A dynamic interaction between CD19 and the tetraspanin CD81 controls B cell co-receptor trafficking
- Department of Biological Chemistry and Molecular Pharmacology, Blavatnik Institute, Harvard Medical School, United States
- Dana Farber Cancer Institute, Department of Cancer Biology, United States
Figures
Figure 1 with 2 supplements
CD81 chimera design and CD19 Export Assay.
(A) Design of CD81 Chimeras used in export assay experiments. (B) Export assay with CD81/CD9 chimeras. (C) Export assay with CD81/Tspan15 C. elegans chimeras. (D) Export assay with CD19/ σ1 receptor …
Figure 1—figure supplement 1
Surface staining of CD81 chimeras used in the CD19 Export Assay.
Expression was analyzed using an anti-CD81 antibody, so only chimeras with the large extracellular loop of CD81 are detectable. (A) CD81 surface staining of parental HEK293T cells compared to CRISPR …
Figure 1—figure supplement 2
Representative gating strategy for CD81 null 293 T cells used in the CD19 export assay and CD19-CD81 fusion protein validation experiments.
Cells were first gated on live cells and then on singlet cells.
Figure 2 with 1 supplement
Design and evaluation of a CD19-CD81 fusion protein.
(A) Cartoon representing the designed CD19-CD81 fusion protein. The model was created based on known structures of the CD19 ectodomain (PDB 6AL5) and CD81 (PDB 5TCX). A short Gly-Ser linker (dashed …
Figure 2—figure supplement 1
Validation of the CD19-CD81 fusion protein with a panel of CD19 antibodies.
A panel of CD19 antibodies recognizes the CD19-CD81 fusion to the same degree as it recognizes wild type CD19, providing further evidence that the fusion protein is properly folded. Error bars …
Figure 3 with 3 supplements
Structure of the 5A6 Fab-CD81 Large Extracellular Loop Complex (PDB 6U9S).
(A) Surface representation of the 5A6-CD81 complex. CD81 is blue, the 5A6 Fab light chain is yellow, and the heavy chain is magenta. Residues at the binding interface are colored in a darker shade. …
Figure 3—figure supplement 1
Representative Density in the CDRs of 5A6 Fab.
(A–B) Composite omit 2Fo-Fc electron density map contoured at 1.0 σ for CD81 Helix C (A) and CD81 Helix D (B).
Figure 3—figure supplement 2
Epitope comparison of Ab5, Ab10, Ab21, and 5A6.
(A) Surface representation of CD81 large extracellular loop colored purple for residues within 4 Å of Ab21 (PDB 5DFW). (B) Surface representation of CD81 large extracellular loop colored red for …
Figure 3—figure supplement 3
CD81 surface staining of polyalanine mutants detected with Ab21.
Error bars represent mean ± SEM of three independent experiments.
Figure 4 with 2 supplements
CD81 antibody labeling experiments in resting and activated primary human B cells.
(A) Surface staining of the B cell activation markers, CD86 and CD69, in resting B cells and cells activated with IgM, IgG Fab’2. (B) Surface staining of CD19 and CD81 with antibody 5A6 and Ab21. (C)…
Figure 4—figure supplement 1
Replicate western blots.
(A) Replicate western blots of total protein lysate from Figure 4D. ‘R’ represents resting cells and ‘A’ represents activated cells. (B) Replicate immunoprecipitations of CD19 from resting and …
Figure 4—figure supplement 2
Representative gating strategy for primary human B cells.
Cells were first gated on live cells, then on singlet cells, and then on CD20+ cells.
Figure 5
Proposed model for the disengagement of the CD81 during B cell activation.
Upon B cell activation, dissociation of the B cell co-receptor complex could allow CD19 to freely diffuse in the membrane and interact with the BCR, leading to amplified signaling through the BCR …
Tables
Table 1
X-ray crystallography data collection and refinement statistics.
Refined coordinates and structure factors are deposited in the Protein Data Bank under accession code 6U9S.
| Data collection | 5A6-CD81 LEL |
|---|---|
| Wavelength (Å) | 0.9792 |
| Space Group | P 21 21 21 |
| Number of crystals | 1 |
| Unit cell dimensions | |
| a,b,c | 40.003, 96.858, 297.091 |
| α, β, γ (°) | 90, 90, 90 |
| Resolution (Å) (last shell) | 49.5–2.4 (2.54–2.4) |
| No. of reflections (total/unique) | 293920/46497 |
| Completeness (%) (last shell) | 99.1 (96.8) |
| I/σ(I) (last shell) | 7.94 (0.46) |
| Rmeas (%) (last shell) | 20.5% (355.7%) |
| CC1/2 (%) (last shell) | 99.5 (16.6) |
| Multiplicity | 6.3 |
| Refinement | |
| Number of atoms (protein/solvent) | 7974/358 |
| Rwork/Rfree (%) | 21.44/28.08 |
| R.M.S. deviation (Å) | |
| Bond length | 0.003 |
| Bond angles | 0.537 |
| Ramachandran statistics | |
| Favored | 96.94 |
| Allowed | 3.06 |
| Outliers | 0.00 |
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Antibody | Rabbit Polyclonal CD19 antibody | Cell Signaling | Cat#3574S; RRID:AB_2275523 | 1:500 (western blot) |
| Antibody | CD19 Mouse Monoclonal Antibody (SJ25-C1), Alexa Fluor 488 | Thermo-Fisher | Cat#MHCD1920; RRID:AB_389313 | 2 µg/mL (flow cytometry) |
| Antibody | GAPDH (D16H11) Rabbit Monoclonal Antibody (HRP Conjugate) | Cell Signaling | Cat#8884S; RRID:AB_11129865 | 1:10,000 (western blot) |
| Antibody | APC Mouse Monoclonal anti-human CD81 | BioLegend | Cat#349510; RRID:AB_2564020 | 2 µg/mL (flow cytometry) |
| Antibody | Human Monoclonal CD81 Clone Ab5 | Recombinant; Nelson et al., 2018 | 2 µg/mL (flow cytometry) | |
| Antibody | Human Monoclonal CD81 Clone Ab10 | Recombinant; Nelson et al., 2018 | 2 µg/mL (flow cytometry) | |
| Antibody | Human Monoclonal CD81 Clone Ab21 | Recombinant; Nelson et al., 2018 | 2 µg/mL (flow cytometry) 1:1000 (western blot) | |
| Antibody | Human Monoclonal CD81 Clone 5A6 | Recombinant; WO 2017/218691 A1 | 2 µg/mL (flow cytometry) 1:100 (western blot) | |
| Antibody | Human Monoclonal CD19 (Coltuximab) | Recombinant; Therapeutic Antibody Database | 2 µg/mL (flow cytometry) | |
| Antibody | Human Monoclonal CD19 (Denintuzumab) | Recombinant; Therapeutic Antibody Database | 2 µg/mL (flow cytometry) | |
| Antibody | Human Monoclonal CD19 (Inebiliziumab) | Recombinant; Therapeutic Antibody Database | 2 µg/mL (flow cytometry) | |
| Antibody | APC Mouse Monoclonal CD86 antibody | BioLegend | Cat#374208; RRID:AB_2721449 | 2 µg/mL (flow cytometry) |
| Antibody | APC Mouse Monoclonal CD20 Clone L27 | BD Biosciences | Cat#340941; RRID:AB_1645724 | 1 µg/mL (flow cytometry) |
| Antibody | Donkey anti-Rabbit IgG (H+L) HRP Conjugate | Sigma Aldrich | Cat#GENA934-1ML; RRID:AB_2722659 | 1:5000 (western blot) |
| Antibody | Rabbit Anti-Human IgG H and L HRP Conjugate | Abcam | Cat#ab6759; RRID_:AB_955434 | 1:5000 (western blot) |
| Antibody | F(ab')2-Goat anti-Human IgG, IgM (H+L), Functional Grade | Thermo-Fisher | Cat#16-5099-85 | 20 µg/mL (B cell activation) |
| Biological sample (human) | Leuko-reduction Collar | Brigham and Women’s Hospital Crimson Core | ||
| Commercial assay or kit | QuickExtract DNA Extraction Solution | VWR | Cat#76081–766 | |
| Chemical compound | Valproic Acid Sodium Salt | Sigma Aldrich | Cat#P4543-25G | |
| Chemical compound, drug | D-(+)-Glucose solution | Sigma Aldrich | Cat#G8769-100ML | |
| Chemical compound, drug | Magnesium Formate DiHydrate | Hampton Research | Cat#HR2-537 | |
| Chemical compound, drug | StockOptions Sodium Acetate | Hampton Research | Cat#HR2-933-01 | |
| Chemical compound, drug | Polyethylene Glycol Monomethyl Ether 550 | Hampton Research | Cat#HR2-611 | |
| Other | MicroTools | Hampton Research | Cat#HR4-837 | |
| Commercial assay or kit | RosetteSep Human B Cell Enrichment Cocktail | STEMCELL Technologies | Cat#15024 | |
| Commercial assay or kit | Lymphoprep density gradient medium | STEMCELL Technologies | Cat#07851 | |
| Chemical compound, drug | Nutridoma-SP | Sigma Aldrich | Cat#11011375001 | |
| Chemical compound, drug | n-Dodecyl-B-D-maltoside (DDM) | Anatrace | Cat#D310 | |
| Chemical compound, drug | Cholesteryl Hemisuccinate | Sigma Aldrich | Cat#C6512 | |
| Chemical compound, drug | Iodoacetamide | Sigma Aldrich | Cat# I1149-5G | |
| Peptide, recombinant protein | Benzonase nuclease | Sigma Aldrich | Cat# E1014-25KU | |
| Commercial assay or kit | In-Fusion HD Cloning Plus | Clontech | Cat# 638911 | |
| Cell line (human) | Expi293F Cells | Thermo-Fisher | Cat#A14527 | |
| Cell line (human) | CD81 null HEK293T cells | This paper | HEK293T cells with CD81 knocked out using CRISPR/Cas9 | |
| Sequence-based reagent | gRNA forward primer for CD81 knockout cell line generation | Integrated DNA Technologies | CACCGATGCGCTGCGTCTGCGGCG | |
| Sequence-based reagent | gRNA reverse primer for CD81 knockout cell line generation | Integrated DNA Technologies | AAACCGCCGCAGACGCAGCGCATC | |
| Recombinant DNA reagent | pcDNA3.1 (+) Mammalian Expression Vector | Thermo-Fisher | Cat#V79020 | |
| Recombinant DNA reagent | pFUSE-hIgG1-Fc2 | InvivoGen | Cat#pfuse-hg1fc2 | |
| Recombinant DNA reagent | pD2610-v5 CMV(v5)-ORF Mamm-ElecD | ATUM | N/A | |
| Recombinant DNA reagent | gBlocks | Integrated DNA Technologies | N/A | |
| Recombinant DNA reagent | pSpCas9(BB)−2A-GFP (PX458) | Addgene | Cat#48138 | |
| Software, algorithm | GraphPad Prism 8.0 | N/A | http://www.graphpad.com/scientific-software/prism/ | |
| Software, algorithm | BD Accuri C6 Plus software | BD Accuri C6 Plus | http://www.bdbiosciences.com/en-us/instruments/research-instruments/research-cell-analyzers/accuri-c6-plus | |
| Software, algorithm | SB Grid Consortium | Morin et al., 2013 | https://sbgrid.org/software/ | |
| Software, algorithm | XDS | Kabsch, 2010 | https://sbgrid.org/software/ | |
| Software, algorithm | Phenix | Afonine et al., 2012 | https://sbgrid.org/software/ | |
| Software, algorithm | Coot | Emsley and Cowtan, 2004 | https://sbgrid.org/software/ | |
| Software, algorithm | PyMOL | DeLano, 2010 | https://sbgrid.org/software/ |
