1. Neuroscience
Download icon

Alpha protocadherins and Pyk2 kinase regulate cortical neuron migration and cytoskeletal dynamics via Rac1 GTPase and WAVE complex in mice

  1. Li Fan
  2. Yichao Lu
  3. Xiulian Shen
  4. Hong Shao
  5. Lun Suo
  6. Qiang Wu  Is a corresponding author
  1. Shanghai Jiao Tong University, China
  2. Renji Hospital affiliated to Shanghai Jiao Tong University Medical School, China
  3. Shanghai Jiao Tong University Medical School, China
Research Article
  • Cited 0
  • Views 1,000
  • Annotations
Cite as: eLife 2018;7:e35242 doi: 10.7554/eLife.35242

Abstract

Diverse clustered protocadherins are thought to function in neurite morphogenesis and neuronal connectivity in the brain. Here, we report that the protocadherin alpha (Pcdha) gene cluster regulates neuronal migration during cortical development and cytoskeletal dynamics in primary cortical culture through the WAVE (Wiskott-Aldrich syndrome family verprolin homologous protein, also known as Wasf) complex. In addition, overexpression of proline-rich tyrosine kinase 2 (Pyk2, also known as Ptk2b, Cakβ, Raftk, Fak2, and Cadtk), a non-receptor cell-adhesion kinase and scaffold protein downstream of Pcdhα, impairs cortical neuron migration via inactivation of the small GTPase Rac1. Thus, we define a molecular Pcdhα/WAVE/Pyk2/Rac1 axis from protocadherin cell-surface receptors to actin cytoskeletal dynamics in cortical neuron migration and dendrite morphogenesis in mouse brain.

https://doi.org/10.7554/eLife.35242.001

eLife digest

There are hundreds of billions of neurons in a human brain, and each one can form several thousand connections with other neurons. This complex network determines our thoughts, memories, personality, and behavior, but how does it form? During brain development, specific areas give rise to new neurons, which then migrate long distances to other parts of the brain. Upon arrival, they generate several structures, called dendrites, which connect with other neurons.

To distribute themselves correctly, the migrating immature neurons must be able to travel long distances and steer clear of one another. The dendrites from a single mature neuron must also avoid each other, a phenomenon known as self-avoidance. Certain membrane-spanning proteins, called clustered protocadherins, may help neurons achieve this. The portion of the protocadherins that sits on the cell surface is highly variable, and acts as a zipcode that helps cells to recognize one another. However, the section of the protein inside the cell varies little and is shared by all members of a protocadherin family. When the clustered protocadherin is ‘switched on’, this internal segment can trigger a cascade of reactions that create changes in the cell. Yet, little was known about the nature of this signaling cascade.

Using gene editing in mice, Fan, Lu et al. focus on the signaling cascade of the clustered protocadherin alpha family. The experiments show that the internal portion of these proteins interacts with a protein complex called WAVE. It also inhibits an enzyme known as Pyk2, which increases the activity of another enzyme called Rac1 GTPase, that then further activates WAVE. This results in the WAVE complex also interacting with the internal skeleton inside the neurons and dendrites, which regulates the ability of these cells to migrate and of the dendrites to avoid each other.

Many brain conditions, such as autism spectrum disorders or depression, result from abnormal neuronal migration and connectivity. Mutations in the genes of clustered protocadherins increase the risk of these disorders. By showing how these proteins help to regulate the migration and connectivity of neurons, Fan, Lu et al. add to our understanding of brain development in health and disease.

https://doi.org/10.7554/eLife.35242.002

Introduction

The human brain contains approximately 86 billion neurons, and each neuron engages in several thousand specific synaptic connections, resulting in complex neural networks with over 1015 specific connections. These complex neural circuits are required for normal brain function, and inappropriate assemblies of neural circuits underlie neurodevelopmental and neuropsychiatric disorders (Hyman, 2008). A remarkable feature of neurodevelopment is the long-distance neuronal migration from the site of origin to the final destination (Angevine and Sidman, 1961; Ayala et al., 2007). For example, cortical immature neurons generated from the proliferative ventricular and subventricular zones (VZ/SVZ) migrate radially through specific phases to appropriate laminar positions in an ‘inside-out’ manner and then differentiate into distinct subtypes of cortical neurons (Angevine and Sidman, 1961; LoTurco and Bai, 2006; Rakic, 1974). The cortical migration phases include somal translocation, multipolar migration, and glial-guided locomotion (Ayala et al., 2007; Cooper, 2014; Noctor et al., 2004). Newly born bipolar neurons in SVZ assume multipolar or stellate morphology and migrate randomly in the intermediate zone (IZ), moving tangentially, up, or down (Ayala et al., 2007; Cooper, 2014; Jossin and Cooper, 2011; Nadarajah et al., 2003; Noctor et al., 2004; Tabata and Nakajima, 2003). They then transit into bipolar again near the border of IZ/CP (cortical plate) and resume final radial migration to settle in appropriate cortical layers (Ayala et al., 2007; Cooper, 2014; Jossin and Cooper, 2011; Nadarajah et al., 2003; Noctor et al., 2004; Tabata and Nakajima, 2003). Abnormal neuronal migration results in various neurodevelopmental and psychiatric diseases (Ayala et al., 2007; LoTurco and Bai, 2006; Valiente and Marín, 2010); however, the underlying molecular mechanisms for the abnormal neuronal migration is largely unknown.

Human genetics studies have implicated mutations of the clustered protocadherin (Pcdh) cell adhesion genes in the 5q31 region for various developmental and psychiatric disorders (Anitha et al., 2013; Iossifov et al., 2012; Pedrosa et al., 2008; Shimojima et al., 2011). Similar to Dscam1 in Drosophila (Zipursky and Sanes, 2010), diverse clustered Pcdh genes play an important role in establishing neuronal identity and connectivity in the vertebrate brain (Garrett et al., 2012; Lefebvre et al., 2012; Molumby et al., 2016; Nicoludis et al., 2016; Rubinstein et al., 2015; Schreiner and Weiner, 2010; Suo et al., 2012; Thu et al., 2014; Wu and Maniatis, 1999). In mice, 58 clustered Pcdh genes are organized into three closely linked Pcdh α, β, and γ clusters (Pcdha, Pcdhb, and Pcdhg) (Wu et al., 2001). The Pcdh α and γ clusters are each consisted of variable and constant regions, similar to that of the Ig, Tcr, and Ugt1 gene clusters (Wu, 2005; Wu and Maniatis, 1999; Wu et al., 2001; Zhang et al., 2004). In particular, the variable region of the mouse Pcdhα cluster contains 12 highly similar ‘alternate exons’, α1-α12, whose promoters are stochastically activated by distal enhancers, and two divergent c-type ‘ubiquitous exons’, αc1 and αc2, whose promoters are constitutively activated by distal enhancers (Figure 1A) (Guo et al., 2012). Each variable exon is separately spliced to the common set of downstream constant exons, generating diverse mRNAs and proteins. CCCTC-binding factor (CTCF)/Cohesin-mediated topological chromatin-looping domains are crucial for proper expression of Pcdhα proteins (Guo et al., 2015; Huang and Wu, 2016). Each variable exon encodes an extracellular domain (ectodomain EC1-6), a transmembrane segment, and a juxtamembrane variable cytoplasmic domain (VCD) (Shonubi et al., 2015; Wu and Maniatis, 1999), whereas the three constant exons encode a common membrane-distal constant domain (CD) of all Pcdhα proteins (Figure 1A). This suggests that diverse extracellular cues converge on a single intracellular signaling pathway. However, the functional significance of this intriguing arrangement remains obscure.

Figure 1 with 1 supplement see all
Pcdhα is required for cortical neuron migration.

(A) Schematics of the mouse Pcdhα organization. Var, variable region; Con, constant region; EC, ectodomain; VCD, variable cytoplasmic domain; αCD, Pcdhα constant domain. (B) GFP and F-actin immunostaining of cortical coronal sections from E12.5, E15.5, and P0 PcdhαGFP mouse brain. Nuclei are counterstained with DAPI. Upper left inset shows the PcdhαGFP mouse line construction. (C) Immunostaining with an antibody specific for PcdhαCD of cortical coronal sections from E15.5 wild-type mouse brains. Nuclei were counterstained with DAPI. (D) Cortical coronal sections of E19.5 mouse brain which were electroporated at E15.5 with control (SCR: scrambled) or αKD (α shRNA1 or α shRNA2) plasmids. Nuclei were counterstained with DAPI. Quantification of GFP+ cell distribution across the cortex (divided into ten equal bins) is shown on the right. n = 6 brains for each group. Statistical significance was assessed using one-way ANOVA, followed by a post-hoc Tukey’s multiple comparisons test. (E) Representative multipolar neurons and their lucida drawings in the red boxes shown in (D). Asterisks indicate multipolar cells. (F) Embryonic brains were electroporated at E15.5 and organotypic slices were prepared from brains at E17.5. Representative frames from a 10 hr time-lapse imaging experiment are shown. Asterisks indicate one migrating cell. See also Video 1. (G and H) Typical migration traces (G) and migration velocity (H) of control and αKD neurons in a time-lapse experiment shown in (F). n = 15 cells for each group. Student’s t test. (I) Cortical coronal sections of E15.5 embryos electroporated at E12.5 with control or αKD plasmids. Nuclei were counterstained with DAPI. (J) Quantification of E15.5 control and αKD GFP+ cells in CP, IZ, and VZ. n = 5 brains for SCR, n = 4 brains for αKD. Student’s t test. Data as mean ± SEM. ****p<0.0001. *p<0.05. See Figure 1—source data 1. Scale bar, 20 μm for (F) and (G); 50 μm for (E); 100 μm for all other panels. MZ, marginal zone; CP, cortical plate; IZ, intermediate zone; SVZ, subventricular zone; VZ, ventricular zone.

https://doi.org/10.7554/eLife.35242.003

A large family of cell-surface receptors, including Pcdhα6 (Pcdha6), recruit WAVE complex to the plasma membrane (Chen et al., 2014; Nakao et al., 2008; Tai et al., 2010). The WAVE complex is a conserved two-partite pentameric complex consisting of a pseudosymmetric dimer of Sra1/Cyfip1 and Nap1/Hem2, and a heteromeric trimer of HSPC300/Brick, Abi1/2/3, and WAVE1/2/3/SCAR (Chen et al., 2010). First, Abi2 interacts with Abelson tyrosine kinase (Abl kinase) and has been implicated in cortical radial migration (Xie et al., 2013). Second, WAVEs/SCARs are members of the Wiskott-Aldrich syndrome protein (WASP) and WASP verprolin homologous protein family, defined by a conserved VCA domain (verprolin homologous, cofilin homologous or central hydrophobic, and acidic regions) (Chen et al., 2010). Third, VCA is inhibited by intermolecular interaction with Sra1 and intramolecular interaction within WAVE (Chen et al., 2010; Padrick et al., 2011; Rohatgi et al., 1999). Fourth, Rac1 binds to WAVE complex and induces a conformational change to release VCA from its inhibitory state and to activate actin filament nucleation and branching through the Arp2/3 complex (Chen et al., 2010; Lebensohn and Kirschner, 2009; Padrick et al., 2011; Rohatgi et al., 1999; Ti et al., 2011). Finally, Pyk2, a calcium-dependent cell-adhesion kinase and scaffold protein highly expressed in the brain and inhibited by Pcdhα, also regulates neurodevelopment (Chen et al., 2009; Hsin et al., 2010; Lev et al., 1995; Suo et al., 2012). However, whether and how WAVE complex and Pyk2 kinase function in cortical neuron migration are not clear.

Here, we report that Pcdhα proteins play a critical role in neuronal migration and cytoskeletal dynamics. Specifically, we define an actin cytoskeleton remodeling pathway by which Pcdhα regulates lamellipodial and filopodial dynamics and neuronal migration as well as dendrite morphogenesis through interaction with WAVE complex via the WIRS (WAVE interacting receptor sequence) motif of Pcdhα constant domain (CD). In addition, Pyk2 regulates cortical neuron migration by inactivating the small GTPase Rac1. Given that actin cytoskeletal dynamics are central for neurite morphogenesis and neuronal migration, our findings have interesting implications for mechanisms of Pcdhα functions in dendrite self-avoidance and neuronal self/nonself recognition in normal brain development as well as aberrant neuron migration and dendrite morphogenesis underlying complex neurodevelopmental diseases.

Results

Defective cortical neuron migration with Pcdhα knockdown

We mapped the embryonic expression pattern of Pcdhα by using a GFP knockin mouse line (PcdhαGFP) (Wu et al., 2007) and found that Pcdhα proteins are expressed throughout the developing forebrain (Figure 1B). Immunostaining with an antibody against alpha constant domain (αCD) revealed that Pcdhα proteins are expressed in all cortical regions and most prominently in the intermediate zone and marginal zone (IZ and MZ) of the developing neocortex (Figure 1C). RT-PCR with isoform-specific primers showed that, starting at E10, every member of the Pcdhα cluster is expressed in the developing brain (Figure 1—figure supplement 1A). Pcdhα knockdown (αKD) with two independent shRNAs, each targeting a distinct subdomain of the constant region by in utero electroporation (IUE), revealed a significant decrease of migrating neurons in the cortical plate (CP) and a concomitant increase within the lower intermediate zone, suggesting defects in multipolar migration (Figure 1D and Figure 1—figure supplement 1B). The αKD multipolar neurons in the intermediate zone display stunted processes, as shown by lucida drawings (Figure 1E). Live cell imaging of brain organotypic slice culture demonstrated the slower velocity of multipolar migration of αKD neurons compared to controls (Figure 1F–H and Video 1). In addition, early born αKD neurons also have migration defects, suggesting that Pcdhα is also required for glia-independent somal translocation (Figure 1I and J). This suggests that Pcdhα is required for migration of immature cortical neurons.

Video 1
Movement of multipolar neurons of control and αKD electroporated cortices.

One frame per 15 min. Playback speed seven frames/s. Scale bar, 50 μm.

https://doi.org/10.7554/eLife.35242.007

To rule out the possibility of altered progenitor proliferation, we labeled αKD mouse brain with BrdU and analyzed cell proliferation. Compared with controls, αKD results in no significant difference of percentage of BrdU+ cells (Figure 1—figure supplement 1C and D). In addition, αKD does not alter the percentage of Tbr2+intermediate progenitor cells (IPCs) (Figure 1—figure supplement 1E and F), nor the morphology of brain lipid binding protein (BLBP)-labeled radial glia cells (Figure 1—figure supplement 1G). Moreover, the defect is not due to increased apoptosis (Figure 1—figure supplement 1H). Finally, there is no cortical migration defect (Figure 1—figure supplement 1I) in mice with deletion of the entire Pcdhα cluster (αKO) (Wu et al., 2007). The phenotypic discrepancy may be due to known genetic compensation mechanisms induced by deletion but not knockdown (Rossi et al., 2015).

Rescuing cortical neuron migration by single Pcdhα isoforms and constant domain

To rescue the migration defect, we constructed shRNA-resistant forms of α6 (α6*), which represents members of the alternate α1-α12, and of the two divergent c-types (αc1* and αc2*) (Figure 2—figure supplement 1A). Indeed the single α6* isoform rescues the αKD migration defect. The Pcdh αc1* also rescues the migration defect; however, αc2* does not (Figure 2A and Figure 2—figure supplement 1B). This suggests that αc2 has distinct functions other than cortical neuron migration, consistent with very recent findings that αc2 endows serotonergic neurons with a single cell-type identity and specifically mediates the axonal tiling and assembly of serotonergic neural circuitries (Chen et al., 2017).

Figure 2 with 1 supplement see all
Pcdhα regulates cortical neuron migration through the WAVE complex.

(A–C) Cortical coronal sections of E19.5 embryonic brains electroporated at E15.5. Nuclei were counterstained with DAPI. Quantification of GFP+ cell distribution is shown on the right. n = 6 brains for each group. (D) Immunostaining for GFP and WAVE2 in primary cultured cortical neurons from E17.5 PcdhαGFP mice. Nuclei were counterstained with DAPI. (E) Two dimensional histogram of Pcdhα and WAVE2 fluorescence intensity in (D). Pearson's R value is analyzed with the ImageJ software. (F) Schematics of Pcdhα protein structure with the AA mutation of the WIRS motif. (G) Cortical coronal sections of E19.5 embryonic brains electroporated at E15.5. Nuclei were counterstained with DAPI. Quantification of GFP+ cell distribution is shown on the right. n = 6 brains for each group. Data as mean ± SEM. Statistical significance was assessed using one-way ANOVA, followed by a post hoc Tukey’s multiple comparisons test. ****p<0.0001. See Figure 2—source data 1. Scale bar, 50 μm for (D); 100 μm for all other panels. MZ, marginal zone; CP, cortical plate; IZ, intermediate zone; SVZ, subventricular zone; VZ, ventricular zone.

https://doi.org/10.7554/eLife.35242.008

To investigate whether the extracellular domain and transmembrane segment play a role in cortical neuron migration, we replaced them with a myristoylation signal to attach the shRNA-resistant intracellular domain (ICD) to the plasma membrane (Myr-α6ICD*, Myr-αc1ICD*, Myr-αc2ICD*) (Figure 2—figure supplement 1A). We found that Myr-α6ICD* and Myr-αc1ICD* rescue the migration defect, and Myr-αc2ICD* does not (Figure 2—figure supplement 1C and D). This suggests that the intracellular domain of Pcdhα plays an important role in cortical neuron migration. To investigate why Myr-αc2ICD* cannot rescue the migration defect, we constructed an αc2 VCD-deleted form, which is, by definition, a myristoylated α constant domain (Myr-αCD*) (Figure 2—figure supplement 1A). Intriguingly, we found that Myr-αCD* rescues the migration defect (Figure 2—figure supplement 1C and D). This demonstrated that αc2 variable cytoplasmic domain has an inhibitory function. Consistently, sequence analysis revealed that αc2 variable cytoplasmic domain is the longest and most divergent among those of αc1 as well as of α1-α12 (Figure 2—figure supplement 1E). Together, these data suggest that members of the Pcdhα family except αc2 regulate cortical neuron migration through their common constant domain.

Rescuing cortical neuron migration by the WAVE complex

Recent studies linked Pcdhα6 to the WAVE complex through the WIRS (WAVE interacting receptor sequence) motif within the Pcdhα constant domain (Chen et al., 2014). We thus investigated whether Pcdhα regulates cortical neuron migration through WAVE. Remarkably, we found that overexpression of either WAVE2 (Wasf2) or Abi2 in vivo rescues the cortical neuron migration defect of αKD neurons (Figure 2B) although they themselves have no apparent influence on cortical neuron migration (Figure 2C). Consistently, endogenous Pcdhα and WAVE2 co-localize in primary cultured cortical neurons (Figure 2D and E). In addition, mutating the WIRS motif (from FITFGK to FIAAGK) of α6*, αc1*, and Myr-αCD* (α6*-AA, αc1*-AA, and Myr-αCD*-AA) abolishes the rescue effect (Figure 2F and G, in comparison to Figure 2A and Figure 2—figure supplement 1D). As controls, these WIRS-mutated isoforms as well as wild types appears to reach the plasma membrane (Figure 2—figure supplement 1F). Thus, Pcdhα regulates cortical neuron migration through the WAVE complex.

A role of Pyk2 in cortical neuron migration

Pcdhα physically interacts with and negatively regulates the Pyk2 kinase (Chen et al., 2009). In addition, we previously found that Pcdhα regulates dendritic and spine morphogenesis through inhibiting Pyk2 activity (Suo et al., 2012). To this end, we investigated whether knockdown of Pyk2 could rescue cortical neuron migration defects of αKD. Although Pyk2 (Ptk2b) knockdown (Pyk2KD) per se or CRISPR knockout of Pyk2 (Pyk2KO) does not affect cortical neuron migration (Figure 3A and Figure 3—figure supplement 1A), we found that Pyk2KD rescues the defect of cortical neuron migration in αKD (Figure 3A and Figure 3—figure supplement 1B). This suggests that Pcdhα regulates cortical neuron migration, at least in part, through the inhibition of Pyk2.

Figure 3 with 1 supplement see all
Pyk2 regulates cortical neuron migration.

(A) Cortical coronal sections of E19.5 embryonic brains electroporated at E15.5. Nuclei were counterstained with DAPI. Quantification of GFP+ cell distribution is shown on the right. n = 6 brains for each group. Statistical significance was assessed using one-way ANOVA, followed by a post hoc Tukey’s multiple comparisons test. (B) Cortical coronal sections of E19.5 embryonic brains electroporated at E15.5 with control or Pyk2-overexpressing (Pyk2OE) plasmids. Nuclei were counterstained with DAPI. Quantification of GFP+ cell distribution is shown on the right. n = 6 brains for each group. (C) High magnification of cortical neurons in the red boxes shown in (B). Lucida drawings are shown in the lower panels. (D) Percentage of GFP+ cells with multipolar morphology in IZ of control and Pyk2OE groups shown in (B). n = 6 brains for each group. (E) Primary process number per cell in IZ of control and Pyk2OE groups shown in (B). n = 10 cells for each group. (F) Typical cortical plate neuron morphology of control and Pyk2OE groups shown in (B). Arrowheads, aberrant branching leading processes. (G) Branch number of leading processes per cortical plate neuron of control and Pyk2OE groups shown in (F). n = 11 cells for each group. (H) Embryonic brains were electroporated in utero with control or Pyk2OE plasmids at E15.5. The organotypic slices are cut at E17.5. Representative frames from a 9 hr time-lapse are shown. Arrowheads, neurites; Arrow, leading process. See also Video 2. (I) Quantification of the migration velocity of control and Pyk2OE neurons. n = 19 cells for each group. (J) Golgi staining (green, arrowheads) of Pyk2OE neurons (magenta) in IZ at E19.5. Arrow indicates the orientation to CP. (K) Percentage of cells with Golgi facing the CP of control and Pyk2OE groups. n = 3 sections for each group. Data as mean ± SEM. Student’s t test for (B), (D), (E), (G), (I), (K); ***p<0.001; ****p<0.0001. See Figure 3—source data 1. Scale bar, 100 μm for (A, B); 50 μm for (C); 20 μm for all other panels. MZ, marginal zone; CP, cortical plate; IZ, intermediate zone; SVZ, subventricular zone; VZ, ventricular zone.

https://doi.org/10.7554/eLife.35242.012

We next asked whether overexpression of Pyk2 (Pyk2OE) could recapitulate αKD cortical neuron migration defects. We found that the majority of Pyk2OE cells are stalled in the middle intermediate zone (mIZ) (Figure 3B), a stage little later than the stalling of αKD cells (Figure 3A). In addition, these mIZ cells have aberrant multipolar morphology with supernumerary primary processes in comparison to single leading processes of control cells (Figure 3C–E). For the very few Pyk2OE cells in the lower cortical plate (CP), they harbor elaborated leading processes (Figure 3F and G); by contrast, control cells displayed typical bipolar morphology with a single or bifurcated thick leading process (Figure 3F and G). Pyk2OE leads to the inhibition of Rac1 activity (Suo et al., 2012). As Rac1 is thought to provide the spatial information for actin polymerization (Tahirovic et al., 2010), loss of Rac1 activity leads to aberrant actin polymerization at many sites with no controlled spatial information, resulting in supernumerary primary processes (Figure 3C–E) and more branchy morphology (Figure 3F and G). Finally, time-lapse imaging showed that there is a significant difference of velocity of cortical neuron migration between Pyk2OE and control cells (Figure 3H and I, and Video 2). These data suggest that Pyk2OE partially recapitulates cortical neuron migration defects.

Video 2
Movement of bipolar neurons of control and Pyk2OE electroporated cortices.

One frame per 15 min. Playback speed seven frames/s. Scale bar, 10 μm

https://doi.org/10.7554/eLife.35242.016

We next examined the orientation of the Golgi apparatus of cells in mIZ, which is essential for transporting vesicles for oriented motility (Jossin and Cooper, 2011), by immunostaining with a Golgi marker GM130 (Figure 3J). Most Golgi complexes are normally localized in front of the cell nucleus and are oriented toward the cortical plate (Jossin and Cooper, 2011). However, the polarity of most Pyk2OE cells is disrupted, showing oblique or inverted orientation of the Golgi apparatus (Figure 3J and K). Thus, Pyk2OE blocks multipolar-bipolar transition by disrupting proper localization of the Golgi apparatus. Finally, early-born Pyk2OE neurons are also stalled at the intermediate zone, suggesting that Pyk2 also plays a role in somal translocation (Figure 3—figure supplement 1C and D).

To rule out the potential nonspecific effect of the CAG promoter, which is active in both progenitors and postmitotic neurons, we ectopically overexpressed Pyk2 at E15.5 only in postmitotic neurons using the NeuroD promoter (Jossin and Cooper, 2011). We found that Pyk2OE under the NeuroD promoter also significantly impairs cortical neuron migration in postmitotic neurons (Figure 3—figure supplement 1E-G). Taken together, this suggests that Pcdhα regulates cortical neuron migration, at least in part, through inhibiting Pyk2 kinase activity.

Regulation of cortical neuron migration by Pyk2 via Rac1

We previously found that Rac1 is epistatic downstream of Pyk2 in dendrite development and spine morphogenesis (Suo et al., 2012). To investigate whether Pyk2-Rac1 pathway also functions in cortical neuron migration, we overexpressed a constitutive active form Rac1 (Rac1Q61L) in Pyk2OE neurons. We found that Rac1Q61L rescues defects of multipolar migration and morphology of Pyk2OE neurons (Figure 4A–C), although Rac1Q61L itself has no apparent effect on cortical neuron migration (Figure 4D). However, overexpression of another constitutively active form of Rac1 (Rac1G12V) impairs cortical neuron migration (Figure 4D) (Konno et al., 2005) and cannot be used to rescue, likely because it has a lower affinity for GTP and thus lower constitutive activity than Rac1Q61L. Thus, the two constitutively active forms of Rac1 have distinct roles in cortical neuron migration (Figure 4A and D). Together, we conclude that Pyk2OE inhibits multipolar-bipolar transition and leads to aberrant branchy morphology in the intermediate zone by inactivating the small GTPase Rac1.

Figure 4 with 1 supplement see all
Pyk2 regulates cortical neuron migration through Rac1 inhibition.

(A) Cortical coronal sections of E19.5 embryonic brains electroporated in utero at E15.5. Nuclei were counterstained with DAPI. Quantification of GFP+ cell distribution is shown on the right. n = 6 brains for each group. (B) High magnification of cortical neurons in the red boxes shown in (A). (C) Percentage of multipolar neurons in the IZ region. n = 6 brains for each group. (D) Cortical coronal sections of E19.5 embryos electroporated at E15.5. Nuclei were counterstained with DAPI. Quantification of GFP+ cell distribution is shown on the right. n = 6 brains for each group. Data as mean ± SEM. Statistical significance was assessed using one-way ANOVA, followed by a post hoc Tukey’s multiple comparisons test. ns, not significant; ***p<0.001; ****p<0.0001. See Figure 4—source data 1. Scale bar, 50 μm for (B); 100 μm for other panels. MZ, marginal zone; CP, cortical plate; IZ, intermediate zone; SVZ, subventricular zone; VZ, ventricular zone.

https://doi.org/10.7554/eLife.35242.017

Dissection of Pyk2 domain in cortical neuron migration

Pyk2 functions as an enzyme through its middle kinase domain and as a molecular scaffold through its N-terminal FERM (four-point-one, ezrin, radixin, moesin) domain (Figure 4—figure supplement 1A) (Chen et al., 2009; Lev et al., 1995; Suo et al., 2012). We systematically engineered Pyk2 by mutating a series of key residues of its enzymatic kinase cascade. We found that overexpression of Pyk2Y402F, an autophosphorylation mutant that still can be activated by endogenous Pyk2, as well as Pyk2Y579F, Pyk2Y580F, and Pyk2Y881F, still recapitulate the migration defects of αKD (Figure 4—figure supplement 1A and B). However, overexpression of Pyk2K457A, which has a mutation at the catalytic center and is completely kinase-dead (Suo et al., 2012), cannot recapitulate the migration defects of αKD (Figure 4—figure supplement 1A and B). This suggests that the catalytic activity of overexpressed Pyk2 is essential for recapitulating the migration defects of αKD.

Remarkably, overexpression of the Pyk2 FERM domain alone recapitulates the blocking activity of Pyk2OE (Figure 4—figure supplement 1A and C), whereas deletion of FERM domain abolishes the blocking (Figure 4—figure supplement 1A and C). Consistently, the C-terminal FAT domain of Pyk2 is not required for the blocking effect and the kinase domain alone cannot block cortical neuron migration (Figure 4—figure supplement 1A and C). This is consistent with that Pyk2 has important kinase-independent functions in contextual fear memory (Suo et al., 2017). Together, we conclude that both Pyk2 kinase cascade and FERM scaffold are crucial for blocking cortical neuron migration.

As stated above, constitutive active Rac1Q61L rescues the blocking effect of Pyk2OE (Figure 4A). However, we found that Rac1Q61L cannot rescue the blocking activity of FERM domain (Figure 4—figure supplement 1D). This suggests that constitutive active form of Rac1 only functions downstream of the kinase cascade but not the FERM scaffold of Pyk2.

Pcdhα in lamellipodial formation and cytoskeletal dynamics

We next investigated actin dynamics underlying neuronal migration in primary cultured cortical neurons. The early development of primary cultured neurons can be divided into two stages: stage 1, in which the cell body is surrounded by flattened lamellipodia and stage 2, in which the lamellipodia transform into definitive processes with growth cones (Dotti et al., 1988). At stage 1, we found that the size of lamellipodia around cell cortex in αKD neurons decreases significantly compared with controls (Figure 5A and B). In addition, α6*, αc1*, or Myr-αCD* rescues the αKD lamellipodial defect. By contrast, αc2* does not rescue (Figure 5C and D), which is consistent with that αc2* cannot rescue the defects of cortical neuron migration (Figure 2A). Moreover, mutating the WIRS motif (from FITFGK to FIAAGK) in either α6*, αc1*, or Myr-αCD* abolishes their rescue effects (Figure 5E and F), similar to the situation in cortical neuron migration (Figure 2G). Finally, both WAVE2 and Abi2 rescue the lamellipodial defect (Figure 5G and H).

Figure 5 with 1 supplement see all
Pcdhα regulates lamellipodial dynamics.

(A, C, E, G) Primary cultured cortical neurons from E17.5 embryonic cortices, electroporated at E15.5, were in-vitro cultured for 24 hr, immunostained by Tuj1 antibody for tubulin and counterstained with phalloidin for F-actin. Arrowheads, lamellipodia; Arrows, defective lamellipodia. (B, D, F, H) Quantification of lamellipodial size per neuron shown in (A), (C), (E), (G). n = 16 cells for SCR, αKD, αKD+αc1*, αKD+αc1*-AA, and αKD+αc2*; n = 15 cells for αKD+α6*, αKD+α6*-AA; n = 12 cells for αKD + Myr-αCD*-AA, αKD + Abi2; n = 11 cells for αKD + Myr-αCD*; n = 10 cells for αKD + WAVE2. (I) Representative frames from time-lapse imaging of primary cortical neurons cultured in vitro for 24 hr. See also Video 3. Arrowheads, lamellipodia. All data are presented as a scatter-dot plot. The median is shown as a line with the interquartile range. Student’s t test for (A). For (D), (F), (H), statistical significance was assessed using one-way ANOVA, followed by a post hoc Tukey’s multiple comparisons test. ***p<0.001; ns, not significant. See Figure 5—source data 1. Scale bar, 10 μm.

https://doi.org/10.7554/eLife.35242.021

At stage 2, αKD results in a significant decrease of percentage of primary neurites with lamellipodia-like protrusions (Figure 5—figure supplement 1A and B). Consistent with the situation at stage 1, α6*, αc1*, or Myr-αCD* rescues this αKD lamellipodial defect while αc2* does not (Figure 5—figure supplement 1C and D), and mutating the WIRS motif (from FITFGK to FIAAGK) abolishes the rescue effects of either α6*, αc1*, or Myr-αCD* (Figure 5—figure supplement 1E and F). In addition, consistent with stage 1, both WAVE2 and Abi2 rescue the lamellipodial defect of stage 2 αKD neurons (Figure 5—figure supplement 1G and H).

Finally, αKD lamellipodial dynamics are significantly impaired in comparison with control neurons, whose veil-like lamellipodia are motile and are constantly extending and retracting in both stage 1 and stage 2 neurons (Figure 5I, Figure 5—figure supplement 1I, Video 3 and Video 4). These data demonstrated that Pcdhα is indispensable for lamellipodial dynamics. Because lamellipodial dynamics are essential for cell migration (Krause and Gautreau, 2014), this suggests that cortical neuron migration defects of αKD are a consequence of impairment of lamellipodial formation and cytoskeletal dynamics.

Video 3
Dynamics of stage1 control and αKD primary cultured cortical neurons.

One frame per 5 min. Playback speed seven frames/s. Scale bar, 20 μm

https://doi.org/10.7554/eLife.35242.025
Video 4
Dynamics of stage2 control and αKD primary cultured cortical neurons.

One frame per 5 min. Playback speed seven frames/s. Scale bar, 40 μm

https://doi.org/10.7554/eLife.35242.026

A comparison between PcdhαKD and Pyk2OE in cytoskeletal dynamics

Consistent with that Pyk2KD rescues cortical neuron migration defects of PcdhαKD (Figure 3A), we found that knockdown of Pyk2 in αKD cells results in a significant increase of lamellipodial sizes of stage1 neurons as well as of the percentage of primary neurites with lamellipodia of stage2 neurons (Figure 6A–C). In addition, Pyk2OE results in a significant decrease of lamellipodial sizes, consistent with that of αKD (Figure 6D and E).

Figure 6 with 1 supplement see all
A comparison between PcdhαKD and Pyk2OE in cytoskeletal dynamics.

(A) Primary cultured cortical neurons, derived from E17.5 embryonic cortices which were electroporated at E15.5 with αKD or αKD + Pyk2 KD plasmids, were in-vitro cultured for 24 hr and immunostained by a Tuj1 antibody for tubulin, counterstained with phalloidin for F-actin. Arrowheads, lamellipodia; Arrows, defective lamellipodia. (B) Quantification of lamellipodial size per stage 1 neuron shown in A). Student’s t test; n = 10 cells for both groups. (C) Percentage of primary neurites with lamellipodia per stage 2 neuron. Student’s t test; n = 12 cells for both groups. (D) Primary cultured cortical neurons, derived from E17.5 embryonic cortices which were electroporated at E15.5 with indicated plasmids, were in-vitro cultured for 24 hr and immunostained by a Tuj1 antibody for tubulin, counterstained with phalloidin for F-actin. Arrowheads, lamellipodia; Arrows, filopodia. (E) Quantification of lamellipodial size per stage1 neuron shown in (D). Statistical significance was assessed using one-way ANOVA, followed by a post hoc Tukey’s multiple comparisons test. n = 10 cells for each group. (F) Quantification of filopodial number per stage 1 neuron shown in (D). Statistical significance was assessed using one-way ANOVA, followed by a post hoc Tukey’s multiple comparisons test. n = 10 cells for each group. (G) Quantification of primary neurite number per stage 2 neuron shown in (D). Statistical significance was assessed using one-way ANOVA, followed by a post hoc Tukey’s multiple comparisons test. n = 13 cells for each group. All data are presented as a scatter-dot plot. The median is shown as a line with the interquartile range. ****p<0.0001; ***p<0.001; ns, not significant. See Figure 6—source data 1. Scale bar, 10 μm.

https://doi.org/10.7554/eLife.35242.027

Filopodia are thin membrane protrusion pushed by underlying actin bundles and filopodial formation is also dependent on Arp2/3 complex (Mattila and Lappalainen, 2008), we found that Pyk2OE results in a significant increase of filopodial number per stage 1 neuron as well as of primary neurite number per stage 2 neuron despite no alternation in αKD cells (Figure 6D–G). Finally, similar to the rescue of cortical neuron migration defects of PykOE (Figure 4A), we found Rac1Q61L rescues both lamellipodial and filopodial defects of Pyk2OE (Figure 6D–G). In summary, although both αKD and Pyk2OE impact cytoskeletal dynamics, they have subtle differences on both lamellipodia and filopodia.

To see whether growth cones with lamellipodia and filopodia are affected in vivo, we co-electroporated Lifeact, an actin marker, with either αKD or Pyk2OE plasmids into the developing mouse cortex. In the lower intermediate zone, αKD neurons exhibit abnormal enrichment of Lifeact-labeled actin structures in stunted processes and cell bodies, while the control neurons extend long processes with growth cones (Figure 6—figure supplement 1A). In the upper intermediate zone, Pyk2OE neurons exhibit branchy morphology with multiple aberrant processes; however, the control neurons have normal bipolar morphology with single leading processes and growth cones (Figure 6—figure supplement 1B).

Discussion

Recent studies revealed that a zipper-like ribbon structure assembles from combinatorial cis- and trans-interactions between like-sets of the clustered Pcdhs located in apposed plasma membranes of neighboring cells (Nicoludis et al., 2016; Rubinstein et al., 2015; Schreiner and Weiner, 2010; Thu et al., 2014; Wu, 2005). These protocadherin interactions could provide enormous diversity and exquisite specificity for neuronal connectivity and neurite self-avoidance required for mammalian brain development. While exquisite specificity is determined by strict homophilic trans-interactions of highly diversified EC2/3 (Goodman et al., 2017; Molumby et al., 2016; Nicoludis et al., 2016; Rubinstein et al., 2015; Schreiner and Weiner, 2010; Thu et al., 2014; Wu, 2005); enormous diversity is mainly generated by promiscuous cis-interactions of highly conserved EC5/6 (Nicoludis et al., 2016; Rubinstein et al., 2015; Schreiner and Weiner, 2010; Thu et al., 2014; Wu, 2005). One intriguing genomic architecture of the Pcdhα cluster is multiple tandem variable exons followed by a single set of three constant exons, encoding a common cytoplasmic constant domain, which is shared by all members of the Pcdhα family (Figure 1A) (Huang and Wu, 2016; Wu and Maniatis, 1999). The extracellular domains of Pcdhα provide enormous diversity and exquisite specificity for cell recognition and adhesion (Nicoludis et al., 2016; Rubinstein et al., 2015; Schreiner and Weiner, 2010; Thu et al., 2014; Wu, 2005). However, the intracellular Pcdhα signaling pathway is largely unknown.

We propose a Pcdhα-based WAVE clustering model for cortical neuron migration (Figure 7). Distinct Pcdhα isoforms on the cell surface recruit WAVE complex to the cell cortex under the plasma membrane. This is strongly supported by (1) the specific interaction between members of the Pcdhα family and the WAVE complex through the WIRS motif in Pcdhα constant domain (Chen et al., 2014); (2) the rescue of migration and lamellipodial defects of αKD neurons by WAVE complex subunits WAVE2 and Abi2; and (3) the abolishment of the rescue effect by WIRS mutations. The WIRS motif of members of the Pcdhα family binds to a composite surface formed by Abi2 and Sra1 of the WAVE complex (Chen et al., 2014). In addition, the Pcdhα proteins may also recruit WAVE complex through the direct binding of Abi2 C-terminal SH3 domain to the four protocadherin PXXP motifs, which are specific to the constant domain of the Pcdhα but not Pcdhγ family (Wu and Maniatis, 1999). Consistently, WAVE2 and Abi2 are required for growth cone activity during cortical neuron migration (Xie et al., 2013).

Figure 7 with 1 supplement see all
A working model of WAVE clustering by protocadherins for actin cytoskeletal dynamics and cortical neuron migration as well as dendrite morphogenesis.

On the neuron surface, Pcdhα family proteins recruit WAVE complex to the plasma membrane via the WIRS motif in the Pcdhα constant domain. In addition, Pcdhα proteins also bind to the Pyk2 kinase and inactivate it, thus disinhibits the small GTPase Rac1. The disinhibited Rac1 activates the WAVE complex by inducing a conformation change to release the VCA domains, which are required to activate actin-nucleation by the Arp2/3 complex, leading to actin filament branching as well as lamellipodial and filopodial formation. Finally, this protocadherin Pyk2/Rac1/WAVE axis is central for actin cytoskeletal dynamics and cortical neuron migration. The distinct variable cytoplasmic domain of Pcdhαc2 may cause it non-functional for cortical neuron migration. This WAVE clustering model may be a general mechanism for diverse functions of alpha protocadherins in dendrite self-avoidance and neuronal self/nonself recognition as well as dendrite morphogenesis as demonstrated by Sholl analyses (Figure 7—figure supplement 1).

https://doi.org/10.7554/eLife.35242.030

We recently found that N-WASP, a homolog of WAVE2, also regulates cortical neuron migration (Shen et al., 2018). In addition, Pcdhα binds to Pyk2 via the intracellular domain and inhibits Pyk2 phosphorylation and activation (Chen et al., 2009; Suo et al., 2012), resulting in disinhibition of small GTPase Rac1 (Figure 7). Moreover, our data suggest that Pyk2 also has kinase-independent scaffolding activity through its FERM (four-point-one, ezrin, radixin, moesin) domain, similar to the FERM domain of FAK, which binds numerous interacting partners and connects cell cortex to diverse downstream intracellular pathways (Frame et al., 2010). Rac1, in conjunction with Pcdhα, activate the WAVE complex (Chen et al., 2010; Lebensohn and Kirschner, 2009; Rohatgi et al., 1999). Two activated WAVE complexes, probably induced by protocadherin dimerization, in turn stimulate actin-nucleating activity of Arp2/3 through the two VCAs (Padrick et al., 2011; Ti et al., 2011). The Arp2/3-mediated actin branching nucleation is central for cytoskeletal dynamics and cell motility (Krause and Gautreau, 2014; Lebensohn and Kirschner, 2009).

Our finding that αKD blocks lamellipodial and filopodial formation and cytoskeletal dynamics is also consistent with the WAVE clustering model. Taken together, we suggest that Pcdhα regulates the formation and dynamics of lamellipodial and filopodial protrusions underlying cortical neuron migration through the WAVE/Pyk2/Rac1 axis (Figure 7). We noted that αKD neurons stall in the lower intermediate zone and Pyk2OE neurons stall in the middle intermediate zone. In other words, αKD phenotype is more severe than that of Pyk2OE. In addition, αKD neurons display stunted processes while Pyk2OE neurons have branchy morphology. Consistently, the WAVE clustering model suggests that, in addition to disinhibition of Pyk2 and consequently inhibition of Rac1, αKD also impairs the membrane recruiting of the WAVE complex directly (Figure 7).

It is puzzling why Pcdhαc2 is different from other members of the Pcdhα family (Figures 2A, 5C and D, and Figure 2—figure supplement 1D, Figure 5—figure supplement 1C and D). However, a recent study revealed an intriguing role of αc2 in serotonergic axonal local tiling and global assembly (Chen et al., 2017). Given the known role of variable cytoplasmic domain of clustered Pcdh proteins in their cytoplasmic association (Shonubi et al., 2015), the unique sequences of the αc2 variable cytoplasmic domain may restrict its role to axonal tiling of serotonergic neurons but not cortical neuron migration.

Diverse roles of the clustered Pcdh genes in axonal targeting, dendritic tiling and self-avoidance, spine morphogenesis, synaptogenesis and connectivity have been reported (Garrett et al., 2012; Katori et al., 2009; Lefebvre et al., 2012; Molumby et al., 2016; Rubinstein et al., 2015; Suo et al., 2012; Thu et al., 2014; Zipursky and Sanes, 2010). In particular, genetic studies demonstrated that Pcdhα functions in axonal projection of olfactory sensory and serotonergic neurons (Chen et al., 2017; Hasegawa et al., 2008; Katori et al., 2009; Mountoufaris et al., 2017). In addition, another WIRS-containing protocadherin, Celsr3, is also central for interneuron tangential migration and Globus Pallidus axonal connectivity in the mouse forebrain (Jia et al., 2014; Ying et al., 2009). It will be interesting to see whether these diverse protocadherin functions, in addition to the crucial role in cortical neuron migration, also require the complex WAVE/Pyk2/Rac1 signaling cascade (Figure 7). Sholl analysis demonstrated that the WIRS domain point mutation rescues the Pcdhα dominant-negative effects on dendrite outgrowth and branching of primary cultured cortical neurons, suggesting that the Pcdhα/WAVE/Pyk2/Rac1 signaling axis indeed functions in dendrite morphogenesis (Figure 7—figure supplement 1). Thus, the regulation of neuronal migration and neurite development by the Pcdhα/WAVE/Pyk2/Rac1 axis through actin cytoskeletal dynamics may be a general mechanism for diverse roles of protocadherins in brain development and function.

Materials and methods

Key resources table
Reagent type (species)
or resource
DesignationSource or referenceIdentifiersAdditional information
Gene
(Mus musculus)
Pcdha6GenBankGenBank:
NM_007767.3
N/A
Gene
(Mus musculus)
Pcdhac1GenBankGenBank:
NM_001003671.1
N/A
Gene
(Mus musculus)
Pcdhac2GenBankGenBank:
NM_001003672.1
N/A
Gene
(Mus musculus)
Ptk2b (Pyk2)GenBankGenBank:
NM_001162366.1
N/A
Gene
(Mus musculus)
Wasf2 (WAVE2)GenBankGenBank:
AY135643.1
N/A
Gene
(Mus musculus)
Abi2GenBankGenBank:
NM_198127.2
N/A
Gene
(Mus musculus)
Rac1GenBankGenBank:
NM_009007.2
N/A
Strain
(Mus musculus)
Pcdhαdel/deldoi:10.1038/ng2060N/AN/A
Strain
(Mus musculus)
PcdhαGFPdoi:10.1038/ng2060N/AN/A
Strain
(Mus musculus)
Pyk2KOdoi:https://doi.org/10.1101/216770N/AN/A
Strain
(Mus musculus)
Pyk2Y402Fdoi:https://doi.org/10.1101/216770N/AN/A
Cell line
(Homo sapiens)
HEK293T/17ATCCCat# CRL-11268N/A
Antibodyanti-beta-actin (mouse monoclonal)ProteintechCat# 60009–1-Ig,
RRID:AB_2687938
N/A
Antibodyanti-Myc (mouse monoclonal)MilliporeCat# 05–724,
RRID:AB_309938
N/A
Antibodyanti-WAVE2 (rabbit polyclonal)MilliporeCat# 07–410,
RRID:AB_310593
N/A
Antibodyanti-Pyk2 (rabbit polyclonal)AbcamCat# ab32571,
RRID:AB_777566
N/A
Antibodyanti-Tbr2 (rabbit polyclonal)AbcamCat# ab23345,
RRID:AB_778267
N/A
Antibodyanti-Tuj1 (mouse monoclonal)CovanceCat# MMS-435P,
RRID:AB_2313773
N/A
Antibodyanti-Pcdhα (rabbit polyclonal)Synaptic SystemsCat# 190003N/A
Antibodyanti-GFP (rabbit polyclonal)InvitrogenCat# A-31852,
RRID:AB_162553
N/A
Cat#anti-BLBP (rabbit polyclonal)MilliporeCat# ABN14,
RRID:AB_10000325
N/A
Antibodyanti-GM130 (mouse monoclonal)BD BioscienceCat# 610822,
RRID:AB_398141
N/A
Antibodyanti-BrdU (mouse monoclonal)Bio-RadCat# MCA2483,
RRID:AB_808349
N/A
Antibodyanti-activated caspase 3 (rabbit polyclonal)Cell Signaling TechnologyCat# 9661,
RRID:AB_2341188
N/A
Software,
algorithm
PrismGraphPad (La Jolla, CA)RRID:SCR_002798N/A
Software,
algorithm
Fijidoi: 10.1038/nmeth.2019RRID:SCR_002285N/A
Software,
algorithm
Clustal X2doi: 10.1093/bioinformatics/btm404RRID:SCR_002909N/A
Recombinant
DNA reagent
pCAG-EGFP (plasmid)doi: 10.1523/JNEUROSCI.6096–09.2010N/AN/A
Recombinant
DNA reagent
pLKO.1-TRC cloning vector (plasmid)Addgeneplasmid #10878N/A
Recombinant
DNA reagent
pNeuroD-ires-GFP (plasmid)doi: 10.1038/nn.2816N/AN/A
Recombinant
DNA reagent
pCAG-Pcdhα6 (plasmid)This paperN/Avector: pCAG;
cDNA fragment: mouse Pcdha6
Recombinant
DNA reagent
pCAG-Pcdhαc1 (plasmid)This paperN/Avector: pCAG;
cDNA fragment: mouse Pcdhac1
Recombinant
DNA reagent
pCAG-Pcdhαc2 (plasmid)This paperN/Avector: pCAG;
cDNA fragment: mouse Pcdhac2
Recombinant
DNA reagent
pCAG-Pyk2 (plasmid)This paperN/Avector: pCAG;
cDNA fragment: mouse Pyk2
Recombinant
DNA reagent
pCAG-WAVE2 (plasmid)This paperN/Avector: pCAG;
cDNA fragment: mouse WAVE2
Recombinant
DNA reagent
pCAG-Abi2 (plasmid)This paperN/Avector: pCAG;
cDNA fragment: mouse Abi2
Recombinant
DNA reagent
pCAG-Rac1 (plasmid)This paperN/Avector: pCAG;
cDNA fragment: mouse Rac1
Recombinant
DNA reagent
pNeuroD-Pyk2-ires-GFP (plasmid)This paperN/Avector: pNeuroD-ires-GFP;
cDNA fragment: mouse Pyk2
Recombinant
DNA reagent
pLKO.1-Pcdhα shRNA1 (plasmid)This paperN/Avector: pLKO.1-TRC;
target: aacagtatccagtgcaacacc
Recombinant
DNA reagent
pLKO.1-Pcdhα shRNA2 (plasmid)This paperN/Avector: pLKO.1-TRC;
target: aattcattatcccaggatctc

Animals

The PcdhαGFP mice were previously described (Suo et al., 2012; Wu et al., 2007). Pyk2KO and Pyk2Y402F mice were generated by CRISPR/Cas9. Animals were maintained at 23°C in a 12 hr (7:00–19:00) light and 12 hr (19:00–7:00) dark schedule. The day of vaginal plug was considered to be embryonic day 0.5 (E0.5). All animal experiments were approved by the Institutional Animal Care and Use Committee (IACUC) of the Shanghai Jiao Tong University.

Generation of CRISPR mice

Mouse lines of Pyk2KO and Pyk2Y402F were generated by using CRISPR/Cas9. Briefly, sgRNA scaffold sequences were constructed in the pLKO.1 plasmid. The construct was then used as template for amplifying a PCR product containing T7 promoter and sgRNA target sequence. The PCR product was gel-purified and used as templates for in vitro transcription of sgRNA (T7-Transcription Kit, Invitrogen). Cas9 mRNA was transcribed in vitro from linearized pcDNA3.1-Cas9 plasmid (T7-ULTRA-Transcription Kit, Ambion). Both Cas9 mRNA and sgRNAs were purified (Transcription Clean-Up Kit, Ambion), mixed in M2 (Millipore) at the concentration of 100 ng/μl, and then injected into the cytoplasm of fertilized eggs of C57BL/6 mice. For Pyk2Y402F mice, single-stranded oligo-donor nucleotides (ssODN) with mutation at Y402 residue and nonsense mutation at PAM sequence were co-injected together with the Cas9 mRNA and sgRNA. After equilibration for 30 min, 15–25 injected fertilized eggs were transferred into fallopian tube of pseudopregnant ICR mouse females. Offspring of these mice were genotyped by PCR, restriction endonuclease digestion, and Sanger sequencing. All oligos used are listed in Supplementary file 1.

Antibodies

The following antibodies were used for biochemistry experiments: mouse anti-β-actin (1:5000, Proteintech), mouse anti-Myc (1:1000, Millipore), rabbit anti-Pyk2 (1:500, Abcam). The following antibodies were used for immunocytochemistry and immunohistochemistry: mouse anti-Tuj1 (1:300, Covance), rabbit anti-αCD (1:500, Synaptic Systems), rabbit anti-GFP (1:1000, Invitrogen), rabbit anti-BLBP (Brain lipid binding protein) (1:500, Chemicon), mouse anti-GM130 (1:1000, BD Bioscience), rat anti-BrdU (1:1000, Bio-Rad), rabbit anti-activated caspase 3 (1:500; Cell Signaling Technology), rabbit anti-Tbr2 (1:500, Abcam), rabbit anti-WAVE2 (1:500, Millipore), goat anti-rabbit Alexa Fluor 488 (1:300, Molecular Probes), goat anti-rabbit Alexa Fluor 568 (1:300, Molecular Probes), goat anti-mouse Alexa Fluor 568 (1:300, Molecular Probes), goat anti-mouse Alexa Fluor 647 (1:300, Molecular Probes).

Plasmid construction

Full-length cDNAs of Pcdha6, Pcdhac1, Pcdhac2, WAVE2 (GenBank AY135643.1), Abi2 (GenBank NM_198127.2) were cloned from mouse brain total RNA preparations by reverse transcriptase PCR (RT-PCR). The cDNAs of Myr-αCD, Rac1 and Rac1G12V, Pyk2 and Pyk2 mutations (Pyk2Y402F, Pyk2K457A, Pyk2Y579F, Pyk2Y580F, Pyk2Y881F), Pyk2 fragments (ΔFERM, ΔFAT, FERM domain, Kinase domain) were cloned from previously published plasmids (Suo et al., 2012). WIRS-mutated and αKD-resistant Pcdhα isoforms (α6*, αc1*, αc2*, Myr-αCD*, α6*-AA, αc1*-AA, Myr-αCD*-AA, Myr-α6ICD*, Myr-αc1ICD*, Myr-αc2ICD*), Rac1Q61L, were constructed from the above plasmids. Constructs used in IUE for overexpression were cloned into the pCAG-Myc vector or pNeuroD-IRES-GFP vector (kindly provided by Dr. Franck Polleux, Columbia University) using restriction enzyme sites. For knockdown, short-hairpin RNA (shRNA) coding sequences were cloned into the pLKO.1 vector. All oligo sequences with corresponding restriction enzyme sites are listed in Supplementary file 1. Plasmids were validated by Sanger sequencing.

In utero electroporation (IUE)

IUE was performed as previously described with modifications (Saito and Nakatsuji, 2001). Briefly, dams were anesthetized with pentobarbital sodium. pLKO.1-shRNAs (2 μg/μl) for knockdown or pCAG-Myc (2 μg/μl) constructs for overexpression were mixed with GFP-expressing plasmid pCAG-eGFP (0.5 μg/μl) and 0.05% fast green. Laparotomy was performed to expose the uteri. The plasmid mixture was injected into the lateral ventricle of the embryonic brain. Five electrical pulses were applied at 40 Volts for a duration of 50 ms at 900 ms intervals using a tweezertrode (3 mm, BTX) with an electroporator (Gene Pulser System, Bio-Rad). The uterine horns were placed back into the abdominal cavity to allow the embryos to continue normal development.

Cortical neuron primary culture, organotypic slice culture, and time-lapse imaging

For cortical neuron primary culture, electroporated cortices were collected from E17.5 embryos in Hanks’ Balanced Salt Solution (HBSS) with 0.5% glucose, 10 mM Hepes, 100 μg/ml penicillin/streptomycin. The cortices were then digested with 0.25% trypsin for 10 min at 37°C. The reaction was terminated with 0.5 mg/ml trypsin inhibitor for 3 min at room temperature (RT). The cortical tissues were gently triturated in the plating medium (MEM with 10% FBS, 1 mM glutamine, 10 mM Hepes, 50 μg/ml penicillin/streptomycin) until fully dissociated. Cell viability and density were determined using 0.4% trypan blue and a hemocytometer. The dissociated cells (1 × 105) were plated into four-well chamber or 35-mm glass-bottom Petri dish precoated with 100 μg/ml poly-L-lysine (Sigma) and 5 μg/ml laminin (Invitrogen). The cells were incubated with 5% CO2 at 37°C for 4 hr. The plating medium was then replaced with a serum-free culture medium (Neurobasal medium, 2% B27, 0.5 mM glutamine, 50 μg/ml penicillin/streptomycin supplemented with 25 μM glutamate). For immunocytochemistry, cells were cultured for additional 20 hr in vitro (hiv).

For cortical organotypic slice culture, the head of E17.5 embryos were briefly placed in 70% ethanol and the brains were carefully dissected. The brains were embedded in 3% low-melting agarose and glued to the chuck of a water-cooled vibratome (Leica). The 250-μm-thick whole-brain coronal sections were cut and collected in the sterile medium. The organotypic slices were carefully placed in a 0.4 μm membrane cell culture insert (Millipore) in a six-well plate. Slices were cultured in slice culture medium: 67% Basal Medium Eagle (BME), 25% HBSS, 5% FBS, 1% N2, 1% penicillin/streptomycin/glutamine (Invitrogen) and 0.66% glucose (Sigma). Slices (three per well) were cultured in six-well plates at 37°C and 5% CO2, incubated for 6–8 hr. The membrane insert with slices was then transferred on to a glass-bottom Petri dish (MatTek). Images were taken at 3 μm steps with 10–15 optical sections and were captured every 15 min for up to 16 hr with the Nikon A1 confocal laser microscope system.

For single-cell time-lapse imaging, cortical neurons were plated into a 35-mm glass-bottom Petri dish. Images were taken at 1 μm steps with 10–15 optical sections and were captured every 5 min for up to 10 hr with Nikon A1 confocal laser microscope system.

Immunocytochemistry, immunohistochemistry, and imaging

Primary cultured cortical neurons were washed once with PBS, fixed in 4% PFA for 20 min at RT, washed and permeabilized with 0.2% Triton X-100 for 10 min. After blocking with 5% BSA, cells were incubated with primary antibodies at 4°C overnight followed by incubation of secondary antibodies for 1–2 hr at RT. F-actin was labeled by Alexa-546 phalloidin (Sigma). For immunohistochemistry, the dams were sacrificed, and embryonic brains were fixed in 4% PFA overnight at 4°C. The brains were then sectioned at 50 μm with a vibratome (Leica). Sections were washed three times in PBS, blocked in 3% BSA, 0.1% Triton X-100 in PBS for 1 hr at RT, and then incubated with primary antibodies at 4°C overnight and secondary antibodies at RT for 1–2 hr. Cell nuclei were visualized with DAPI. Images were collected with a confocal microscope (Leica) under a 10x objective for brain sections. High-resolution images were collected under a 60x oil objective with a 3x digital zooming factor for primary cultured neurons.

Cell culture and western blot

HEK293T cells were maintained in DMEM with 10% FBS and 100 μg/ml penicillin/streptomycin. Cultured cells were transfected using Lipofectamine 2000 (Invitrogen). Total protein of HEK293T cells was extracted by lysis buffer (50 mM Tris–HCl, pH 7.5, 150 mM NaCl, 1% NP40, 0.5% sodium deoxycholate, 0.1% SDS) with protease inhibitors and then centrifuged at 12,000 × g at 4°C for 30 min. The lysates were subjected to Western blot analyses.

Reverse transcriptase PCR (RT-PCR)

Total RNA was extracted from embryonic mouse brain tissues with TRIzol (Ambion). The reverse-transcription reaction was performed with 1 μg total RNA preparations. All oligos used are listed in Supplementary file 1.

Statistical analysis/image analysis and quantification

For each group, the IUE experiments were performed using at least three pregnant female mice, by which we usually harvested at least six embryonic brains. We obtained 15 ~ 20 sections from each electroporated brain, and quantified one typical section per brain. Nearly identical areas in the presumptive somatosensory cortices of anatomically matched brain sections were chosen for imaging and quantification. For bin analysis, the cortices were divided into ten equal bins and all GFP+ neurons in each bin were counted. In total, about 150 ~ 300 cells were counted per section. Statistical significance was assessed using one-way ANOVA, followed by a post hoc Tukey’s multiple comparisons test.

In primary culture experiments, the development stage of cultured neurons were defined as in Dotti’s paper: at stage 1, the cell body was surrounded by flattened lamellipodia; at stage 2, the lamellipodia transformed into neural processes with growth cones (Dotti et al., 1988). We immunostained the cultured cells with Tuj1 (Neuron-specific class III beta-tubulin) antibody, a neuron-specific marker, to exclude differentiated glia or radial glia. For quantification, we selected neurons with typical stage 1 or stage 2 morphology based on GFP and phalloidin signals. For stage 1 neurons, we selected the lamellipodia region by the wand tool in the ImageJ software (NIH) and measured the area size. For stage 2 neurons, the neurite tips with F-actin-enriched protrusions two folds larger than its width were defined as ‘neurite with lamellipodia’. Sholl analysis was performed as previously described (Suo et al., 2012).

The significance of differences between two groups was analyzed using unpaired Student’s t tests. One-way ANOVA was used for multiple comparisons by the GraphPad software.

References

  1. 1
  2. 2
  3. 3
  4. 4
  5. 5
  6. 6
  7. 7
  8. 8
  9. 9
  10. 10
  11. 11
  12. 12
  13. 13
  14. 14
  15. 15
  16. 16
  17. 17
  18. 18
  19. 19
  20. 20
  21. 21
  22. 22
  23. 23
  24. 24
  25. 25
  26. 26
  27. 27
  28. 28
  29. 29
  30. 30
  31. 31
  32. 32
  33. 33
  34. 34
  35. 35
  36. 36
  37. 37
  38. 38
  39. 39
  40. 40
  41. 41
  42. 42
  43. 43
  44. 44
  45. 45
  46. 46
  47. 47
  48. 48
  49. 49
  50. 50
  51. 51
  52. 52
  53. 53
  54. 54
  55. 55
  56. 56
  57. 57
  58. 58
  59. 59
  60. 60
  61. 61
  62. 62

Decision letter

  1. Jeremy Nathans
    Reviewing Editor; Johns Hopkins University School of Medicine, United States

In the interests of transparency, eLife includes the editorial decision letter and accompanying author responses. A lightly edited version of the letter sent to the authors after peer review is shown, indicating the most substantive concerns; minor comments are not usually included.

Thank you for submitting your manuscript "A Pcdhα/WRC/Pyk2/Rac1 Axis for Cortical Neuron Migration and Lamellipodial Dynamics" to eLife. Your article has been reviewed by a Senior Editor, a Reviewing Editor, and three reviewers. As you will see, all of the reviewers were impressed with the importance and novelty of your work.

In the reviews and the follow-up discussion, the major points regarding new experimental data that emerged are: (1) it would be useful to see comparison of the Pcdhα KO vs. the Pcdhα KD (knockdown) phenotypes; (2) likewise, a comparison between Pcdhα KD vs. Pyk2-OE (over-expression) phenotypes to determine the extent to which the defects are similar and thus consistent with misregulation of a Pcdhα-WRC-Pyk2 axis in neuronal migration and cytoskeletal dynamics; (3) assessing whether the mutant versions of Pcdhα go to the plasma membrane; and (4) describe sample sizes and consider other statistical tests such as ANOVA for comparing multiple groups.

We are including the three reviews at the end of this letter, as there are many specific and useful suggestions in them. We appreciate that the reviewers' comments cover a broad range of suggestions for improving the manuscript. Please use your best judgment in deciding which of these can be accommodated in a reasonable period of time. We look forward to receiving your revised manuscript.

Reviewer #1:

Cortical neurons born from the proliferative ventricular zone and subventricular zones migrate radially to reach the appropriate laminar positions during development. Wu et al. have investigated the role of protocadherin cell surface molecules, and their downstream signaling through the WAVE complex and Pyk2 kinase, in radial migration. The authors carried out an extensive set of experiments utilizing in vivo genetic manipulation, live imaging, immunohistochemistry, and primary cell culture to address this question. Using electroporation of shRNA targeting the common intracellular domain of the protocadherin-α cluster (Pcdhα), they find a dramatic effect on migration: Pcdhα knockdown sequesters neurons within the lower intermediate zone and inhibits them from arriving at the cortical plate. This effect is then shown to involve signaling through Pyk2, WAVE, and Rac1. Knockdown of Pcdhα elevates Pyk2 function; the deleterious effects of increased Pyk2 are shown to require Pyk2 kinase activity as well as its scaffolding FERM domain.

Overall, this is an interesting study. Little is known about signaling downstream of protocadherins, so this is a nice contribution. The authors provide a thorough and convincing picture of how Pcdhα/WRC/PKY2/Rac1 axis affects cortical neuron migration. The findings are generally well supported by the data presented. However, additional data may help make this study more impactful and is needed to support some of the conclusions.

Specific comments:

1) The authors demonstrated a clear lamellipodial phenotype in culture. However, its link to neuron phenotype in vivo was fuzzy. For one thing, the "stunted neurites" (subsection “Defective cortical neuron migration with Pcdhα knockdown”) morphology was not well documented. I had trouble appreciating the neuronal morphology in Figure 1E. The authors should include drawings of individual cells, as was done in Figure 3C (Pyk2 overexpression), because it is hard to tell the morphological detail in these panels.

2). Related to this: Based on the images provided in Figure 1E and Video 1 and Video 2, the Pyk2 overexpressing cells seem more branchy than Pcdhα knockdown cells. The authors' model requires both manipulations to affect the same underlying actin cytoskeletal biology. How do the authors explain the difference in morphology?

3) Last point on the morphology of migrating cells: It is unclear whether the "stunted neurite" morphology of Pcdhα-knockdown cells is due to altered lamellipodia. Same is true for extra branches in Pyk2 overexpressing cells. I thought I could discern some lamellipodia-like structures in Video 1 and Video 2, although without actin labeling it's hard to be sure. To connect the in vivo phenotype to the cultured cell phenotype, the authors should use an actin marker (e.g. lifeact) to find out if lamellipodia are affected in vivo.

4) The authors state that the WIRS motif is located in the common intracellular domain shared by most Pcdhα family members. They cite Chen et al., 2014 for this information. This is the paper that shows interaction of WAVE complex with the WIRS domain of Pcdhα6. I could not find documentation in that paper of where WIRS is located (i.e. is it in the variable or common cytoplasmic region). The authors should clarify how they determined that WIRS is in the common region. If it were in the variable region, they would need to show biochemical interactions with WAVE for other Pcdhα isoforms, to demonstrate that their point mutants are indeed disrupting this particular interaction. As long as it's in the common region I think the interaction shown in Chen et al. is sufficient.

5) There is not enough information provided on how the bin analysis was done to measure neuronal migration. The authors state "n=6." I assume that is the number of animals (please confirm). But how many sections were analyzed per animal, and how many cells were analyzed per section? How were particular sections/cells/fields of view selected for analysis? Also, since statistical comparisons were presumably made for multiple bins, the authors should justify the use of a T-test (rather than ANOVA with post-hoc comparisons) and/or explain how they controlled for multiple comparisons.

6) The authors concluded that Rac1Q61L cannot rescue the blocking activity of FERM domain alone. However, from the images shown in Figure 4—figure supplement 1D, this looks to me like a partial rescue compare to the control (FERM domain only) condition. In the absence of further data I don't necessarily agree with the authors' conclusion that FERM domain acts independently of Rac1. A related point: It would be helpful to have at least brief consideration in the Discussion of how the FERM domain could function without the kinase. This would help guide readers who don't know much about FERM domains.

7) The authors refer to cultured neurons at "Stage 1" and "Stage 2" but these terms are not defined. Please elaborate. Also, it should be stated in the methods how cultured cells were selected for analysis (e.g. is there a way to tell neurons from differentiated glia or radial glia). Finally, the Materials and methods section should include more detail on how lamellipodia were counted – i.e. what criteria were used to distinguish them from other protrusions.

8) There are many abbreviations throughout the manuscript. These abbreviations can make it hard for readers to follow the flow of the story. Since eLife has no length limits, the authors should endeavor to get rid of as many of these as is practical. Everything that is a two-letter abbreviation (e.g. IZ for intermediate zone) for sure, and hopefully others.

9) While the effects of downstream signaling from Pcdhα are demonstrated to be quite important, I was less clear on the authors' model for when this pathway might be activated. Do they think it is constitutively required? Or activated under certain circumstances – i.e. when Pcdhα mediates cell adhesion in a particular context? One possibility raised by the use of electroporation for the loss of function studies is that cells lacking Pcdhα might be at a relative disadvantage compared to the surrounding wild-type cells. This is a phenotype that has been observed for other cell adhesion molecules in other contexts. The authors have previously studied germline Pcdhα knockout mice; it would be quite informative if these animals had a phenotype that was less severe than the sparse knockdown.

10) Finally, a suggestion: Protocadherins have remarkably diverse extracellular domains that allow them to function in many cellular contexts. The authors argue that they are studying the common downstream output of this diverse protein family. It is a plausible argument based on the shared common intracellular domain. However, if they could show that the Pcdhα/WRC/PKY2/Rac1 axis generalizes to other Pcdhα functions – e.g. dendrite morphology, as they have previously studied, or self-avoidance – this would bolster their claim that they are in fact studying a common downstream pathway. Such a finding would, in my opinion, substantially increase the impact of the study. For example, the authors could test whether the WIRS domain point mutants can rescue Pcdhα loss-of-function effects on pyramidal cell dendrite branching.

For the title, all the abbreviations are probably going to stifle accessibility to a broad audience. "Protocadherin" and "WAVE complex" should substitute for their abbreviations, at minimum.

Reviewer #2:

Prior studies have demonstrated interaction between representative clustered and non-clustered protocadherins (Pcdhs) and the WAVE complex. Nevertheless, the biological relevance of Pcdh-VAVE interactions have not been demonstrated. In the current paper, Wu and colleagues report experiments in mice demonstrating that knockdown of α Pcdh leads to defects in neuronal migration, which can be rescued by reintroduction of a single a-Pcdh isoform. Mapping of the molecular regions responsible show that the cytoplasmic region can rescue alone, and this effect is lost by mutation of the a-Pcdh WAVE-binding WIRS sequence. Additional knockdown and overexpression experiments of non-receptor tyrosine kinase Pyk2, known to interact with Pcdh cytoplasmic regions, suggest that Pyk2 inhibits migration. Dissection of Pyk2 identifies the FERM domain as a key actor. Pyk2 appears to exert its effects by modulating the activation state of Rac1. Altogether, the authors define a putative pathway by which a-Pcdh interaction recruits the WAVE complex to the membrane to regulate neuronal migration. Concomitantly, a-Pcdh down-regulates Pyk2, leading to activation of WAVE through Rac1 activation.

Overall, this is a fascinating paper, which adds biological context to the previously reported interaction between Pcdhs and the WAVE complex. It should be of high interest to people in the field.

There are a number of questions raised by the findings, which are not addressed in the Discussion section:

1) How could ABI2 rescue if there's no anchor to the membrane?

2) Why is there no effect on brightness of GFP in αKD cells?

3) Two different Rac1 mutations have different effects, but potential interpretations are not discussed.

4) Overexpression of Pyk2 leads to a defect, which is further along than for αKD. Overexpression of the Pyk2 FERM domain recapitulates this phenotype, and overexpression of Pyk2 lacking the FERM domain appears wild-type. Since defects seem to be associated with FERM domain overexpression. It is hard to understand why the overexpression of a full-length kinase-dead Pyk2, containing the FERM domain, yields a wild-type phenotype. The authors should comment on this observation.

5) It would help to improve the description of the differences between the α-Pcdhs that give different phenotypes. These different phenotypes are presumably due to differences in the juxtamembrane "variable" cytoplasmic domain region. A sequence alignment showing differences between the α-Pcdhs would be useful. Also, it would help to mark the location of the WAVE-binding WIRS peptide.

Reviewer #3:

This is an interesting manuscript reporting on a pathway in which α-Pcdhs influence neuronal migration through regulation of WAVE-Pyk2-RAC1 signaling. The clustered Pcdhs regulate diverse aspects of neuronal patterning, but little is known of the pathways by which Pcdhs transduce signals and regulate cytoskeletal dynamics. This group and others have shown that Pcdhs influence neurite patterning by negatively regulating Pyk2 and FAK, and indirectly promoting activation of Rac1. Another group identified a WAVE-interacting sequence motif present in α-Pcdhs, suggesting that Pcdhαs may also signal through the WAVE complex (Chen et al., 2014).

Here, the authors test whether α-Pcdhs functionally interact with a WAVE-Pyk2-RAC1cascade by interrogating them in the context of cortical neuronal migration. They show that knock-down of Pcdhαs causes cortical migration defects, and then further manipulate Pcdhα and WAVE-Pyk2-RAC1 components through in utero electroporation and neuronal culture studies to determine their functional relationships. Their main conclusions are: (1) knockdown of Pcdhα specifically affects the extent and rate of migration, and this phenotype cannot be rescued by αc2 or by Pcdhα with mutations in the putative WAVE interacting motif (WIRS); (2) migration defects are observed when its downstream inhibitory target Pyk2 is overexpressed; and (3) the influence of α-Pcdhs on actin remodeling is also illustrated in lamellipodia formation and rescued by overexpression of Wave and Abl1 kinase.

Overall, the study is important and provides the first demonstration of functional interactions between WAVE and Pcdhαs. However, there are several concerns that need to be addressed (see below), which would require further experiments and analyses. The major weaknesses are the omission of studies using Pcdhα-KO tissue and the lack of biochemical data showing interactions between Pcdhα and WAVE components. Moreover, the study manipulates different components of the pathway, but it fails to compare the phenotypes to each other. And the manipulations on Pyk2, Rac1 etc., are not verified in the context of Pcdh-a KD-induced migration defects. Therefore, the studies fall short of demonstrating a Pcdhα-WAVE-Pyk2-Rac1 axis in the regulation of cortical migration and cytoskeletal dynamics.

1) The study is limited to shRNA-mediated knockdowns of Pcdhα, and does not extend to Pcdhα-KO brains. The omission is perplexing as the authors have generated and studied Pcdhα-KO mice in previous work (i.e. Wu et al., 2008; Suo et al., 2012). Data from Pcdhα-KO mice would significantly improve the quality of the results and, support the findings from the knockdown approaches. If they no longer carry these mice, they could obtain KO or conditional Pcdhα brains from other groups to report whether migration phenotypes are detected in fixed mutant tissue. If migration defects are not detected, they could further investigate if developmental delays, redundancy among Pcdhs, or possibly differential adhesion resulting from Pcdh mosaicism contributes to the mutant knockdown phenotype. Moreover, they could include an additional control for the shRNA by IUE Pcdhα-6 shRNA into Pcdh-aKO mice.

2) The images showing Pcdhα protein expression and co-localization with WAVE are not informative. In Figure 1, the panels are low magnification. High power images of Pcdhαs localized along processes of migrating neurons (in WT and IUE tissue with GFP+ labeled neurons) should be shown. In Figure 2, the localization of Pcdhα and WAVE appear to cytosolic rather than at the membranes. Have the authors detected their co-localization in neuronal membranes in migrating cells in IUE tissue, or in growth cones or lamellipodia (i.e. in Figure 5, and Figure 5—figure supplement 1; Xie et al., 2013), which would be relevant to this study? Note that other groups have used membrane-targeted GFP for IUE-mediated labeling of migrating neurons to better resolve neurite structures (i.e. Lyn-GFP in Xie et al., 2013).

3) The 'WIRS' sequence in Pcdhα6 proposed by Chen et al., (2014) resides in the 3rd constant exon, which is shared by all Pcdhαs, including αc2. Interestingly, the authors show that, in contrast to α6 and αc1, full-length αc2 does not rescue the phenotype. However, deleting the αc2 variableCD leads abolishes this effect, suggesting that the αc2 variableCD distinguishes the activity of αc2 from the other Pcdhαs. This is potentially important and could advance the idea Pcdhα isoforms have different functions through their VCDs. But follow-up is needed, especially given that Pcdhαs also differ in their extracellular domains. The authors could test if chimeric forms of full-length Pcdhα can rescue the migration phenotype (i.e. α6 ECD-αc2 VCD-αCD).

4) The finding in Figure 2G that mutating the WIRS motif in Pcdhαs fails to rescue migration is very interesting. However, it is premature to conclude: "Thus, Pcdhα regulates cortical neuron migration through the WRC complex". Additional data are needed: (1) Control experiments showing that this mutant Pcdhα-WIRS (AA) variant reaches the cell surface. There are reports in in vitro models suggesting that Pcdhαs do not traffic well to the cell-surface, and so it would be good to distinguish between alternate possibilities; and (2) Biochemical data showing interactions between Pcdhα and WAVE, such as pulldowns, preferably using cortical tissue. At the very least, pulldown assays in cell lines (as done by Chen et al., 2014) could be done to show that interactions are abolished with this mutant form.

5) In Figure 3, Pyk2OE also leads to neuronal migration phenotypes, but these mutant neurons are multipolar with increased branching, and their Golgi are misoriented. Were these phenotypes analyzed in Pcdhα-KD tissue? Migrating Pcdhα-KD neurons look bipolar in Figure 1, but there are no Lucida drawings. Likewise, does electroporating the constitutive Rac1 mutant rescue cortical defects in Pcdhα-KD? Again, comparing the same phenotypes across the manipulations would strengthen study's objective that a Pcdhα-WRC-Pyk2 axis regulates neuronal migration and cytoskeletal dynamics.

6) In subsection “Dissection of Pyk2 domain in cortical neuron migration”, the authors describe the Pyk2 structure-function analyses in terms 'recapitulating the migration defects of αKD'. 'Recapitulate' is misused here. Do they mean phenocopy? If that is the case, there is not sufficient evidence for this. As stated in point 5, the phenotypes were not evaluated in the same way, and Pyk2OE leads to multipolar phenotypes that is not shown for αKD. While the Pyk2 structure function analyses do reveal relevant domains, I fail to see how they inform on αKD regulation of Pyk2 activity. Moreover, these manipulations were limited to Pyk2, and were not coupled with αKD manipulations (I initially expected co-transfection experiments but found no description of this approach).

7) The migration defects are vaguely described in the Results section and are not sufficiently discussed in the context of previous studies. Many phenotypes are described, but the biological significances of these effects and whether the components produce the same effects are unclear.

For example, in subsection “A role of Pyk2 in cortical neuron migration”, the authors note that Pyk2OE leads to a multipolar phenotype. They interpret the results:

"Thus, Pyk2OE blocks multipolar migration by disrupting proper localization of the Golgi apparatus", but this statement is not fully supported by the data, nor are relevant citations given. Jossin et al., showed that Golgi orientation is important for orientating the direction of migration, but does not affect the speed. Here, Pyk2OE also affects migration speed.

Regarding this point: "Finally, early born Pyk2OE neurons are also stalled at IZ, suggesting that Pyk2 also plays a role in somal translocation (Figure 3—figure supplement 1C and 1D)."

The relevant example is presented in Figure 3H, in the live imaging. But no quantifications are presented.

Xie et al., 2013 showed that during the radial migration phase, cortical neurons undergo a multipolar-bipolar transition in their morphology for glia-guided locomotion, which is dependent on WAVE2, Abi2 (Xie et al., 2013). Is this relevant to the Pcdhα-WAVE-Pyk2 pathway? This could be expanded in the Discussion section.

8) The sequence of results are disconnected and the rationales are not clear.

For example, the transitions between Pcdhα to Pyk2 and back to Pcdhα are disconnected, and the two seem like separate studies.

Subsection “A role of Pyk2 in cortical neuron migration”

“We previously found that Pcdhα regulates dendritic and spine morphogenesis through inhibiting Pyk2 kinase activity (Suo et al., 2012). To this end, we investigated whether Pyk2 was involved in Pcdhs-regulated cortical neuron migration.”

The authors could better articulate their goal to test whether there is increased Pyk2 in αKD tissue, and provide experiments combining KD and Pyk2 manipulations.

Another example: It's not clear why the authors chose to further analyze the functional interactions between Pcdhα and Abi/Wave in lamellipodia using cultures of naïve, non-polarized neurons. Why not revisit this more mature lamellipodia structures relevant to migration, such as leading processes. The data on 'primary neurites' in Figure 5—figure supplement 1 are more convincing than those in Figure 5.

9) The method used for quantifying lamellipodia should be described. Which fluorescent structure was used? (GFP? F-Actin?). The GFP appears to be cytosolic and may not fully resolve the membrane structures.

10) Samples sizes are not properly described. Ns are given, but it's not clear what they comprise. The authors should report the numbers of cells, sections analyzed, animals per litter, numbers of litter/replicates.

11) Statistical tests are limited to t-tests. But in many instances, multiple groups are analyzed and thus ANOVA and post-hoc multiple comparisons would be more suitable.

12) I think it is also premature to exclude effects on survival, since quantification of numbers of GFP labeled cells in each IUE manipulation are not given. Cleaved-caspase 3 might only be detected during a small window, and labeled cells are cleared rapidly.

https://doi.org/10.7554/eLife.35242.043

Author response

In the reviews and the follow-up discussion, the major points regarding new experimental data that emerged are: (1) it would be useful to see comparison of the Pcdhα KO vs. the Pcdhα KD (knockdown) phenotypes;

Thanks for your insightful synthesis. We have performed the experiments suggested by the three reviewers. The resulting new data are presented as new figures or figure panels. The new Figure1—figure supplement 1I shows new data of the Pcdhα knockout mice by IUE experiments with GFP plasmids. Quantification revealed that there is no significant difference between heterozygous and homozygous Pcdhα KO mice. Thus, there appears to be no cortical neuron migration defect in embryonic Pcdhα KO mice. This is consistent with the normal cortical layering of the adult Pcdhα KO mice reported in our original paper (Wu et al., 2007). In addition, there are not uncommon for the different phenotypes between acute gene inactivation by RNAi and constitutive germline knockout by gene targeting (Bai et al., 2003; Corbo et al., 2002; de Nijs et al., 2009; Koizumi et al., 2006; Pramparo et al., 2010; Rossi et al., 2015; Suzuki et al., 2009; Young-Pearse et al., 2007).

Perhaps the most famous and relevant examples are the established role of doublecortin and doublecortin-like in cortical neuron migration. Knockdown of either doublecortin or doublecortin-like results in clear and convincing cortical neuron migration defects. By contrast, knockout of either doublecortin or doublecortin-like results in no cortical neuron migration defects (Bai et al., 2003; Corbo et al., 2002; Gotz, 2003; Koizumi et al., 2006; Pramparo et al., 2010). In our case of the Pcdhα, we have two independent shRNA targeting different subregions of the common constant region of all members of the Pcdhα family. In addition, we also have clear rescue experiments by shRNA-resistant constructs. These data provide strong and convincing evidence for a role of Pcdhα in cortical neuron migration. We have added the following sentence to the Results section: “Finally, there is no cortical migration defect (Figure 1—figure supplement 1I) in mice with deletion of the entire Pcdhα cluster (αKO) (Wu et al., 2007). The phenotypic discrepancy may be due to known genetic compensation mechanisms induced by deletion but not knockdown (Rossi et al., 2015).”

(2) likewise, a comparison between Pcdhα KD vs. Pyk2-OE (over-expression) phenotypes to determine the extent to which the defects are similar and thus consistent with misregulation of a Pcdhα-WRC-Pyk2 axis in neuronal migration and cytoskeletal dynamics;

We have performed extensive in-vitro and in-vivo (with Lifeact) experiments to compare αKD vs. Pyk2OE phenotypes in cytoskeletal dynamics and neuronal migration. The resulting data are presented in the new Figure 6 and Figure 6—figure supplement 1. We renamed the old Figure 6 as the new Figure 7 accordingly. We added a new subsection to the Results section: “A comparison between PcdhαKD and Pyk2OE in cytoskeletal dynamic”:

“Consistent with that Pyk2KD rescues cortical neuron migration defects of PcdhαKD (Figure 3A), we found that knockdown of Pyk2 in αKD cells results in a significant increase of lamellipodial sizes of stage1 neurons as well as of the percentage of primary neurites with lamellipodia of stage2 neurons (Figure 6A-6C). In addition, Pyk2OE results in a significant decrease of lamellipodial sizes, consistent with that of αKD (Figure 6D and 6E). […] In the upper intermediate zone, Pyk2OE neurons exhibit branchy morphology with multiple aberrant processes; however, the control neurons have normal bipolar morphology with single leading processes and growth cones (Figure 6-figure supplement 1B).”

Although both α knockdown and Pyk2 overexpression result in cortical neuron migration defects, they do display subtle differences. We added the following two sentences to the Discussion section: “We noted that αKD neurons stall in the lower intermediate zone and Pyk2OE neurons stall in the middle intermediate zone. In other words, αKD phenotype is more severe than that of Pyk2OE. In addition, αKD neurons display stunted processes while Pyk2OE neurons have branchy morphology.”

(3) assessing whether the mutant versions of Pcdhα go to the plasma membrane;

Indeed, these control experiments are important as previous transfection experiments have suggested that cell-surface delivery of Pcdhα to neuronal membrane requires Pcdhγ (Bonn et al., 2007; Goodman et al., 2017; Murata et al., 2004; Schreiner and Weiner, 2010; Thu et al., 2014). To this end, we constructed C-terminal Myc-tagged mutant versions of α6*-AA, αc1*-AA, Myr-αCD*-AA, as well as their corresponding wildtypes α6*, αc1*, Myr-αCD*, and transfected each mutant version or their corresponding wildtype into primary cultured neurons, which are most likely expressing Pcdhγ. We then immunostained these primary cultured neurons with Myc antibody to show the location of transfected Pcdhα. Both wildtype and WIRS motif mutant versions are detected at the very tip of neurite ends, so we concluded that they go to the cell-surface. We presented the new data as Figure 2—figure supplement 1F and added the following sentence to the Results section: “As controls, these WIRS mutated isoforms as well as wildtypes appears to reach the plasma membrane (Figure 2—figure supplement 1F).”

and (4) describe sample sizes and consider other statistical tests such as ANOVA for comparing multiple groups.

We have gone through the relevant legends and methods to make corrections. In addition, we have described sample sizes and used ANOVA for comparing multiple groups. Finally, we have added the following subsection of detailed description to the Materials and methods section: “Statistical analysis/ Image analysis and quantification”

Reviewer #1:

[…] Overall, this is an interesting study. Little is known about signaling downstream of protocadherins, so this is a nice contribution. The authors provide a thorough and convincing picture of how Pcdhα/WRC/PKY2/Rac1 axis affects cortical neuron migration. The findings are generally well supported by the data presented. However, additional data may help make this study more impactful and is needed to support some of the conclusions.

Indeed, the novelty of Pcdhα in cortical neuron migration supported by thorough and convincing evidence is the main finding of the work. We have performed additional experiments suggested by Reviewer #1 and obtained new data to make the study more impactful and to support some of the conclusions.

Specific comments:

1) The authors demonstrated a clear lamellipodial phenotype in culture. However, its link to neuron phenotype in vivo was fuzzy. For one thing, the "stunted neurites" (subsection “Defective cortical neuron migration with Pcdhα knockdown”) morphology was not well documented. I had trouble appreciating the neuronal morphology in Figure 1E. The authors should include drawings of individual cells, as was done in Figure 3C (Pyk2 overexpression), because it is hard to tell the morphological detail in these panels.

We thank Reviewer #1 for this suggestion and we have added Lucida drawings of typical cells as in new Figure 1E, to show the morphological differences between control and Pcdhα knockdown neurons. We have changed the sentence from: “The αKD multipolar neurons in IZ display stunted neurites (Figure 1E)” to: “The αKD multipolar neurons in IZ display stunted processes, as shown by lucida drawings (Figure 1E)”.

2) Related to this: Based on the images provided in Figure 1E and Video 1 and Video 2, the Pyk2 overexpressing cells seem more branchy than Pcdhα knockdown cells. The authors' model requires both manipulations to affect the same underlying actin cytoskeletal biology. How do the authors explain the difference in morphology?

We agree that Pyk2OE and αKD neurons have different morphology. As stated above, we have performed additional experiments to compare them and the resulting data are presented in new Figure 6. Our new data show that Pyk2OE results in a significant increase of filopodial number per stage1 neuron and of primary neurite number per stage2 neuron, consistent with more branchy phenotype. Pyk2OE leads to the inhibition of Rac1 activity (Suo et al., 2012). As Rac1 is thought to provide the spatial information for actin polymerization (Tahirovic et al., 2010), loss of Rac1 activity leads to aberrant actin polymerization at many sites with no controlled spatial information, resulting in more aberrant filopodia. This explains that immature Pyk2OE neurons display more branching while wildtype neurons are bipolar.

We therefore added the following sentence to the Results section: “Pyk2OE leads to the inhibition of Rac1 activity (Suo et al., 2012). As Rac1 is thought to provide the spatial information for actin polymerization (Tahirovic et al., 2010), loss of Rac1 activity leads to aberrant actin polymerization at many sites with no controlled spatial information, resulting in more branchy phenotype.”

3) Last point on the morphology of migrating cells: It is unclear whether the "stunted neurite" morphology of Pcdhα-knockdown cells is due to altered lamellipodia. Same is true for extra branches in Pyk2 overexpressing cells. I thought I could discern some lamellipodia-like structures in Video 1 and Video 2, although without actin labeling it's hard to be sure. To connect the in vivo phenotype to the cultured cell phenotype, the authors should use an actin marker (e.g. lifeact) to find out if lamellipodia are affected in vivo.

We thank Reviewer #1 for this insightful suggestion. To address this question, we performed the suggested experiment using the Lifeact to see whether lamellipodia are affected in αKD and Pyk2OE cells. Lifeact was constructed into pCAG plasmid with C-terminal mCherry in-frame fusion, so the Lifeact labeled actin can be observed by red fluoresce. We added a paragraph at the end of the Results section: “To see whether growth cones with lamellipodia and filopodia are affected in vivo, we co-electroporated Lifeact, an actin marker, with either αKD or Pyk2OE plasmids into the developing mouse cortex. […] In the upper intermediate zone, Pyk2OE neurons exhibit branchy morphology with multiple aberrant processes; however, the control neurons have normal bipolar morphology with single leading processes and growth cones (Figure 6—figure supplement 1B).”

4) The authors state that the WIRS motif is located in the common intracellular domain shared by most Pcdhα family members. They cite Chen et al., 2014 for this information. This is the paper that shows interaction of WAVE complex with the WIRS domain of Pcdhα6. I could not find documentation in that paper of where WIRS is located (i.e. is it in the variable or common cytoplasmic region). The authors should clarify how they determined that WIRS is in the common region. If it were in the variable region, they would need to show biochemical interactions with WAVE for other Pcdhα isoforms, to demonstrate that their point mutants are indeed disrupting this particular interaction. As long as it's in the common region I think the interaction shown in Chen et al. is sufficient.

We appreciate these comments and apologize for the confusion. As seen in the new sequence alignments in Author response image 1, the WIRS motif is in the common cytoplasmic region of all members of the Pcdhα protein family. Indeed, in the pioneering study by Chen et al., they reported the physical interactions between the WIRS motif of Pcdhα and the WRC (WAVE) complex (Chen et al., 2014).

Author response image 1
The WIRS motif is in the common cytoplasmic constant domain (CD) of Pcdhα proteins.
https://doi.org/10.7554/eLife.35242.036

5) There is not enough information provided on how the bin analysis was done to measure neuronal migration. The authors state "n=6." I assume that is the number of animals (please confirm). But how many sections were analyzed per animal, and how many cells were analyzed per section? How were particular sections/cells/fields of view selected for analysis? Also, since statistical comparisons were presumably made for multiple bins, the authors should justify the use of a T-test (rather than ANOVA with post-hoc comparisons) and/or explain how they controlled for multiple comparisons.

We have added a paragraph to provide detailed information on how the bin analysis was done to measure neuronal migration: “For each group, the IUE experiments were performed using at least three pregnant female mice, by which we usually harvested at least 6 embryonic brains. We obtained 15~20 sections from each electroporated brain and quantified 1 typical section per brain. Nearly identical areas in the presumptive somatosensory cortices of anatomically matched brain sections were chosen for imaging and quantification. For bin analysis, the cortices were divided into ten equal bins and all GFP+ neurons in each bin were counted. In total, about 150~300 cells were counted per section. Statistical significance was assessed using one-way ANOVA, followed by a post hoc Tukey’s multiple comparisons test.”

We thank Reviewer #1 for pointing out that some of the statistical analyses in manuscript are not correctly used. We agree that Student’s t tests are not appropriate for multiple comparisons. We re-performed all the significance tests using ANOVA with post-hoc comparisons. We added one sentence to the end of the above paragraph.

6) The authors concluded that Rac1Q61L cannot rescue the blocking activity of FERM domain alone. However, from the images shown in Figure 4—figure supplement 1D, this looks to me like a partial rescue compare to the control (FERM domain only) condition. In the absence of further data I don't necessarily agree with the authors' conclusion that FERM domain acts independently of Rac1. A related point: It would be helpful to have at least brief consideration in the Discussion of how the FERM domain could function without the kinase. This would help guide readers who don't know much about FERM domains.

We thank Reviewer#1 for this comment. Because there appears to be more neurons migrated into the cortical plate than FERM in this particular section, we agree that it looks like partial rescue of FERM+Rac1Q61L in old Figure 4—figure supplement 1D. However, as shown in (Author response figure 2) of all six sections from six mouse brains, overall there does not appear to be significant different between FERM+Rac1Q61L and FERM alone. We have nevertheless replaced the FERM+Rac1Q61L image in old Figure 4—figure supplement 1D with a new one (Figure 4—figure supplement 1D) to avoid potential confusion.

It was previously reported that the FERM domain of Pyk2 has a role in malignant glioma cell migration (Lipinski et al., 2006), and Pyk2 FERM domain is involved in the regulation of Pyk2 activity by acting to regulate the formation of Pyk2 oligomers which is critical for Pyk2 activity (Riggs et al., 2011). Overwhelming evidence in literature shows that the FERM domain of FAK, a close homolog of Pyk2, has clear kinase-independent scaffolding activity by interacting with numerous partners and regulating downstream signaling (Frame et al., 2010). As suggested we have added the following sentence to the Discussion section to help guide readers about the FERM domain scaffolding: “Moreover, our data suggest that Pyk2 also has kinase-independent scaffolding activity through its FERM (four-point-one, ezrin, radixin, moesin) domain, similar to the FERM domain of FAK, which binds to numerous interacting partners and connects cell cortex to diverse downstream intracellular pathways (Frame et al., 2010).

Author response image 2
Rac1Q61L cannot rescue the blocking activity of FERM domain.
https://doi.org/10.7554/eLife.35242.037

7) The authors refer to cultured neurons at "Stage 1" and "Stage 2" but these terms are not defined. Please elaborate. Also, it should be stated in the methods how cultured cells were selected for analysis (e.g. is there a way to tell neurons from differentiated glia or radial glia). Finally, the Materials and methods section should include more detail on how lamellipodia were counted – i.e. what criteria were used to distinguish them from other protrusions.

Thanks for the suggestion. We added the following to subsection “Pcdh in lamellipodial formation and cytoskeletal dynamics”: “The early development of primary cultured neurons can be divided into two stages: stage1, in which the cell body is surrounded by flattened lamellipodia, and stage2, in which the lamellipodia transform into definitive processes with growth cones (Dotti et al., 1988).”

We selected neurons with typical stage1 or stage2 morphology based on the GFP signal, which labels transfected cells, and the phalloidin signal, which stains F-actin.

We immunostained the cultured cells with a Tuj1 (Neuron-specific class III β-tubulin) antibody, which is regarded as a neuron-specific marker, to exclude differentiated glia or radial glia.

For stage1 neurons, we selected the lamellipodia region by the wand tool in the ImageJ software, and measured the area’s size. For stage2 neurons, the neurite tips with F-actin-enriched protrusions two folds larger than the neurite width are defined as neurites with lamellipodia.

8) There are many abbreviations throughout the manuscript. These abbreviations can make it hard for readers to follow the flow of the story. Since eLife has no length limits, the authors should endeavor to get rid of as many of these as is practical. Everything that is a two-letter abbreviation (e.g. IZ for intermediate zone) for sure, and hopefully others.

Thanks for the suggestion and we have gone through the entire text carefully to get rid of as many as abbreviations as is practical.

9) While the effects of downstream signaling from Pcdhα are demonstrated to be quite important, I was less clear on the authors' model for when this pathway might be activated. Do they think it is constitutively required? Or activated under certain circumstances – i.e. when Pcdhα mediates cell adhesion in a particular context? One possibility raised by the use of electroporation for the loss of function studies is that cells lacking Pcdhα might be at a relative disadvantage compared to the surrounding wild-type cells. This is a phenotype that has been observed for other cell adhesion molecules in other contexts. The authors have previously studied germline Pcdhα knockout mice; it would be quite informative if these animals had a phenotype that was less severe than the sparse knockdown.

Cell motility, in particular cortical neuron migration, is enormously complex (Ayala et al., 2007; Krause and Gautreau, 2014; Mitra et al., 2005). The two highly-similar mammalian cell-adhesion kinases, Pyk2 and FAK, are likely central for cell motility. Our data suggest that Pcdhα and Pyk2 function in cortical neuron migration through WAVE complex to regulate actin fiber dynamics. We think that our working model is dynamic, undulating between activated and inactivated states through coordinated cycles in the cell leading edge and trailing edge. We do not know whether these activities are dependent on the cell-adhesion activity of Pcdhα or not. Nevertheless, in conjunction with the germline knockout experiments, our data suggest that cells lacking Pcdhα might be indeed at a relative disadvantage compared to the surrounding wild-type cells.

As stated above, we have performed the α germline knockout experiments and the new data are presented in Figure 1—figure supplement 1I. Indeed, the knockout mice appear to have no defect in cortical neuron migration. This is strikingly similar to members of the DOUBLECORTIN protein family as discussed extensively above.

10) Finally, a suggestion: Protocadherins have remarkably diverse extracellular domains that allow them to function in many cellular contexts. The authors argue that they are studying the common downstream output of this diverse protein family. It is a plausible argument based on the shared common intracellular domain. However, if they could show that the Pcdhα/WRC/PKY2/Rac1 axis generalizes to other Pcdhα functions – e.g. dendrite morphology, as they have previously studied, or self-avoidance – this would bolster their claim that they are in fact studying a common downstream pathway. Such a finding would, in my opinion, substantially increase the impact of the study. For example, the authors could test whether the WIRS domain point mutants can rescue Pcdhα loss-of-function effects on pyramidal cell dendrite branching.

We thank Reviewer #1 for this good suggestion and we have performed suggested dendritic experiment and Sholl analysis to address whether Pcdhα WIRS motif play a general role in dendrite development and branching. We previously showed that Myr-αCD function as a dominant-negative construct and lead to dendrite developmental defect in cultured hippocampal neurons (Suo et al., 2012). Our new experiments with primary cultured cortical neurons using Myr-αCD reproduced the dendrite developmental defect (Figure 7—figure supplement 1). Strikingly, mutation of the WIRS (from FITFGK to FIAAGK) abolished the dendrite developmental defect, suggesting that other Pcdhα functions such as dendrite development are also dependent on the signaling through the WAVE complex (Figure 7—figure supplement 1). We added the following sentence to the Discussion section: “Sholl analysis demonstrated that the WIRS domain point mutation can rescue the Pcdhα dominant-negative effects on dendrite outgrowth and branching of primary cultured cortical neurons, suggesting that the Pcdhα/WAVE/Pyk2/Rac1 signaling axis indeed functions in dendrite morphogenesis (Figure 7—figure supplement 1).”

For the title, all the abbreviations are probably going to stifle accessibility to a broad audience. "Protocadherin" and "WAVE complex" should substitute for their abbreviations, at minimum.

We have considered carefully and changed the title to: “Αlpha Protocadherins and Pyk2 kinase Regulate Cortical Neuron Migration and Cytoskeletal Dynamics via Rac1 GTPase and WAVE complex”.

Reviewer #2:

[…] Overall, this is a fascinating paper, which adds biological context to the previously reported interaction between Pcdhs and the WAVE complex. It should be of high interest to people in the field.

Indeed, this work provides strong evidence for novel function of the previously reported interactions between Pcdhs and the WAVE complex in the brain.

There are a number of questions raised by the findings, which are not addressed in the Discussion section:

1) How could ABI2 rescue if there's no anchor to the membrane?

We thank Reviewer#2 for this insightful question. There are four PXXP motifs within the common Pcdhα cytoplasmic constant domains which are anchors for ABI2 to the membrane. We have added the following two sentences to the Discussion section: “The WIRS motif of members of the Pcdhα family binds to a composite surface formed by Abi2 and Sra1 of WAVE (Chen et al., 2014). In addition, the Pcdhα proteins may also recruit WAVE through the direct binding of Abi2 C-terminal SH3 domain to the four PXXP motifs, which are specific to the constant domain of the Pcdhα but not Pcdhγ family (Wu and Maniatis, 1999).”

2) Why is there no effect on brightness of GFP in αKD cells?

We are sorry for the confusion. For all the α knockdown IUE experiments, we co-electroporated two separate plasmids: one plasmid expresses shRNA and the other one expresses GFP. The two plasmids should not influence each other. Thus, the GFP expression level is not decreased in αKD neurons.

The GFP is used to label transfected cells in the IUE experiments. If two plasmids are co-electroporated into the mouse brain by IUE, almost all of the transfected cells are co-transfected. This is proved by GFP-mCherry co-electroporation experiments (Author response image 3).

Author response image 3
GFP and mCherry co-electroporation.
https://doi.org/10.7554/eLife.35242.038

3) Two different Rac1 mutations have different effects, but potential interpretations are not discussed.

The two Rac1 mutations are likely have different constitutive activities because the Q61L mutant has a higher affinity for GTP than the G12V mutant (Heasman and Ridley, 2008; Luo et al., 1996; Xu et al., 1997). We have added the following at the end of the relevant sentence: “likely because it has a lower affinity for GTP and thus lower constitutive activity than Rac1Q61L.”

4) Overexpression of Pyk2 leads to a defect, which is further along than for αKD. Overexpression of the Pyk2 FERM domain recapitulates this phenotype, and overexpression of Pyk2 lacking the FERM domain appears wild-type. Since defects seem to be associated with FERM domain overexpression. It is hard to understand why the overexpression of a full-length kinase-dead Pyk2, containing the FERM domain, yields a wild-type phenotype. The authors should comment on this observation.

We thank Reviewer #2 for the comment. As discussed above, Pyk2 has both tyrosine kinase signaling and FERM domain scaffolding activity under physiological conditions. According to the structure of FAK (Lietha et al., 2007), which is a very close homolog of Pyk2 and likely shares similar structures, the FERM and kinase domains are sequestered in an autophosphorylation-closed inactive state. With the kinase-dead mutation, there is no conformational change for opening and phosphorylation, and subsequent Pyk2 activation. Therefore, it is understandable that the overexpression of a full-length kinase-dead Pyk2, despite containing the FERM domain, because of its closed state, still yields a wild-type phenotype of cortical neuron migration.

5) It would help to improve the description of the differences between the α-Pcdhs that give different phenotypes. These different phenotypes are presumably due to differences in the juxtamembrane "variable" cytoplasmic domain region. A sequence alignment showing differences between the α-Pcdhs would be useful. Also, it would help to mark the location of the WAVE-binding WIRS peptide.

We appreciate Reviewer #2 for this good suggestion. We performed the suggested sequence alignment to demonstrate the differences in the juxtamembrane "variable" cytoplasmic domain region (Figure 2—figure supplement 1E). Pcdhα1-Pcdhα12 have relatively short VCDs with high similarity, while Pcdhαc1 and Pcdhαc2 have longer and divergent VCDs. These structural differences may underlie the functional differences between diverse Pcdhα isoforms. We have added the following sentence to the Results section: “Consistently, sequence analysis revealed that αc2 VCD is the longest and most divergent among those of αc1 as well as of α1-α12 (Figure 2—figure supplement 1E).”

The WIRS motif is in the common cytoplasmic constant region of the Pcdhα proteins as described above in addressing reviewer #1’s comments (Author response image 1).

Reviewer #3:

[…] 1) The study is limited to shRNA-mediated knockdowns of Pcdhα and does not extend to Pcdhα-KO brains. The omission is perplexing as the authors have generated and studied Pcdhα-KO mice in previous work (i.e. Wu et al., 2008; Suo et al., 2012). Data from Pcdhα-KO mice would significantly improve the quality of the results and, support the findings from the knockdown approaches. If they no longer carry these mice, they could obtain KO or conditional Pcdhα brains from other groups to report whether migration phenotypes are detected in fixed mutant tissue. If migration defects are not detected, they could further investigate if developmental delays, redundancy among Pcdhs, or possibly differential adhesion resulting from Pcdh mosaicism contributes to the mutant knockdown phenotype. Moreover, they could include an additional control for the shRNA by IUE Pcdhα-6 shRNA into Pcdh-aKO mice.

We appreciate Reviewer #3 for these comprehensive constructive suggestions. As described above, we have performed experiments with Pcdhα knockout mice and there appears no cortical neuron migration defect. We discussed the reasons extensively above. Because of limited time to revise the manuscript, we have not investigated the reasons experimentally. We appreciate the additional control experiment for the shRNA by IUE Pcdh α6 shRNA into α knockout mice. However, we have used two independent shRNAs targeting distinct subregions of the Pcdhα constant region. Most importantly, we have solid rescue results. The consilience of all of these results demonstrates that the αKD defect is not due to off-target.

2) The images showing Pcdhα protein expression and co-localization with WAVE are not informative. In Figure 1, the panels are low magnification. High power images of Pcdhαs localized along processes of migrating neurons (in WT and IUE tissue with GFP+ labeled neurons) should be shown. In Figure 2, the localization of Pcdhα and WAVE appear to cytosolic rather than at the membranes. Have the authors detected their co-localization in neuronal membranes in migrating cells in IUE tissue, or in growth cones or lamellipodia (i.e. in Figure 5, and Figure 5—figure supplement 1; Xie et al., 2013), which would be relevant to this study? Note that other groups have used membrane-targeted GFP for IUE-mediated labeling of migrating neurons to better resolve neurite structures (i.e. Lyn-GFP in Xie et al., 2013).

We thank Reviewer #3 for this comment. It’s hard to detect endogenous Pcdhα localization along processes of migrating neurons in WT and IUE tissues because there are too many cells compact together. The WAVE2 and Abi2 proteins co-localize with F-actin in lamellipodia enriched growth cones (Xie et al., 2013). We have performed GFP staining using the PcdhαGFP mice. As shown in Author response image 4, the endogenous Pcdhα proteins co-localize with F-actin in the growth cones. Together, we conclude that endogenous Pcdhα proteins co-localize with WAVE2/Abi2.

Author response image 4
The localization of endogenous Pcdhα proteins with F-actin in growth cones.
https://doi.org/10.7554/eLife.35242.039

3) The 'WIRS' sequence in Pcdhα6 proposed by Chen et al., (2014) resides in the 3rd constant exon, which is shared by all Pcdhαs, including αc2. Interestingly, the authors show that, in contrast to α6 and αc1, full-length αc2 does not rescue the phenotype. However, deleting the αc2 variableCD leads abolishes this effect, suggesting that the αc2 variableCD distinguishes the activity of αc2 from the other Pcdhαs. This is potentially important and could advance the idea Pcdhα isoforms have different functions through their VCDs. But follow-up is needed, especially given that Pcdhαs also differ in their extracellular domains. The authors could test if chimeric forms of full-length Pcdhα can rescue the migration phenotype (i.e. α6 ECD-αc2 VCD-αCD).

As can be seen from the VCD sequence alignment, each member of the Pcdhα family proteins has a unique VCD sequences, with the αc2 having the longest and most divergent VCD sequences. To test the VCD function, we performed experiments to delete the VCD domain of the α6, αc1, and αc2 protein (Author response image 5). Because myristoylated α constant domain as well as myristoylated α6 and αc1 intracellular domains (ICD) rescues α knockdown phenotype, it is intriguing that neither α6ΔVCD* nor αc1ΔVCD* rescues the αKD cortical neuron migration defect (Author response figure 5). These new data demonstrated again that αVCD is very important (Author response figure 5). Since we already showed the data on Myristoylated αc2 ICD and Myristoylated αc2 CD, namely the deletion of αc2 VCD, it is expected that the chimeric forms of full-length Pcdhα (i.e. α6 ECD-αc2 VCD-αCD) cannot rescue the migration phenotype. To emphasize the difference of αc2 VCD, as stated above, we have added one sentence near the end of the section2 of Results section: “Consistently, sequence analysis revealed that αc2 VCD is the longest and most divergent among those of αc1 as well as of α1-α12 (Figure 2——figure supplement 1E).”

Author response image 5
Deletion of Pcdhα VCDs results in the abolishment of rescue of αKD defects.
https://doi.org/10.7554/eLife.35242.040

4) The finding in Figure 2G that mutating the WIRS motif in Pcdhαs fails to rescue migration is very interesting. However, it is premature to conclude: "Thus, Pcdhα regulates cortical neuron migration through the WRC complex". Additional data are needed: (1) Control experiments showing that this mutant Pcdhα-WIRS (AA) variant reaches the cell surface. There are reports in in vitro models suggesting that Pcdhαs do not traffic well to the cell-surface, and so it would be good to distinguish between alternate possibilities; and (2) Biochemical data showing interactions between Pcdhα and WAVE, such as pulldowns, preferably using cortical tissue. At the very least, pulldown assays in cell lines (as done by Chen et al., 2014) could be done to show that interactions are abolished with this mutant form.

This has been addressed above. We have not done the pulldown because it will not provide stronger evidence than the Chen et al., 2014 paper.

5) In Figure 3, Pyk2OE also leads to neuronal migration phenotypes, but these mutant neurons are multipolar with increased branching, and their Golgi are misoriented. Were these phenotypes analyzed in Pcdhα-KD tissue? Migrating Pcdhα-KD neurons look bipolar in Figure 1, but there are no Lucida drawings. Likewise, does electroporating the constitutive Rac1 mutant rescue cortical defects in Pcdhα-KD? Again, comparing the same phenotypes across the manipulations would strengthen study's objective that a Pcdhα-WRC-Pyk2 axis regulates neuronal migration and cytoskeletal dynamics.

We have added Lucida drawings of αKD neurons, showing the stunted morphology. As stated above, we have changed the sentence from: “The αKD multipolar neurons in IZ display stunted neurites (Figure 1E)” to: “The αKD multipolar neurons in IZ display stunted processes, as shown by lucida drawings (Figure 1E)”. During migration, cortical neurons reach the lower IZ and become multipolar, starting “multipolar migration” at IZ. The multipolar neurons later reorient the Golgi towards the pia at the IZ/CP and establish a dominant pia-directed leading process, this is known as “multipolar-bipolar transition”, leading to radial migration at CP (Cooper, 2013). Since αKD neurons accumulate in the lower IZ with stunted multipolar morphology, not look bipolar, as shown by Lucida drawings. By contrast, Pyk2OE neurons are stalled in the middle IZ (mIZ) with branchy morphology as discussed above, suggesting defects of multipolar-bipolar transition. The Golgi orientation experiment is designed to address the “multipolar-bipolar transition” defect, so we didn’t analyze the Golgi orientation in αKD neurons.

We have performed the suggested rescue experiments of αKD by electroporating Rac1Q61L and of Pyk2OE by electroporating WAVE2. As shown in Author response image 6, they cannot rescue. This is consistent with our model that they do not have a direct relationship.

Author response image 6
Rescue experiments of αKD+Rac1Q61L and Pyk2OE+WAVE2.
https://doi.org/10.7554/eLife.35242.041

6) In subsection “Dissection of Pyk2 domain in cortical neuron migration”, the authors describe the Pyk2 structure-function analyses in terms 'recapitulating the migration defects of αKD'. 'Recapitulate' is misused here. Do they mean phenocopy? If that is the case, there is not sufficient evidence for this. As stated in point 5, the phenotypes were not evaluated in the same way, and Pyk2OE leads to multipolar phenotypes that is not shown for αKD. While the Pyk2 structure function analyses do reveal relevant domains, I fail to see how they inform on αKD regulation of Pyk2 activity. Moreover, these manipulations were limited to Pyk2, and were not coupled with αKD manipulations [I initially expected co-transfection experiments but found no description of this approach].

As discussed extensively above, although both αKD and Pyk2OE have cortical neuron migration defect, they are not exactly the same. αKD neurons stalled at lower IZ and have stunted multipolar morphology. Pyk2OE neurons stalled at middle IZ and have branchy morphology. Thus, we do not mean “recapitulate” as “phenocopy”. It’s known that Pyk2 is negatively regulated by Pcdhα (Chen et al., 2009). Thus, αKD results in increased endogenous Pyk2 activity. The suggested overexpression of various Pyk2 dissection experiments would not provide additional new information.

7) The migration defects are vaguely described in the Results section and are not sufficiently discussed in the context of previous studies. Many phenotypes are described, but the biological significances of these effects and whether the components produce the same effects are unclear.

For example, in subsection “A role of Pyk2 in cortical neuron migration”, the authors note that Pyk2OE leads to a multipolar phenotype. They interpret the results:

"Thus, Pyk2OE blocks multipolar migration by disrupting proper localization of the Golgi apparatus", but this statement is not fully supported by the data, nor are relevant citations given. Jossin et al., showed that Golgi orientation is important for orientating the direction of migration, but does not affect the speed. Here, Pyk2OE also affects migration speed.

As stated above, during the multipolar-bipolar transition, the multipolar cell reorients the Golgi apparatus towards the pia, establishes a dominant pia-directed leading process. This is essential for radial migration. We agree that the statement “Pyk2OE blocks multipolar migration by disrupting proper localization of the Golgi apparatus” is not fully supported by the data. However, Pyk2OE leads to dysregulated Rac1 activity (Suo et al., 2012), resulting in aberrant Arp2/3 and actin assembly. The Golgi apparatus thus cannot reorient. In the end, this results in blocked multipolar-to-bipolar transition. Although Golgi misorientation per se does not affect the speed, the overall radial migration speed is still reduced by Pyk2OE because the cycling of actin fibers at the leading and trailing edges may also be disrupted (in addition to misoriented Golgi).

Regarding this point: " Finally, early born Pyk2OE neurons are also stalled at IZ, suggesting that Pyk2 also plays a role in somal translocation (Figure 3—figure supplement 1C and 1D)."

The relevant example is presented in Figure 3H, in the live imaging. But no quantifications are presented.

The quantification of early born Pyk2OE neurons stalling at IZ is shown in Figure 3—figure supplement 1D in the original manuscript. In addition, the quantifications of live imaging of Figure 3H is shown in Figure 3I in the original manuscript.

Xie et al., 2013 showed that during the radial migration phase, cortical neurons undergo a multipolar-bipolar transition in their morphology for glia-guided locomotion, which is dependent on WAVE2, Abi2 (Xie et al., 2013). Is this relevant to the Pcdhα-WAVE-Pyk2 pathway? This could be expanded in the Discussion section.

We appreciate Reviewer #3 for this insightful suggestion. We have expanded the following text in the Discussion section: “The WIRS motif of members of the Pcdhα family binds to a composite surface formed by Abi2 and Sra1 of WAVE (Chen et al., 2014). In addition, the Pcdhα proteins may also recruit WAVE through the direct binding of Abi2 C-terminal SH3 domain to the four PXXP motifs, which are specific to the constant domain of the Pcdhα but not Pcdhγ family (Wu and Maniatis, 1999). Consistently, WAVE2 and Abi2 are required for growth cone activity during cortical neuron migration (Xie et al., 2013).”

8) The sequence of results are disconnected and the rationales are not clear.

For example, the transitions between Pcdhα to Pyk2 and back to Pcdhα are disconnected, and the two seem like separate studies.

Subsection “A role of Pyk2 in cortical neuron migration”

“We previously found that Pcdhα regulates dendritic and spine morphogenesis through inhibiting Pyk2 kinase activity (Suo et al., 2012). To this end, we investigated whether Pyk2 was involved in Pcdhs-regulated cortical neuron migration.”

The authors could better articulate their goal to test whether there is increased Pyk2 in αKD tissue, and provide experiments combining KD and Pyk2 manipulations.

Thanks for the good suggestion. We have changed the relevant text to: “Pcdhα physically interacts with and negatively regulates the Pyk2 kinase (Chen et al., 2009). In addition, we previously found that Pcdhα regulates dendritic and spine morphogenesis through inhibiting Pyk2 activity (Suo et al., 2012). To this end, we investigated whether knockdown of Pyk2 could rescue cortical neuron migration defects of αKD.”

Another example: It's not clear why the authors chose to further analyze the functional interactions between Pcdhα and Abi/Wave in lamellipodia using cultures of naïve, non-polarized neurons. Why not revisit this more mature lamellipodia structures relevant to migration, such as leading processes. The data on 'primary neurites' in Figure 5—figure supplement 1 are more convincing than those in Figure 5.

Thanks for this suggestion. We agree that “The data on 'primary neurites' in Figure 5—figure supplement 1 are more convincing than those in Figure 5.” The WAVE2 and Abi2 data in Figure 5—figure supplement 1 are really good. However, the paper is too long. We would be happy to change Figure 5—figure supplement 1 to a main figure if your esteemed journal requires us to do so.

9) The method used for quantifying lamellipodia should be described. Which fluorescent structure was used? (GFP? F-Actin?). The GFP appears to be cytosolic and may not fully resolve the membrane structures.

We used both GFP (labeling transfection) and phalloidin (F-actin) for quantifying lamellipodial structure. We have added the following sentences to Materials and methods section to address these comments: “For quantification, we selected neurons with typical stage1 or stage2 morphology based on GFP and phalloidin signals. For stage1 neurons, we selected the lamellipodia region by the wand tool of the ImageJ software (NIH) and measured the area size. For stage2 neurons, the neurite tips with F-actin-enriched protrusions two folds larger than its width were defined as “neurite with lamellipodia”.

10) Samples sizes are not properly described. Ns are given, but it's not clear what they comprise. The authors should report the numbers of cells, sections analyzed, animals per litter, numbers of litter/replicates.

We have added the detailed information as described above.

11) Statistical tests are limited to t-tests. Bu in many instances, multiple groups are analyzed and thus ANOVA and post-hoc multiple comparisons would be more suitable.

We have now used ANOVA and post-hoc multiple comparisons to analyze multiple groups.

12) I think it is also premature to exclude effects on survival, since quantification of numbers of GFP labeled cells in each IUE manipulation are not given. Cleaved-caspase 3 might only be detected during a small window, and labeled cells are cleared rapidly.

We have quantified the numbers of GFP labeled cells in each IUE manipulation. As shown in Author response image 7, there is no statistical difference between scrambled (SCR) and α knockdowns (αKD-1 and αKD-2). Consistent with this quantification, cleaved-caspase 3 staining did not reveal increased apoptosis. Although cleaved-caspase 3 might only be detected during a small window, and labeled cells are cleared rapidly, this method has been used in many studies to detect apoptotic cells such as Nancy Ip’s recent work on cortical neuron migration (Ye et al., 2014).

Author response image 7
Quantification of the numbers of GFP labeled cells in each IUE manipulation.

One-way ANOVA, ns, not significant.

https://doi.org/10.7554/eLife.35242.042
https://doi.org/10.7554/eLife.35242.044

Article and author information

Author details

  1. Li Fan

    1. Key Laboratory of Systems Biomedicine (Ministry of Education), Center for Comparative Biomedicine, Institute of Systems Biomedicine, Shanghai Center for Systems Biomedicine, Shanghai Jiao Tong University, Shanghai, China
    2. State Key Laboratory of Oncogenes and Related Genes, Shanghai Cancer Institute, Renji Hospital affiliated to Shanghai Jiao Tong University Medical School, Shanghai, China
    3. School of Life Sciences and Biotechnology, Shanghai Jiao Tong University, Shanghai, China
    Present address
    Developmental Biology Program, Sloan Kettering Institute, New York, United States
    Contribution
    Data curation, Formal analysis, Investigation, Writing—original draft
    Contributed equally with
    Yichao Lu
    Competing interests
    No competing interests declared
  2. Yichao Lu

    1. Key Laboratory of Systems Biomedicine (Ministry of Education), Center for Comparative Biomedicine, Institute of Systems Biomedicine, Shanghai Center for Systems Biomedicine, Shanghai Jiao Tong University, Shanghai, China
    2. State Key Laboratory of Oncogenes and Related Genes, Shanghai Cancer Institute, Renji Hospital affiliated to Shanghai Jiao Tong University Medical School, Shanghai, China
    3. School of Life Sciences and Biotechnology, Shanghai Jiao Tong University, Shanghai, China
    Contribution
    Data curation, Formal analysis, Investigation, Writing—original draft, Writing—review and editing
    Contributed equally with
    Li Fan
    Competing interests
    No competing interests declared
  3. Xiulian Shen

    1. Key Laboratory of Systems Biomedicine (Ministry of Education), Center for Comparative Biomedicine, Institute of Systems Biomedicine, Shanghai Center for Systems Biomedicine, Shanghai Jiao Tong University, Shanghai, China
    2. State Key Laboratory of Oncogenes and Related Genes, Shanghai Cancer Institute, Renji Hospital affiliated to Shanghai Jiao Tong University Medical School, Shanghai, China
    3. School of Life Sciences and Biotechnology, Shanghai Jiao Tong University, Shanghai, China
    Contribution
    Data curation, Formal analysis, Investigation
    Competing interests
    No competing interests declared
  4. Hong Shao

    1. Key Laboratory of Systems Biomedicine (Ministry of Education), Center for Comparative Biomedicine, Institute of Systems Biomedicine, Shanghai Center for Systems Biomedicine, Shanghai Jiao Tong University, Shanghai, China
    2. State Key Laboratory of Oncogenes and Related Genes, Shanghai Cancer Institute, Renji Hospital affiliated to Shanghai Jiao Tong University Medical School, Shanghai, China
    3. School of Life Sciences and Biotechnology, Shanghai Jiao Tong University, Shanghai, China
    Contribution
    Data curation, Formal analysis, Investigation
    Competing interests
    No competing interests declared
  5. Lun Suo

    1. Key Laboratory of Systems Biomedicine (Ministry of Education), Center for Comparative Biomedicine, Institute of Systems Biomedicine, Shanghai Center for Systems Biomedicine, Shanghai Jiao Tong University, Shanghai, China
    2. Department of Assisted Reproduction, Shanghai Jiao Tong University Medical School, Shanghai, China
    Contribution
    Data curation, Formal analysis, Investigation
    Competing interests
    No competing interests declared
  6. Qiang Wu

    1. Key Laboratory of Systems Biomedicine (Ministry of Education), Center for Comparative Biomedicine, Institute of Systems Biomedicine, Shanghai Center for Systems Biomedicine, Shanghai Jiao Tong University, Shanghai, China
    2. State Key Laboratory of Oncogenes and Related Genes, Shanghai Cancer Institute, Renji Hospital affiliated to Shanghai Jiao Tong University Medical School, Shanghai, China
    3. School of Life Sciences and Biotechnology, Shanghai Jiao Tong University, Shanghai, China
    Contribution
    Conceptualization, Supervision, Funding acquisition, Project administration, Writing—review and editing
    For correspondence
    qiangwu@sjtu.edu.cn
    Competing interests
    No competing interests declared
    ORCID icon 0000-0003-3841-3591

Funding

National Natural Science Foundation of China (31630039)

  • Qiang Wu

National Natural Science Foundation of China (91640118)

  • Qiang Wu

National Natural Science Foundation of China (31470820)

  • Qiang Wu

Ministry of Science and Technology of the People's Republic of China (2017YFA0504203)

  • Qiang Wu

Science and Technology Commission of Shanghai Municipality (14JC1403601)

  • Qiang Wu

The funders had no role in study design, data collection, and interpretation, or the decision to submit the work for publication.

Acknowledgements

We thank J Ao and Y Guo for technical help, and S Zhao for suggestions on live imaging. We thank WV Chen, T Maniatis, G Mountoufaris, T Südhof, X Wang, and L Wang, as well as members of the Wu Lab for critical reading of the manuscript. F Polleux for providing pNeuroD-IRES-EGFP plasmid. This study is supported by grants from NSFC (31630039, 91640118, and 31470820), the Ministry of Science and Technology of China (2017YFA0504203), the Science and Technology Commission of Shanghai Municipality (14JC1403601). QW is a Shanghai Subject Chief Scientist.

Ethics

Animal experimentation: Animal experimentation: All procedures involving animals were in accordance with the Shanghai Municipal Guide for the care and use of Laboratory Animals, and approved by the Shanghai Jiao Tong University Animal Care and Use Committee (protocol #: 1602029).

Reviewing Editor

  1. Jeremy Nathans, Johns Hopkins University School of Medicine, United States

Publication history

  1. Received: January 19, 2018
  2. Accepted: June 11, 2018
  3. Accepted Manuscript published: June 18, 2018 (version 1)
  4. Accepted Manuscript updated: June 19, 2018 (version 2)
  5. Version of Record published: July 16, 2018 (version 3)

Copyright

© 2018, Fan et al.

This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.

Metrics

  • 1,000
    Page views
  • 254
    Downloads
  • 0
    Citations

Article citation count generated by polling the highest count across the following sources: Crossref, PubMed Central, Scopus.

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Download citations (links to download the citations from this article in formats compatible with various reference manager tools)

Open citations (links to open the citations from this article in various online reference manager services)

Further reading

    1. Neuroscience
    Paul Hoffman et al.
    Research Article Updated
    1. Neuroscience
    Romain Franconville et al.
    Research Article Updated