural studies will be required to distinguish between these possibilities.
Based on the PhosphoSite database, K170 of PPARγ has not been reported to undergo additional PTMs, such as acetylation or ubiquitination. Interestingly, however, the neighboring residue threonine 166 (T166), located within the DBD, is phosphorylated by PKCα and has been shown to regulate PPARγ transcriptional activity and lipid metabolic programs in adipocytes (Yang et al., 2023). To further explore this possibility, we performed structural modeling based on the published PPARγ–DNA co-crystal structure (PDB: 3DZY). The model predicts that the K170me1 side chain is oriented away from the DNA interface and does not introduce steric clashes with DNA, suggesting that K170 methylation is unlikely to directly alter the DNA-binding interface. In contrast, phosphorylation of T166 is predicted to introduce multiple intramolecular steric clashes within the DBD, which may alter its local conformation or dynamics and thereby indirectly influence DNA binding or transcriptional activity (Figure 6—figure supplement 1). Together with our ChIP-qPCR data demonstrating reduced promoter occupancy of the PPARγ K170R mutant, these observations support a model in which K170 methylation primarily regulates PPARγ chromatin occupancy through indirect mechanisms, such as modulation of protein–protein interactions, cofactor recruitment, or local chromatin organization, rather than through direct steric effects on the DNA-binding interface. While these observations remain speculative and require further experimental validation, they suggest that phosphorylation and methylation within the DBD may coordinately regulate PPARγ chromatin occupancy and transcriptional selectivity.
Accumulating evidence suggests that SETD6 functions as a broader regulator than previously appreciated of transcription factor activity through lysine methylation. Previous studies demonstrated that SETD6-mediated methylation modulates the activity of multiple chromatin-associated factors, including RelA, E2F1, TWIST1, and BRD4 (Chopra et al., 2025; Kublanovsky et al., 2023; Li and Dewey, 2011; Vershinin et al., 2021; Ulu et al., 2026; Admoni-Elisha et al., 2022), thereby influencing chromatin organization, cofactor recruitment, and transcriptional selectivity. Together with the findings presented here, these observations raise the possibility that SETD6 acts as a context-dependent epigenetic signaling regulator that integrates metabolic, inflammatory, and oncogenic cues through selective methylation of transcription factors. In the context of PPARγ, it is possible that conditions associated with elevated fatty acid flux, steatosis, or metabolic stress promote the functional significance of PPARγ K170 methylation, potentially by stabilizing chromatin occupancy or facilitating recruitment of additional transcriptional cofactors. Further studies will be required to define the upstream signals and physiological conditions that regulate SETD6 catalytic activity toward distinct substrates.
Nonalcoholic fatty liver disease, recently also termed metabolic dysfunction-associated fatty liver disease (MAFLD), is the most common chronic liver disorder worldwide, affecting approximately 25% of the global population (Younossi et al., 2016). It represents a spectrum of liver diseases characterized by abnormal accumulation of triglycerides and lipid droplets within hepatocytes, and is clinically defined by lipids accounting for more than 5% of the liver weight (Loomba et al., 2021). Lipid droplets are the primary intracellular storage organelles for neutral lipids and are predominantly composed of triacylglycerols and steryl esters surrounded by a phospholipid monolayer (Abd El-Kader and El-Den Ashmawy, 2015; Onal et al., 2017; Shpilka et al., 2015). A central mechanism contributing to hepatic steatosis occurs when adipose tissue exceeds its lipid storage capacity, leading to elevated basal adipocyte lipolysis and increased release of free fatty acids into circulation. This lipid overflow promotes excessive fatty acid uptake by hepatocytes and the formation of lipid droplets within the hepatocytes. While steatosis initially develops as a metabolic adaptation to nutrient excess, persistent lipid accumulation can trigger oxidative stress, inflammation, and cellular dysfunction. In a substantial subset of patients, MAFLD progresses to steatohepatitis (MASH), fibrosis, cirrhosis, greatly increasing the risk for hepatocellular carcinoma (Goh and McCullough, 2016; Scorletti and Carr, 2022; Wong et al., 2015). These emphasize the need to better understand the molecular pathways regulating hepatic lipid accumulation and metabolic stress responses.
Future studies should therefore involve physiologically relevant in vivo models used to investigate MAFLD progression and metabolic liver disease. Such approaches will allow us to evaluate the role of SETD6-mediated PPARγ K170 methylation under diet-induced metabolic stress conditions and to further validate the mechanistic model proposed in this study. In particular, mice expressing either wild-type PPARγ or the K170R mutant, whole body or in a tissue-specific manner, will enable assessment of the whole-body impact of SETD6-dependent methylation of PPARγ via genomic programs, lipid droplet accumulation, steatosis progression, and inflammatory responses.
In summary, this study highlights the pivotal cellular role of SETD6 and its lysine methylation activity via a central regulator of cellular metabolism – PPARγ. Our findings uncover a previously unrecognized function of SETD6 in promoting lipid droplet accumulation, mediated through its influence on the DNA-binding capacity and transcriptional regulation of PPARγ target genes in a methylation-dependent manner. Integrating the data obtained in this study will pave new research directions to gain more insight into SETD6’s role in metabolic diseases through the methylation of PPARγ, with potential therapeutic applications.
Materials and methods
Cell lines treatment
Request a detailed protocolHepG2 (Hepatocellular Carcinoma) cells were maintained in Eagle’s Minimum Essential Medium (BI, 01-025-1A) with 10% fetal bovine serum (Gibco, 10270106), 2 mg/ml L-glutamine (Sigma, G7513), and 1 mM sodium pyruvate (BI, 03-042-1B). Human embryonic kidney cells (HEK293T) and HeLa cells were maintained in Dulbecco’s modified Eagle’s medium (Sigma, D5671) with 10% fetal bovine serum (Gibco, 10270106), 2 mg/ml L-glutamine (Sigma, G7513), 1% penicillin–streptomycin (Sigma, P0781), and non-essential amino acids (Sigma, M7145). Cells were cultured at 37°C in a humidified incubator with 5% CO2. Cell lines were obtained from ATCC and were routinely tested to confirm the absence of mycoplasma contamination. Cell line identity was verified based on authentication by the original source (ATCC).
Plasmids
Mouse PPARγ2 (mPPARγ2) coding sequence was excised from plasmids that were kindly provided by Yosef Shaul`s lab from Weizmann Institute of Science. In addition, the human PPARγ2 (hPPARγ2) coding sequence was amplified from a sample of cDNA sequence from human visceral adipose tissue that was kindly provided by Prof. Assaf Rudich’s lab. mPPARγ2 and hPPARγ2 sequences were amplified by using PCR with compatible primers as indicated in Table 1. The amplicons were digested with AscI and PacI restriction enzymes and mPPARγ2 subcloned into a pET-Sumo plasmid for protein purification. mPPARγ2 and hPPARγ2 subcloned into pcDNA3.1 3xFlag. To generate mPPARγ2 and hPPARγ2 mutants, site-directed mutagenesis on a PPARγ2 wild-type vector was performed for each plasmid using other primers indicated in Table 1. PPARγ2 K170R mutants were also cloned into pcDNA3.1 3xFlag, and mPPARγ2 K170R mutant was cloned into a pET-Sumo plasmid for protein purification. PCR reactions were accomplished using the KAPA HiFi HotStart ReadyMix (KAPA Biosystems), and cloned plasmids were confirmed by sequencing. Cloning pET-Duet and pcDNA3.1 hSETD6 (Human) plasmid containing His and HA tags described in Martín-Morales et al., 2017, respectively. SETD6 promoter sequence was amplified by PCR using primers indicated in Table 1, and subcloned into pGL3 plasmid.
Primers for cloning and mutagenesis.
| Name | Sequence (5′–3′) |
|---|---|
| mPPARγ2-fw | TTAGGCGCGCCGGTGAAACTCTGGGAGATTCTCC |
| mPPARγ2-rev | GGCTTAATTAACTAATACAAGTCCTTGTAGATCTCCTGG |
| mPPARγ2-K170R-fw | GAACCATCCGATTGCGCCTTATTTATGATAGGTGTGATCTTAACTGCCG |
| mPPARγ2-K170R-rev | CTATCATAAATAAGGCGCAATCGGATGGTTCTTCGGAAAAAAC |
| hPPARγ2-AscI-fw | TAAGGCGCGCCGGTGAAACTCTGGGAGATTCTCC |
| hPPARγ2-PacI-rev | GGCTTAATTAACTAGTACAAGTCCTTGTAGATCTCCTGC |
| hPPARγ2-K170R-fw | GAACAATCAGATTGCGCCTTATCTATGACAGATGTGATCTTAACTGTCGG |
| hPPARγ2-K170R-rev | TCTGTCATAGATAAGGCGCAATCTGATTGTTCTCCGGAAGAAACC |
| SETD6 promoter-fw | TTAGGTACCAACCTCTATATTCACAGCCTC |
| SETD6 promoter-rev | GGCCAAGCTTGTTCTGCGAACGGAGAAG |
| SETD6 gRNA #1 | TAAGGCGCGCCGGTGAAACTCTGGGAGATTCTCC |
| SETD6 gRNA #2 | GGCTTAATTAACTAGTACAAGTCCTTGTAGATCTCCTGC |
Transfection
Request a detailed protocolCells were plated in 10 cm plates, and transfection was performed using polyethyleneimine reagent (Polyscience Inc, 23966) for HEK293T cells or Mirus reagents; TransIT-X2 or TransIT-LT1 for HepG2 and Lipofectamine 2000 (Thermo Fisher Scientific) or TransIT-LT1 for HeLa cells, according to the manufacturer’s instructions. For stable transfection in HepG2 cell lines, lentiviruses were produced by transfecting HEK293T cells with the indicated pLenti constructs (empty, Flag PPARγ2 wild-type or Flag PPARγ2 K170R) and with plasmids encoding PMD2 and PX3. Target cells were infected with the viral supernatants and selected with 4 μg/ml puromycin.
SETD6 knockout by CRISPR/CAS9
Request a detailed protocolHepG2 CRISPR/Cas9 SETD6 knockout cells were generated using three independent sgRNAs targeting SETD6 cloned into the lentiCRISPR plasmid (Addgene, #49535). Cells transfected with the empty lentiCRISPR vector served as CRISPR control (CT) cells. Briefly, 3×10^5 HepG2 cells were plated per well in 6-well plates and transfected using TransIT-X2 reagent (Mirus) according to the manufacturer’s instructions. Following transfection and puromycin selection, single clones were isolated and expanded. Clones were validated by sequencing.
Recombinant protein expression and purification
Request a detailed protocolEscherichia coli BL21 transformed with a plasmid expressing a protein of interest were grown in LB media. Bacteria were harvested by centrifugation after IPTG induction and homogenized with ice-cold lysis buffer containing PBS, 10 mM imidazole, 0.1% Triton X-100, 1 mM PMSF, and one complete mini protease inhibitors tablet (Roche). After adding 0.25 mg/ml lysozyme for 30 min, the lysates were subjected to sonication on ice (18% amplitude, 1 min total, 10 s ON/OFF). The tagged fusion proteins were purified on a His-Trap column using AKTA Pure protein purification system (GE). Eluted with 0.5 M imidazole in PBS buffer, followed by overnight dialysis (PBS, 10% glycerol). Recombinant GST-SETD6 was overexpressed and purified from insect cells as previously described in Li and Dewey, 2011.
In vitro methylation assay
Request a detailed protocolThe methylation assay reaction (total volume of 25 μl) contained 2 μg of His-Sumo mPPARγ2 wt, or K170R mutant proteins and 2 μg His-SETD6, 2μCi 3H-labeled S-adenosyl-methionine (SAM) (AdoMet, Amersham) and 5 μl of PKMT buffer (20 mM Tris-HCl pH 8, 10% glycerol, 20 mM KCl, 5 mM MgCl2). The reaction tube was incubated overnight at 30°C. The reaction was resolved by SDS–PAGE for Coomassie staining (Expedeon, InstantBlueTM) and exposed to autoradiogram. For the non-radioactive (cold) methylation assay, 300 μM non-radioactive SAM was added (Abcam, ab142221).
Enzyme-linked immunosorbent assay
Request a detailed protocol2 μg of recombinant proteins (BSA, MBP-RelA, and His-Sumo mPPARγ2 wt) diluted in PBS were added to a sticky surface (Greiner Microlon) 96-well plate and incubated for 1 hr at RT followed by 3% BSA blocking in PBST for 1 hr incubation at RT. After three washes with PBST, the plate was covered with 0.5 μg GST-SETD6 or GST protein (negative control) diluted in 1% BSA in PBST for 1 hr at RT. Plates were then washed and incubated with primary antibody (anti-GST, 1:4000 dilution) followed by incubation with HRP-conjugated secondary antibody (goat anti-rabbit, 1:2000 dilution) for 1 hr. Finally, TMB reagent and then 1 N H2SO4 were added; the absorbance at 450 nm was detected using a Tecan Infinite M200 plate reader.
Mass spectrometry analysis
Request a detailed protocolIn vitro methylation reaction was performed as described above, but instead of using a radioactive SAM, 300 μM non-radioactive SAM was added (Abcam, ab142221). Reactions were then sent for mass spectrometry analysis at the Weizmann Institute of Science as described previously (Admoni-Elisha et al., 2022).
Antibodies and western blot analysis
Request a detailed protocolSamples were denatured with Laemmli sample buffer (250 mM Tris-HCl pH 6.8, 10% SDS, 30% glycerol, 5% β-mercaptoethanol, a pinch of bromophenol blue), boiled for 5 min at 95°C, resolved on 8–12% SDS-PAGE gel, and then blotted onto PVDF membranes. Primary antibodies used were anti-Flag (Sigma, F1804), anti-HA (Millipore, 05-904), anti-actin (Abcam, ab3280), anti-SETD6 (Genetex, GTX629891), anti-PPARγ (CST, 2435), anti-PPARγ2 (Abcam, ab45036), anti-histone H3 (Abcam, ab10799), anti-PPARγ K170me1 (Abmart Inc), and anti-pan-methyl lysine (Abcam, ab23366; used at 1:500 dilution for western blot analysis and 2 μg per reaction for immunoprecipitation experiments). HRP-conjugated secondary antibodies, goat anti-rabbit, goat anti-mouse, and mouse anti-rabbit were purchased from Jackson ImmunoResearch (111-035-144, 115-035-062, and 211-032-171, respectively). For endogenous immunoprecipitation of the SETD6 experiment, HRP goat anti-mouse light chain antibody (Jackson, 115-035-174) was used. Antibodies were diluted and prepared in TBST with 5% BSA or in PBST with 10% skim milk, according to the manufacturer’s recommendations. The immobilized HRP antibodies were detected by ECL (Biological Industries). For western blot analysis, cells were homogenized and lysed in RIPA buffer (50 mM Tris-HCl pH 8, 150 mM NaCl, 1% Nonidet P-40, 0.5% sodium deoxycholate, 0.1% SDS, 1 mM DTT, and 1:100 protease inhibitor (PI) mixture (Sigma)). Samples were resolved on SDS-–PAGE, followed by western blot analysis.
Chromatin extraction
Request a detailed protocol10 cm plate of HepG2 cells washed three times with PBSx1, harvested, and centrifuged (1800 × g, 5 min, 4°C). Firstly, the pellet was resuspended with 500 µl of Buffer A (10 mM HEPES pH 7.9, 10 mM KCl, 1.5 mM MgCl2, 0.34 M sucrose, and 10% glycerol) supplemented with 0.1% Triton, 1 Mm DTT, 1:200 PI cocktail, 100 Nm PMSF and incubated on ice for 8 min. After another centrifugation, the supernatant was removed, and the pellet that consists mainly of intact nuclei was rewashed with Buffer A with the same supplementation without the addition of Triton. Then, the washed pellet was resuspended with 500 µl of No Salt Buffer (3 mM EDTA, 0.2 mM EGTA) supplemented with 1:200 PI cocktail (P8340, Sigma) and 1 mM DTT and kept on ice for 30 min with occasional vortexing. After centrifugation and removal of soluble nuclear proteins from the pellet, the pellet will consist of a chromatin fraction. Two different approaches were carried out to extract the soluble chromatin proteins; in the first one, the chromatin pellet was resuspended with 200 µl of Buffer A supplemented with 1:200 PI cocktail (P8340, Sigma) and 1:200 Benzonase (E1014-25KU, Sigma), incubated for 15 min at 37°C to solubilize the pellet. The second approach included resuspension of the chromatin pellet with 100 ul of Buffer A with the addition of 1:200 PI and then sonicated (Bioruptor, Diagenode) at high power settings for three cycles, 6 min each (30 s ON/OFF). The soluble chromatin fraction was collected by low-speed centrifugation (1800 × g, 5 min, 4°C).
Immunoprecipitation
Request a detailed protocolPreclear of the chromatin fraction for 1 hr at RT was conducted with Magnetic CHIP protein A/G magnetic beads (Millipore, 16-663). Afterward, the soluble chromatin fraction was incubated overnight at 4°C with pre-conjugated A/G magnetic beads conjugated to the antibody of interest, washed three times, and analyzed by western blot.
Dual-luciferase assay
Request a detailed protocolHepG2 cells were seeded in 24-well plates and transiently transfected with 0.1 μg Flag-PPARγ WT or K170R mutant, 0.1 μg firefly luciferase plasmid, containing SETD6 promoter, and 0.1 μg Renilla luciferase plasmid. The total amount of transfected DNA in each dish was kept constant by the addition of empty vector, as necessary. Cell extracts were prepared 24 hr after transfection, and firefly luciferase activity was measured with the Dual-Glo Luciferase Assay system (Promega) and normalized to that of Renilla luciferase.
PLA image processing and data analysis
Request a detailed protocolCells were cultivated on coated coverslips, washed with PBS, and fixed in cold 4% paraformaldehyde at RT for 15 min. Cell permeabilization was performed using 0.5% Triton X-100 in PBS for 10 min in RT. PLA (Duolink) was performed according to the manufacturer’s instructions (Sigma) using antibodies against GFP (Abcam, ab290) and Flag (Sigma, F1804) overnight at 4°C. Images were acquired by confocal spinning disk microscopy with a 63x objective. The PLA units were calculated per cell as the ratio between the number of dots within the nucleus and the nucleus area (stained with DAPI, using Duolink mounting media). Only nuclei GFP stained were calculated (indicating successful GFP-SETD6 transfection). Each nucleus is then represented as a point in the quantification graph. Each frame represents maximum intensity projection for 40–60 Z-stacks captured. Image processing and data analysis were previously described in Biton et al., 2025.
RNA-sequencing
Request a detailed protocolTotal RNA from HepG2 cells was extracted using the NucleoSpin RNA Kit (Macherey-Nagel) according to the manufacturer’s instructions. Samples were prepared in two biological replicates for control cells, four biological replicates for SETD6 KO, and four biological replicas for PPARγ and PPARγ K170R mutant. Libraries were prepared using the INCPM-mRNA-seq protocol. Briefly, the polyA fraction (mRNA) was purified from 500 ng of total input RNA followed by fragmentation and the generation of double-stranded cDNA. Afterward, an Agencourt Ampure XP beads cleanup (Beckman Coulter), end repair, A base addition, adapter ligation, and PCR amplification steps were performed. Libraries were quantified by Qubit (Thermo Fisher Scientific) and TapeStation (Agilent). The sequencing was done on a HiSeq instrument (Illumina).
RNA-sequencing analysis
Request a detailed protocolThe analysis of the raw sequence reads was carried out using the NeatSeq-Flow platform (https://doi.org/10.1101/173005). The sequences were quality trimmed and filtered using Trim Galore (version 0.4.5) (quality cutoff = 25, length cutoff = 25) and cutadapt (version 1.15) (DOI: https://doi.org/10.14806/ej.17.1.200). Alignment of the reads to the human genome (GRCh38) was done with RSEM (version 1.2.28) (Li and Dewey, 2011) (option ‘bowtie2’) and calculation of the number of reads per gene per sample was also done with RSEM. Quality assessment of the process was carried out using FASTQC (version 0.11.8) and MultiQC (version 1.0.dev0) (Ewels et al., 2016). Genes with low expression values (mean count <1 over all samples) were excluded from differential expression analysis. Read counts for differential gene expression were analyzed with the DESeq2 R package (Love et al., 2014) using the NeatSeq-Flow platform DESeq2 module. Genes with fold change ≥1 and adjusted p < 0.05 were considered as significantly differentially expressed genes. Significant genes were clustered using the ‘eclust’ function from the factorextra R package (10.32614/CRAN.package.factoextra) with the default restriction of maximum clusters. In some cases, batch effect was included in the design and also corrected for visualization purposes using the sva R package (Leek et al., 2012). SVA: Surrogate Variable Analysis. R package version 3.52.0. For treated mutant PPARγ vs. treated WT PPARγ and for treated WT PPARγ vs. EMPTY PPARγ, genes with fold change ≥1 and adjusted p < 0.05. Enrichment analysis for KEGG pathways was performed using Enrichr (Kuleshov et al., 2016; Chen et al., 2013). RNA-seq data were deposited into the Gene Expression Omnibus database under accession number GSE328466.
Real-time qPCR
Request a detailed protocol200 ng of the extracted RNA was reverse transcribed to cDNA using the iScript cDNA Synthesis Kit (Bio-Rad) according to the manufacturer’s instructions. Real-time qPCR was performed using the LightCycler 480 SYBR Green master (Roche, 04-887-352). All samples were amplified in triplicates in a 384-well plate using the following cycling conditions: 5 min at 95°C, 45 cycles of amplification; 10 s at 95°C, 10 s at 60°C, and 10 s at 72°C, followed by melting curve acquisition; 5 s at 95°C, 1 min at 65°C and monitoring up to 97°C, and finally cooling for 30 s at 40°C Gene expression levels were normalized relative to GAPDH gene and controls of the experiment Table 2.
Primers for qPCR.
| Name | Sequence (5′–3′) |
|---|---|
| GAPDH FW | AGCCACATCGCTCAGACAC |
| GAPDH Rev | GCCCAATACGACCAAATCC |
| MOGAT1 FW | GGAAAGCCATCCACACTGTT |
| MOGAT1 Rev | CCTCCATATAGGTCTGATGTAACTCC |
| MOGAT2 FW | GGTATCTGGACCGAGACAAGCC |
| MOGAT2 Rev | GTGGAAGCCCGCAATGTAGTT |
| PLIN1 FW | ACATTAAAGGGAAGAAGTTGAAGC |
| PLIN1 REV | TTCTCCTGCTCAGGGAGGT |
| PLIN2 FW | TCAGCTCCATTCTACTGTTCACC |
| PLIN2 REV | CCTGAATTTTCTGATTGGCACT |
| PLIN4 FW | AGTTCCAAGCCAGGGACAC |
| PLIN4 REV | CTGCTGGGCCTTTTCAATC |
| PLIN5 FW | GATCACTTCCTGCCCATGAC |
| PLIN5 REV | CACCGAACCCACTTCAGG |
| SETD6 FW | GGATGAAAAGGAGCCCAACT |
| SETD6 BC | CTACCATCCGAAGACAATTCG |
ChIP-qPCR
Request a detailed protocolFor DNA ChIP-qPCR, DNA ChIP protocol was used from Ainbinder et al., 2002 with the following modifications: HepG2 cells from 10 cm plate were cross-linked using 1.5% formaldehyde (Sigma, F8775) on a shaking platform for 10 min at room temperature. The cross-linking reaction was stopped by adding 0.125 M glycine pH 8.5 for 5 min at room temperature. Cells were harvested and washed three times with cold PBS, once with 2.5 ml of buffer I (10 mM HEPES [pH 6.5], 10 mM EDTA, 0.5 mM EGTA, 0.25% Triton X-100), and once with buffer II (10 mM HEPES [pH 6.5], 1 mM EDTA, 0.5 mM EGTA, 200 mM NaCl). Afterward, cells were resuspended with 500 ul of lysis buffer (50 mM Tris pH 8, 10 mM EDTA, 1% SDS, 1:100 PI cocktail), then sonicated (Bioruptor, Diagenode) at high power settings for 6 cycles, 6 min each (30 s ON/OFF). The chromatin extract was then clarified by centrifugation for 15 min, full speed at 4°C, and diluted 5x in dilution buffer (20 mM Tris pH 8, 2 mM EDTA, 150 mM NaCl, 1.84% Triton X-100, and 0.2% SDS). ChIP was performed as previously described (Ainbinder et al., 2002; Mishra et al., 2018). Chromatin was precleared overnight at 4°C with Magnetic ChIP protein A/G magnetic beads (Millipore, 16-663). The precleared sample was then immunoprecipitated in dilution buffer with Anti-FLAG magnetic beads (Sigma, M8823) or Magnetic ChIP protein A/G magnetic beads (Millipore, 16-663). The immunoprecipitated complexes were washed once with TSE150 buffer (20 mM Tris pH 8, 2 mM EDTA, 1% Triton X-100, 0.1% SDS, and 150 mM NaCl), TSE500 buffer (20 mM Tris pH 8, 2 mM EDTA, 1% Triton X-100, 0.1% SDS, and 500 mM NaCl), buffer 3 (250 mM LiCl, 10 mM Tris pH 8, 1 mM EDTA, 1% sodium deoxycholate, and 1% Nonidet P-40), and twice with TE buffer (10 mM Tris pH 8 and 1 mM EDTA). DNA was eluted with elution buffer (50 mM NaHCO3, 140 mM NaCl, and 1% SDS) containing 0.2 μg/μl RNase A and 0.2 μg/μl Proteinase K. Finally, the DNA eluates were decross-linked at 65°C overnight with shaking at 900 rpm and purified by NucleoSpin Gel and PCR Clean-up kit (Macherey-Nagel), according to the manufacturer’s instructions. Purified DNA was subjected to qPCR using specific primers (Table 3). Primers were designed based on PPARγ occupancy as previously described on PPARγ target gene (Yu et al., 2015; Tachibana et al., 2005). qPCR was performed using SYBR Green I Master (Roche) in a LightCycler 480 System (Roche). All samples were amplified in five replicates in a 384-well plate using the following cycling conditions: 5 min at 95°C, 45 cycles of amplification; 10 s at 95°C, 10 s at 60°C, and 10 s at 72°C, followed by melting curve acquisition; 5 s at 95°C, 1 min at 65°C and monitoring up to 97°C, and finally cooling for 30 s at 40°C. The results were normalized to input DNA and presented as % input.
Primers for ChIP-qPCR.
| Name | Sequence (5′–3′) |
|---|---|
| Mogat1 PPRE Fw | GAGCTCTTCTTGGAGTTCAGCC |
| Mogat1 PPRE Rev | GCCCTTACTTGAGCTGTAGCC |
| PLIN2 PPRE Fw | CCTGCTCTAATGACCTCTTACTTTGC |
| PLIN2 PPRE Rev | CCTTAAGTGAGGAAATGACTCACAGG |
| SETD6 promoter PPRE region I FW | CTGGCAAATAAGGGCAGAGG |
| SETD6 promoter PPRE region I Rev | GAGCGACCTCCTGATCTCGAC |
Structural modeling
Request a detailed protocolStructural analyses were performed using the published crystal structure of the PPARγ–RXRα heterodimer bound to DNA and NCOA2 peptide (PDB: 3DZY). Structural visualization, residue modification, and analysis were carried out using UCSF ChimeraX (version 1.12). Mono-methylation of PPARγ K170 and phosphorylation of T166 were modeled using the ‘swapaa’ command to generate the corresponding modified amino acid residues (M3L and TPO, respectively). Sidechain rotamers were selected using the ChimeraX rotamer library, and multiple rotamers were evaluated for K170me1. Potential steric clashes were assessed using the ChimeraX clashes/contacts tool with default parameters.
The structural model of the SETD6–PPARγ complex was generated using AlphaFold3. The predicted complex was visualized in ChimeraX, and the region surrounding the SET domain of SETD6 and the DBD of PPARγ was analyzed. Structural models were used solely to generate mechanistic hypotheses and to visualize potential structural consequences of PTMs; no quantitative energetic or molecular dynamics analyses were performed.
Lipid droplet dynamics with live imaging microscopy
Request a detailed protocol20 × 103 cells of HepG2 cells were plated in 48 plate-well. On the next day, a live imaging microscopy was conducted for 20 or 24 hr to measure oleic acid (OA) accumulation. For lipid droplets biogenesis, cells were treated with 600 μmol/l of oleic acid [(OA, conjugated to albumin at 5:1 mol/l ratio), Sigma-Aldrich, St. Louis, MO, USA], with 200 ng/ml BODIPY 493/503 (D3922; Invitrogen, Carlsbad, CA, USA) for neutral lipid staining, and 1 μg/ml Hoechst 33342 (H1399; Thermo Fisher Scientific, Inc, Waltham, MA, USA) was added for staining nuclei immediately before imaging. Imaging experiments were taken using a LionHeart FX (BioTek Instruments) configured with DAPI, GFP, and Brightfield light cubes. The fluorescence was measured with a 10x objective area scan with three beacons for each well and averaging the GFP signal for each well to account for variations in cell location in the well. Differences in cell number were corrected by using Hoechst fluorescence to normalize the BODIPY signal in each well. Data represent the mean of 3 wells per treatment. Image Analysis used primary and secondary masks of the captured digital images to determine the Mean GFP, which represents the mean OA accumulation per cell. Primary mask analysis of the DAPI channel identifies individual cells by their nuclei. The secondary mask is denoted as the region up to 20 µm surrounding each nucleus and represents the cytoplasmic cell region. Scale bar indicates 200 µm.
Statistical analyses
Request a detailed protocolStatistical analyses for all assays were analyzed with GraphPad Prism software, using Student’s two-tailed t-test (unpaired) when comparing two groups or one-way analysis of variance (ANOVA) with a Tukey’s post hoc test for comparing more than two groups. Two-way ANOVA was performed when two different categorical independent variables were tested on one dependent variable.
Data availability
RNA-seq data were deposited into the Gene Expression Omnibus database under accession number GSE328466.
-
NCBI Gene Expression OmnibusID GSE328466. SETD6-mediated methylation of PPARγ establishes a transcriptional feedback circuit promoting lipid accumulation in liver-derived cells.
References
-
Non-alcoholic fatty liver disease: The diagnosis and managementWorld Journal of Hepatology 7:846–858.https://doi.org/10.4254/wjh.v7.i6.846
-
TWIST1 methylation by SETD6 selectively antagonizes LINC-PINT expression in gliomaNucleic Acids Research 50:6903–6918.https://doi.org/10.1093/nar/gkac485
-
Mechanism of rapid transcriptional induction of tumor necrosis factor alpha-responsive genes by NF-kappaBMolecular and Cellular Biology 22:6354–6362.https://doi.org/10.1128/MCB.22.18.6354-6362.2002
-
Histone methyltransferases in cancerSeminars in Cell & Developmental Biology 21:209–220.https://doi.org/10.1016/j.semcdb.2009.10.007
-
Functional regulation of PPARs through post-translational modificationsInternational Journal of Molecular Sciences 19:1738.https://doi.org/10.3390/ijms19061738
-
Structural basis of SETD6-mediated regulation of the NF-kB network via methyl-lysine signalingNucleic Acids Research 39:6380–6389.https://doi.org/10.1093/nar/gkr256
-
Orchestrating epigenetics: a comprehensive review of the methyltransferase SETD6Experimental & Molecular Medicine 57:533–544.https://doi.org/10.1038/s12276-025-01423-2
-
JASPAR 2020: update of the open-access database of transcription factor binding profilesNucleic Acids Research 48:D87–D92.https://doi.org/10.1093/nar/gkz1001
-
Breaking a dogma: high-throughput live-cell imaging in real-time with hoechst 33342Advanced Healthcare Materials 12:e2300230.https://doi.org/10.1002/adhm.202300230
-
Natural history of nonalcoholic fatty liver diseaseDigestive Diseases and Sciences 61:1226–1233.https://doi.org/10.1007/s10620-016-4095-4
-
Perilipins: a diversity of intracellular lipid droplet proteinsLipids in Health and Disease 16:83.https://doi.org/10.1186/s12944-017-0473-y
-
SetD7 (Set7/9) is a novel target of PPARγ that promotes the adaptive pancreatic β-cell glycemic responseThe Journal of Biological Chemistry 297:101250.https://doi.org/10.1016/j.jbc.2021.101250
-
Methylation of the transcription factor E2F1 by SETD6 regulates SETD6 expression via a positive feedback mechanismThe Journal of Biological Chemistry 299:105236.https://doi.org/10.1016/j.jbc.2023.105236
-
Enrichr: a comprehensive gene set enrichment analysis web server 2016 updateNucleic Acids Research 44:W90–W97.https://doi.org/10.1093/nar/gkw377
-
Pivotal roles of peroxisome proliferator-activated receptors (PPARs) and their signal cascade for cellular and whole-body energy homeostasisInternational Journal of Molecular Sciences 19:949.https://doi.org/10.3390/ijms19040949
-
PDV: an integrative proteomics data viewerBioinformatics 35:1249–1251.https://doi.org/10.1093/bioinformatics/bty770
-
SETD6 dominant negative mutation in familial colorectal cancer type XHuman Molecular Genetics 26:4481–4493.https://doi.org/10.1093/hmg/ddx336
-
PPARγ activates ABCA1 gene transcription but reduces the level of ABCA1 protein in HepG2 cellsBiochemical and Biophysical Research Communications 402:477–482.https://doi.org/10.1016/j.bbrc.2010.10.053
-
Lipid droplets in health and diseaseLipids in Health and Disease 16:128.https://doi.org/10.1186/s12944-017-0521-7
-
A new perspective on NAFLD: Focusing on lipid dropletsJournal of Hepatology 76:934–945.https://doi.org/10.1016/j.jhep.2021.11.009
-
Inhibiting monoacylglycerol acyltransferase 1 ameliorates hepatic metabolic abnormalities but not inflammation and injury in miceThe Journal of Biological Chemistry 289:30177–30188.https://doi.org/10.1074/jbc.M114.595850
-
PPARs as metabolic regulators in the liver: lessons from liver-specific PPAR-null miceInternational Journal of Molecular Sciences 21:2061.https://doi.org/10.3390/ijms21062061
-
Peroxisome proliferator-activated receptors as therapeutic target for cancerJournal of Cellular and Molecular Medicine 28:e17931.https://doi.org/10.1111/jcmm.17931
-
Oligomerization and auto-methylation of the human lysine methyltransferase SETD6Journal of Molecular Biology 430:4359–4368.https://doi.org/10.1016/j.jmb.2018.08.028
-
Blockage of PPARγ T166 phosphorylation enhances the inducibility of beige adipocytes and improves metabolic dysfunctionsCell Death and Differentiation 30:766–778.https://doi.org/10.1038/s41418-022-01077-x
-
Monoacylglycerol O-acyltransferase 1 is regulated by peroxisome proliferator-activated receptor γ in human hepatocytes and increases lipid accumulationBiochemical and Biophysical Research Communications 460:715–720.https://doi.org/10.1016/j.bbrc.2015.03.095
-
Recent advances in fluorescent probes for lipid dropletsChemical Communications 58:1495–1509.https://doi.org/10.1039/D1CC05717K
-
Cistrome Data Browser: expanded datasets and new tools for gene regulatory analysisNucleic Acids Research 47:D729–D735.https://doi.org/10.1093/nar/gky1094
-
Peroxisome proliferator-activated receptor {delta} regulates inflammation via NF-{kappa}B signaling in polymicrobial sepsisThe American Journal of Pathology 177:1834–1847.https://doi.org/10.2353/ajpath.2010.091010
Article and author information
Author details
Funding
Israel Science Foundation (262/18)
- Noa Nashnaz
- Dana Goldberg
- Maayan Abramov
- Anand Chopra
- Tamar Rosiecki
- Tzofit Elbaz Biton
- Michal Feldman
- Dan Levy
Israel Science Foundation (496/23)
- Noa Nashnaz
- Dana Goldberg
- Maayan Abramov
- Anand Chopra
- Tamar Rosiecki
- Tzofit Elbaz Biton
- Michal Feldman
- Dan Levy
Israel Science Foundation (163/22)
- Raz Zarivach
Israel Cancer Research Fund
- Noa Nashnaz
- Dana Goldberg
- Maayan Abramov
- Anand Chopra
- Tamar Rosiecki
- Tzofit Elbaz Biton
- Michal Feldman
- Dan Levy
Israel Cancer Association USA
- Noa Nashnaz
- Dana Goldberg
- Maayan Abramov
- Anand Chopra
- Tamar Rosiecki
- Tzofit Elbaz Biton
- Michal Feldman
- Dan Levy
Israel Science Foundation (194/24)
- Habib Muallem
- Yulia Haim
- Assaf Rudich
Azrieli Foundation
- Anand Chopra
The funders had no role in study design, data collection, and interpretation, or the decision to submit the work for publication.
Acknowledgements
This work was supported by grants to DL from The Israel Science Foundation (262/18 and 496/23), The Research Career Development Award from the Israel Cancer Research Fund and from the Israel Cancer Association. RZ is supported by The Israel Science Foundation (163/22). AR is supported by The Israel Science Foundation (194/24).
Version history
- Sent for peer review:
- Preprint posted:
- Reviewed Preprint version 1:
- Reviewed Preprint version 2:
- Version of Record published:
- Version of Record updated:
Cite all versions
You can cite all versions using the DOI https://doi.org/10.7554/eLife.111542. This DOI represents all versions, and will always resolve to the latest one.
Copyright
© 2026, Nashnaz et al.
This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.
Metrics
-
- 654
- views
-
- 42
- downloads
-
- 0
- citations
Views, downloads and citations are aggregated across all versions of this paper published by eLife.