MARCH8 inhibits viral infection by two different mechanisms
- Department of Pathology, National Institute of Infectious Diseases, Japan
- Faculty of Life and Environmental Sciences, University of Yamanashi, Japan
- Faculty of Pharmaceutical Sciences, Nagasaki International University, Japan
Figures
Figure 1
MARCH8 targets and ubiquitinates cytoplasmic lysine residues of VSV-G but not of HIV-1 Env.
(A) Schematic structure of the lysine mutants of VSV-G (CT5K/R; upper) and HIV-1 Env (CT2K/R; lower). SP, signal peptide; EC, extracellular domain; TM, transmembrane domain; CT, cytoplasmic tail; SU, surface subunit. (B) Infectivity of viruses prepared from 293T cells cotransfected with Env-defective HIV-1 luciferase (luc) reporter proviral DNA and either the VSV-G wild-type (WT) or CT5K/R mutant plasmid together with either a control (Ctrl) (black) or HA-MARCH8 (gray) plasmid. Data are shown as a percentage of the viral infectivity in the absence of MARCH8 when WT VSV-G was used (mean + s.d. from three independent experiments). (C) Infectivity of viruses prepared as shown in B, except for using either the WT HIV-1 Env or its CT2K/R mutant plasmid (mean + s.d. from three independent experiments). (D) The VSV-G lysine mutant is resistant to MARCH8-mediated intracellular degradation. Shown are immunofluorescence-based analyses of the intracellular expression of either the WT or CT5K/R mutant VSV-G with or without MARCH8 in transfected HOS cells. Scale bars, 10 μm. Note that the cell-staining for VSV-G cannot be performed because VSV-G is tagged with the T7 epitope (T7e) at the C-terminus. (E) The lysine mutant of HIV-1 Env is still sensitive to MARCH8-induced downregulation from the cell surface. Immunofluorescence images show cell-surface expression of either the WT or CT2K/R mutant HIV-1 Env with or without MARCH8 in transfected HOS cells. Scale bars, 10 μm. (F) MARCH8 sequesters HIV-1 Env in the trans-Golgi network (TGN). Immunofluorescence images show intracellular localization of either the WT or CT2K/R mutant HIV-1 Env and the TGN marker TGN46, with or without MARCH8 in transfected HOS cells. Scale bars, 10 μm. (G) Lysine residues at the CT domain of VSV-G are ubiquitinated by MARCH8. The ubiquitination of the WT or CT5K/R mutant VSV-G tagged with T7e in cells expressing control or MARCH8 (WT or RING-CH mutant (CS)) was examined by immunoprecipitation (IP) of either ubiquitinated proteins with an anti-ubiquitin antibody (left panel) or of T7e-tagged VSV-G with an anti-T7e antibody (right panel), followed by immunoblotting with an antibody to either T7e (left panel) or ubiquitin (right panel), respectively.
Figure 2
The tyrosine motif of MARCH8 mediates downregulation of HIV-1 Env but not of VSV-G.
(A) Schematic structure of YxxΦ motif mutants of MARCH8 (222YxxL225 and 232YxxV235). (B) Western blot analysis was performed by using extracts from 293T cells transfected with HA-tagged MARCH8 expression plasmids. Antibodies specific for HA were used to detect MARCH8 proteins. (C, D) Infectivity of viruses prepared from 293T cells cotransfected with Env-defective HIV-1 luciferase (luc) reporter proviral DNA and either a control (Ctrl), HA- WT, HA-222AxxL225 or HA-232AxxV235 MARCH8 plasmid, together with either (C) the VSV-G expression plasmid or (D) the HIV-1 Env expression plasmid. Data are shown as a percentage of the viral infectivity in the absence of MARCH8 (mean + s.d. from three independent experiments). ns; ***p<0.0005 compared with the Ctrl using two-tailed unpaired t-tests. (E, F) BlaM-Vpr-based viral entry assay using VSV-G-pseudotyped viruses (E) or NL4-3 whole viruses (F) produced from cells expressing either control, WT MARCH8, or the 222AxxL225 mutant. Representative FACS dot plots are shown from four independent experiments. (G) VSV-G is downregulated by both WT and 222AxxL225 mutant MARCH8, (H) whereas the cell-surface expression of HIV-1 Env is not affected by the mutant MARCH8. (I) 222AxxL225 MARCH8 expression in producer cells is unable to decrease HIV-1 gp120 levels in viral supernatants. ELISA-based levels of Env gp120 in viral supernatants from 293T cells cotransfected with luc reporter proviral DNA and NL-Env plasmid, together with either MARCH8 WT or its 222AxxL225 mutant. Representative data from three independent experiments are shown as percent Env gp120/Gag p24 in the supernatants relative to that from control cells. (mean + s.d. from three independent experiments). ns; ***p<0.0005 compared with the Ctrl using two-tailed unpaired t-tests.
Figure 3
Schematic diagram of two different molecular mechanisms by which MARCH8 inhibits viral infection.
Left, MARCH8 (red) downregulates VSV-G (violet) in a ubiquitin-dependent manner. The RING-CH domain (pink) of MARCH8 recognizes VSV-G’s cytoplasmic lysine residues, which results in ubiquitin conjugation (shown as orange beads), leading to lysosomal degradation; Right, MARCH8 downregulates HIV-1 Env (green) in a YxxΦ motif-dependent manner. The tyrosine motif located in the C-terminal CT of MARCH8 likely interacts with the adaptor protein μ-subunits (navy) (if this is the case with μ2 or μ1, clathrin (brown) is involved in this step), resulting in the intracellular retention of HIV-1 Env in the TGN without degradation. It should be noted that the downregulation of these viral glycoproteins might not necessarily occur at the plasma membrane. The nucleus and other organelles are not shown.
Tables
Appendix 1—key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Gene(Homo sapiens) | MARCH8 | NCBI | BC025394 | |
| Recombinant DNA reagent | pNL4-3 | Adachi et al., 1986 | ||
| Recombinant DNA reagent | pNL-E(-) | Iwabu et al., 2009 | ||
| Recombinant DNA reagent | pNL-Luc2-E(-) | Tada et al., 2015 | ||
| Recombinant DNA reagent | pC-GagPol-RRE | Tada et al., 2015 | ||
| Recombinant DNA reagent | pC-NLenv | Tada et al., 2015 | ||
| Recombinant DNA reagent | pCa-Rev | Iwabu et al., 2009 | ||
| Recombinant DNA reagent | pC-VSVg | Tada et al., 2015 | ||
| Recombinant DNA reagent | pVSVg-T7E | Tada et al., 2015 | ||
| Recombinant DNA reagent | pCa-EGFP | Iwabu et al., 2009 | ||
| Recombinant DNA reagent | pMM310 | Tobiume et al., 2003 | ||
| Recombinant DNA reagent | pC-MARCH8 | Tada et al., 2015 | ||
| Recombinant DNA reagent | pC-HA-MARCH8 | Tada et al., 2015 | ||
| Recombinant DNA reagent | pC-HA-MARCH8-CS | Tada et al., 2015 | ||
| Recombinant DNA reagent | pC-NLenv-CT2K/R | This paper | See Materials and methods | |
| Recombinant DNA reagent | pC-VSVg-CT5K/R | This paper | See Materials and methods | |
| Recombinant DNA reagent | pC-VSVg-CT5K/R-T7E | This paper | See Materials and methods | |
| Recombinant DNA reagent | pC-MARCH8-222AxxL225 | This paper | See Materials and methods | |
| Recombinant DNA reagent | pC-HA-MARCH8-222AxxL225 | This paper | See Materials and methods | |
| Recombinant DNA reagent | pC-MARCH8-232AxxV235 | This paper | See Materials and methods | |
| Recombinant DNA reagent | pC-HA-MARCH8-232AxxV235 | This paper | See Materials and methods | |
| Sequence-basedreagent | NL-env-MfeI-S | This paper | gacaattggagaagtgaatt | Sense primer for pC-NLenv-CT2K/R |
| Sequence-basedreagent | NLenv-CT2KR-A | This paper | ctattcCttagttcctgactccaatactgtaggagattccaccaatatCtgagggc | Overlapping PCR's antisense primer for pC-NLenv-CT2K/R |
| Sequence-basedreagent | NLenv-CT2/KR-S | This paper | gccctcaGatattggtggaatctcctacagtattggagtcaggaactaaGgaatag | Overlapping PCR's sense primer for pC-NLenv-CT2K/R |
| Sequence-basedreagent | NL-env-XhoI-A | This paper | ccgCTCGAGttatagcaaaatcctttccaag | Antisense primer for pC-NLenv-CT2K/R |
| Sequence-basedreagent | VSVg-BsiWI-S | This paper | atCGTACGatgaagtgccttttgtactt | Sense primer for pC-VSVg-CT5K/R-T7E |
| Sequence-basedreagent | VSVg-CT5K/R-XhoI-A | This paper | ATctcgaGcCttccaagtcggttcatctctatgtctgtataaatctgtcttCtcCtggtgtgcCttaatCtaatg | Antisense primer for pC-VSVg-CT5K/R-T7E |
| Sequence-basedreagent | MARCH8-KpnI-S | This paper | ggGGTACCatgagcatgccactgcatcag | Sense primer for pC-MARCH8-222AxxL225 and pC-MARCH8-232AxxV235 |
| Sequence-basedreagent | MARCH8-XhoI-S | This paper | ccgCTCGAGagcatgccactgcatcagat | Sense primer for pC-HA-MARCH8-222AxxL225 and pC-HA-MARCH8-232AxxV235 |
| Sequence-basedreagent | MARCH8-222AxxL225-S | This paper | gtgtaaagtgGCtgtgcaGttgtggaagag | Overlapping PCR's sense primer for pC-MARCH8-222AxxL225 and pC-HA-MARCH8-222AxxL225 |
| Sequence-basedreagent | MARCH8-222AxxL225-A | This paper | ctcttccacaaCtgcacaGCcactttacac | Overlapping PCR's antisense primer for pC-MARCH8-222AxxL225 and pC-HA-MARCH8-222AxxL225 |
| Sequence-basedreagent | MARCH8-232AxxV235-S | This paper | gagactcaaggccGCtaatagagtgatc | Overlapping PCR's sense primer for pC-MARCH8-232AxxV235 |
| Sequence-basedreagent | MARCH8-232AxxV235-A | This paper | gatcactctattaGCggccttgagtctc | Overlapping PCR's antiense primer for pC-MARCH8-232AxxV235 |
| Sequence-basedreagent | MARCH8-XhoI-A | This paper | ccgCTCGAGtcagacgtgaatgatttctg | Antisense primer for pC-MARCH8-222AxxL225 and pC-MARCH8-232AxxV235 |
| Sequence-basedreagent | MARCH8-NotI-A | This paper | attGCGGCCGCtcagacgtgaatgatttctg | Antisense primer for pC-HA-MARCH8-222AxxL225 and pC-HA-MARCH8-232AxxV235 |
| Cell line (H. sapiens) | 293T | ATCC | CRL-3216 | |
| Cell line (H. sapiens) | MT4 | JCRB | 1216 RRID:CVCL_2632 | |
| Cell line (H. sapiens) | HeLa | ATCC | CVCL_0030 | |
| Cell line (H. sapiens) | MAGIC5 | Mochizuki et al., 1999 | ||
| Cell line (H. sapiens) | HOS | ATCC | CRL-1543 | |
| Commercial assayor kit | PCR Mycoplasma Detection Set | Takara | TKR-6601 | Mycoplasma detection |
| Chemicalcompound,drug | FuGENE6 | Promega | E2691 | Transfection reagent |
| Commercial assayor kit | HIV-1 p24 ELISA Kit | XpressBio | XBR-1000 | HIV-1 p24 antigen capture ELISA |
| Commercial assayor kit | HIV-1 gp120 ELISA Kit | Advanced BioScience Laboratories | 5429 | HIV-1 gp120 ELISA |
| Commercial assayor kit | One-Glo Luciferase Assay Reagent | Promega | E6110 | Luciferase assay |
| Chemicalcompound,drug | Protein A-Sepharose | GE Healthcare | 17-0780-01 | Immunoprecipitation |
| Chemicalcompound,drug | Complete protease inhibitor cocktail | Roche | 11697498001 | Protease inhibitor |
| Chemicalcompound,drug | n-octyl-β-D-glucoside | Dojindo | O001 | Nonionic surfactant |
| Chemicalcompound,drug | Saponin | Sigma-Aldrich | 47036 | Nonionic surfactant |
| Antibody | Anti-HA | Sigma-Aldrich | H9658 RRID:AB_260092 | WB (1:10,000 )Mouse monoclonal |
| Antibody | Anti-HA | Sigma-Aldrich | H3663 RRID:AB_262051 | IF (1:200)Mouse monoclonal |
| Antibody | Anti-HA | Sigma-Aldrich | H6908 RRID:AB_260070 | IF (1:200)Rabbit polyclonal |
| Antibody | anti-HA | GenScript | A00168-40 | IF (1:200)Goat polyclonal |
| Antibody | Anti-β-actin | Sigma-Aldrich | A5316 RRID:AB_476743 | WB (1:5,000) Mouse monoclonal |
| Antibody | Anti-T7 epitope tag | MBL | PM022 RRID:AB_592788 | IP (4 μg); WB (1:1,000)Rabbit polyclonal |
| Antibody | Anti-T7 epitope tag | Novagen | 69522-4 RRID:AB_11211744 | IF (1:200)Mouse monoclonal |
| Antibody | Anti-ubiquitin | Cayman | 14220 | IP (4 μg); WB (1:500)Mouse monoclonal (Clone FK2) |
| Antibody | Anti-gp120 | Abcam | Ab21179 RRID:AB_732949 | FACS (1:150); IF (1:200)Goat polyclonal |
| Antibody | Anti-gp120 | Matsushita et al., 1988 | IF (1:100)Mouse monoclonal (0.5β)kindly provided by S. Matsushita | |
| Antibody | Anti-TGN46 | Abcam | Ab50595 RRID:AB_2203289 | IF (1:200)Rabbit polyclonal |
| Antibody | Anti-VSV-G | Sigma-Aldrich | V5507 RRID:AB_261877 | FACS (1:150)Mouse monoclonal |
| Antibody | Goat anti-mouse IgG conjugated with R-phycoerythrin | Molecular Probes | P-852 RRID:AB_143191 | FACS (1:500) |
| Antibody | Alexa 488 donkey anti-mouse IgG | Molecular Probes | A-21202 RRID:AB_141607 | IF (1:400) |
| Antibody | Alexa 488 donkey anti-goat IgG | Molecular Probes | A-11055 RRID:AB_2534102 | IF (1:400) |
| Antibody | Alexa 568 donkey anti-rabbit IgG | Molecular Probes | A-10042 RRID:AB_2534017 | IF (1:400) |
| Antibody | Alexa 647 donkey anti-goat IgG | Molecular Probes | A-21447 RRID:AB_141844 | FACS (1:500); IF (1:400) |
| Antibody | Alexa 647 donkey anti-mouse IgG | Molecular Probes | A-31571 RRID:AB_162542 | IF (1:400) |
| Antibody | Alexa 647 donkey anti-rabbit IgG | Molecular Probes | A-31573 RRID:AB_2536183 | IF (1:400) |
| Commercial assayor kit | ECL Western blotting detectionsystem | GE Healthcare | RPN2109 | Chemiluminescence |
| Commercial assayor kit | EzWestLumi plus | ATTO | WSE-7120 | Chemiluminescence |
| Chemicalcompound,drug | HBSS | Thermo Fisher | 14025076 | Wash buffer |
| Chemicalcompound,drug | CCF2-AM dye | Invitrogen | K1023 | Fluorescent substrate for BlaM |
| Chemicalcompound,drug | Pluronic F-127 | Invitrogen | P2443 | Nonionic surfactant for CCF2-AM dye |
| Chemicalcompound,drug | Saponin | Sigma-Aldrich | 47036 | Non-ionic surfactant for immunofluorescence |
| Software,algorithm | BD FACS Diva Software | BD Bioscience | ||
| Software,algorithm | GraphPadPrism 8.04 | GraphPad |
Additional files
-
Source data 1
Source Data File for Figures 1B, C, 2C, D and I.
- https://cdn.elifesciences.org/articles/57763/elife-57763-data1-v2.xlsx
-
Source data 2
Source data for Figure 1G and 2B.
Original uncropped images of IP-western blot (ubiquitination assays) in Figure 1G. The PVDF membranes were incubated with an anti-T7-epitope tag antibody, or with an anti-ubiquitin antibody. Images shown in Figure 1G were cropped from the boxed areas, and the brightness/contrast was adjusted equally across the entire image using Photoshop CS6 Figure 2B source data. Original uncropped images of western blot in Figure 2B. The PVDF membrane was incubated with an anti-HA antibody, then stripped and reprobed with an anti-β-actin antibody for a loading control. Images shown in Figure 2B were cropped from the boxed areas, and the brightness/contrast was adjusted equally across the entire image using Photoshop CS6.
- https://cdn.elifesciences.org/articles/57763/elife-57763-data2-v2.pdf
-
Transparent reporting form
- https://cdn.elifesciences.org/articles/57763/elife-57763-transrepform-v2.docx
Download links
A two-part list of links to download the article, or parts of the article, in various formats.
Downloads (link to download the article as PDF)
Open citations (links to open the citations from this article in various online reference manager services)
Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)
MARCH8 inhibits viral infection by two different mechanisms
eLife 9:e57763.
https://doi.org/10.7554/eLife.57763
