Figures and data in Fruitless mutant male mosquitoes gain attraction to human odor

Figures
Tables
Additional files

5 figures, 1 table and 3 additional files

Figures

Figure 1

Download asset Open asset

Sex-specific mosquito attraction to humans and *fruitless* splicing.

(**A, B**) Arm-next-to-cage assay schematic A and image B with female (top) and male (bottom) *Aedes aegypti* mosquitoes. (C) Percent mosquitoes next to arm measured every 30 s. Data are mean ± s.e.m., n = 6 trials, n = 20 mosquitoes/trial; *p<0.05, Mann-Whitney test for each time point. (**D, E**) Schematic of *Aedes aegypti fruitless* genomic locus D and sex-specific splicing region with RNA-seq read evidence E. (F) Phylogeny of mosquito species with outgroup *Drosophila melanogaster*, with conserved *fruitless* exon structure inferred from de novo transcriptome assembly. In E, F, coding and non-coding exons are represented by filled and open dashed bars, respectively. *Toxorhynchites rutilus* and *Culex salinarius* images were used to represent *Toxorhynchites amboinensis* or *Culex quinquefasciatus*, respectively. See acknowledgments for photo credits. Cartoons indicate blood-feeding (blood drop) and non-blood-feeding (flower) species. (**G, H**) *Aedes aegypti fruitless* exon usage based on male and female RNA-seq data (normalized counts) from the indicated tissue plotted for each exon G and m, f, and c1 exons H n = 3–4 independent RNA-seq replicates (Matthews et al., 2016). (I) Schematic of generation of *fruitless^∆M* and *fruitless^{∆M-tdTomato}* mutants.

Figure 1—source data 1 Source data for Figure 1.: https://cdn.elifesciences.org/articles/63982/elife-63982-fig1-data1-v2.xlsx
Download elife-63982-fig1-data1-v2.xlsx

Figure 2 with 1 supplement

Download asset Open asset

Expression of *fruitless* in the mosquito brain.

(**A–F**) Confocal images of brains of the indicated genotypes showing *fruitless >tdTomato* (green) and Brp (magenta) expression. Scale bars, 20 µm. (**D–F**) Top-to bottom images are optical sections of the same brain, arranged from anterior to posterior.

Figure 2—figure supplement 1

Download asset Open asset

Expression of *fruitless* in the female mosquito ventral nerve cord.

(**A–B**) Confocal images of ventral nerve cords of the indicated genotypes showing *fruitless >tdTomato* (green) and Brp (magenta) expression. All scale bars, 20 µm.

Figure 3

Download asset Open asset

Expression of *fruitless* in the mosquito olfactory system.

(A) Schematic of antennal olfactory sensory neurons and their projections to the antennal lobe of the mosquito brain. (**B–D**) Confocal images of antennae of the indicated genotypes with *fruitless >tdTomato* (green) and Orco (magenta) expression. (E) Confocal image of *orco* mutant antenna, as negative control for Orco and tdTomato antibodies, with DAPI (blue). (F) Number of antennal lobe glomeruli labeled by *fruitless >tdTomato* in the indicated genotypes. (**G–I**) Confocal images of antennal lobes of the indicated genotypes with *fruitless >tdTomato* (green) and Brp (magenta) expression. (**J–L**) Confocal images of antennal lobes of the indicated genotypes showing *fruitless >tdTomato* (green) and Brp (magenta) expression. Top-to bottom images are optical sections of the same lobes, arranged from anterior to posterior. All scale bars, 20 µm.

Figure 3—source data 1 Source data for Figure 3.: https://cdn.elifesciences.org/articles/63982/elife-63982-fig3-data1-v2.xlsx
Download elife-63982-fig3-data1-v2.xlsx

Figure 4

Download asset Open asset

Male *fruitless* mutant mosquitoes gain attraction to a live human host.

(A) Feeding assay schematic. (B) Feeding on indicated meal (n = 8 trials/meal; n = 20 mosquitoes/trial). (C) Insemination assay schematic. (D) Insemination of wild-type females by males of the indicated genotype (n = 6 trials/male genotype, n = 20 females/trial; *p=0.0022, Mann-Whitney test). (E) Schematic of Quattroport assay, highlighting ability to run multiple stimuli and genotypes simultaneously. (F) Side-view schematic of Quattroport, highlighting close-range (attraction) and long-range (activation) metrics (G) Percent activated animals, n = 8–14 trials/group, n = 17–28 mosquitoes/trial. (**H, J**) Quattroport assay schematic for nectar-seeking H and live human host seeking J. 1% CO₂ is added to the airstream in the live human host seeking assay J. (**I, K**) Percent of attracted animals (n = 8–14 trials per group, n = 17–28 mosquitoes/trial). Data in B, D, G, I, K are mean ± s.e.m. In B, I, G, K, data labeled with different letters are significantly different from each other (Kruskal-Wallis test with Dunn’s multiple comparisons, p<0.05). In B, comparisons are made between genotypes for each meal. In **I, K**, comparisons are made between all genotypes and stimuli.

Figure 4—source data 1 Source data for Figure 4.: https://cdn.elifesciences.org/articles/63982/elife-63982-fig4-data1-v2.xlsx
Download elife-63982-fig4-data1-v2.xlsx

Figure 5 with 2 supplements

Download asset Open asset

Olfactory cues selectively drive male *fruitless* mutant attraction to humans.

(A) Heat-seeking assay schematic. A 20 s pulse of 10% CO₂ is added to the assay. (B) Percent of animals on Peltier. Data are mean ± s.e.m., n = 6 trials/temperature, n = 50 mosquitoes/trial. Data labeled with different letters are significantly different from each other, within each temperature. (C) Schematic of human odor host-seeking assay (left) and stimuli (right). (D) Percent of attracted animals. Data are mean ± s.e.m., n = 8–14 trials/group, n = 17–28 mosquitoes/trial. (**E–F**) Summary of results and model of gain of *fruitless* function in *Aedes aegypti*. Photo credit: *Aedes aegypti* (Alex Wild); *D. melanogaster* (Nicolas Gompel). In B, D, data labeled with different letters are significantly different from each other (Kruskal-Wallis test with Dunn’s multiple comparisons, p<0.05). In B, comparisons are made between genotypes at each temperature. In D, comparisons are made across all genotypes and stimuli.

Figure 5—source data 1 Source data for Figure 5.: https://cdn.elifesciences.org/articles/63982/elife-63982-fig5-data1-v2.xlsx
Download elife-63982-fig5-data1-v2.xlsx

Figure 5—figure supplement 1

Download asset Open asset

No significant blood-feeding or mating defects in *fruitless^∆M* females.

(A) Percent of females crossed to indicated male genotype blood-feeding on a live human arm. (B) Percent of females crossed to indicated male genotype laying eggs. Data in A, B, are mean ± s.e.m., n = 3–10 trials/group, n = 12–27 mosquitoes/trial. Data labeled with different letters are significantly different from each other (Kruskal-Wallis test with Dunn’s multiple comparisons, p<0.05). Comparisons were made across all genotypes. (C) Number of inseminated females by males of indicated genotype. n = 10 females.

Figure 5—figure supplement 1—source data 1 Source data for Figure 5—figure supplement 1.: https://cdn.elifesciences.org/articles/63982/elife-63982-fig5-figsupp1-data1-v2.xlsx
Download elife-63982-fig5-figsupp1-data1-v2.xlsx

Figure 5—figure supplement 2

Download asset Open asset

Female *fruitless^∆F* mutant mosquitoes have blood-feeding and egg-laying defects.

(A) Schematic of *Aedes aegypti fruitless* genomic locus. (B) Sex-specific *fruitless* transcripts and generation of *fruitless^∆F* mutant, with effect of splicing on Fruitless protein. (C) Crossing scheme to generate female mutants and potential male recombinants. (D) Blood-feeding assay schematic. (E) Feeding on live human arm; p<0.0001, Chi-square test. (F) Insemination assay schematic. (G) Insemination of females of indicated genotype by wild-type males; p=0.5464, Fisher’s exact test. (H) Egg-laying assay schematic. (I) Egg-laying by females of indicated genotype; p<0.0001, Fisher’s exact test.

Figure 5—figure supplement 2—source data 1 Source data for Figure 5—figure supplement 2.: https://cdn.elifesciences.org/articles/63982/elife-63982-fig5-figsupp2-data1-v2.xlsx
Download elife-63982-fig5-figsupp2-data1-v2.xlsx

Tables

Key resources table

Reagent type (species) or resource	Designation	Source or reference	Identifiers	Additional information
Gene (Aedes aegypti)	fruitless	RefSeq	LOC5567734
Gene (Anopheles gambiae)	fruitless	VectorBase	AGAP000080
Gene (Culex quinquefasciatus)	fruitless	RefSeq	CPIJ010853
Gene (Wyeomyia smithii)	fruitless	This paper		Figure 1—source data 1
Gene (Toxorhynchites amboinensis)	fruitless	This paper		Figure 1—source data 1
Strain, strain background (Aedes aegypti, both sexes)	LVP-IB12	BEI resources	MRA-735
Strain, strain background (Anopheles gambiae, both sexes)	G3	Flaminia Catteruccia (Harvard University)
Strain, strain background (Culex quinquefasciatus, both sexes)	JHB	BEI resources	NR-43025
Strain, strain background (Wyeomyia smithii, both sexes)	PB	William Bradshaw and Christina Holzapfel (University of Oregon)
Strain, strain background (Toxorhynchites amboinensis, both sexes)		Laurence Zwiebel (Vanderbilt University)
Genetic reagent (Aedes aegypti, both sexes)	fruitless^∆M	This paper		fruitless mutant strain; eggs available on request
Genetic reagent (Aedes aegypti, both sexes)	fruitless^{∆M-tdTomato}	This paper		fruitless mutant strain; eggs available on request
Antibody	Mouse monoclonal anti-Apocrypta bakeri Orco antibody	Vanessa Ruta (The Rockefeller University) (PMID:30111839)	15B2	IF(1:50)
Antibody	Rabbit polyclonal anti-RFP antibody	Rockland	Cat# 600-401-379, RRID:AB_2209751	IF(1:200)
Antibody	Mouse monoclonal anti-Brp antibody	DSHB	Cat# nc82, RRID:AB_2314866	IF(1:5000)
Antibody	Goat polyclonal anti-mouse Alexa Fluor 488 antibody	Thermo Fisher	Cat# A-11001, RRID:AB_2534069	IF(1:500)
Antibody	Goat polyclonal anti-mouse Alexa Fluor 555 Plus antibody	Thermo Fisher	Cat# A32732, RRID:AB_2633281	IF(1:500)
Antibody	Goat polyclonal anti-mouse Alexa Fluor 647 polyclonal antibody	Thermo Fisher	Cat# A-21235, RRID:AB_2535804	IF(1:500)
Recombinant DNA reagent	Fruitless∆-T2A-QF2 (plasmid)	This paper		Plasmid used to generatefruitless^∆M strain
Recombinant DNA reagent	Fruitless∆-T2A-CsChrimson-TdTomato (plasmid)	This paper		Plasmid used to generatefruitless^{∆M-tdTomato} strain
Commercial assay or kit	NEBuilder HiFi DNA Assembly	NEB	NEB:E5520S
Commercial assay or kit	HiScribe Quick T7 kit	NEB	NEB:E2050S
Peptide, recombinant protein	Cas9	PNABio	PNABio:CP01-200
Sequence-based reagent	sgRNA_for	This paper	PCR primer for sgRNA	GAAATTAATACGACTCACTATAGCACCGAAGGTATGTTGAGGTTTTAGAGCTAGAAATAGC
Sequence-based reagent	sgRNA_rev	This paper	PCR primer for sgRNA	AAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC
Software, algorithm	STAR v 2.5.2a			RNAseq alignment
Software, algorithm	Trinity v 2013-03-25			De novo assembly
Software, algorithm	Prism v8	GraphPad	Prism 8	statistics
Software, algorithm	MacVector v15.0.3	MacVector	MacVector	Plasmid cloning
Other	DAPI stain	Sigma	D9542	1:10,000
Other	Quattroport	This paper		https://github.com/VosshallLab/Basrur_Vosshall2020; Basrur, 2021; (copy archived atswh:1:rev:529b0ba393bac09207d298e73e425b452338e876)