Interleukin-33 regulates the endoplasmic reticulum stress of human myometrium via an influx of calcium during initiation of labor
- Department of Obstetrics, The First Affiliated Hospital of Nanjing Medical University, China
- Department of Obstetrics, The Affiliated Wuxi Maternity and Child Health Care Hospital of Nanjing Medical University, China
Figures
Figure 1
Nuclear localization of the interleukin-33 (IL-33) and reduced level associated with the onset of labor.
The fixed paraffin-embedded sections of human myometrium were immune stained with anti-IL-33 antibody. (A) Immunohistochemistry results showing that in term nonlabor (TNL) and preterm nonlabor (PNL) tissues, IL-33 was mostly located in the nuclei which reduced sharply and emerged in the cytoplasm with the initiation of labor as shown in these representative images of term labor (TL) and preterm labor (PTL) samples. Quantification of IL-33 expression within the nuclear regions showed apparent differences between labor and nonlabor tissues (n = 8). (B) The sections of human myometrium were visualized using an Alexa Flour 594 secondary antibody labeled with IL-33 (red), and the nuclei were stained with DAPI (blue). Analysis of nuclei was performed by using confocal microscopy and the fluorescence signals of IL-33 and nuclei were superimposed. Representative immunofluorescence photomicrographs reflected this same phenomenon. (C) From western blots, we also can see that the nonlabor groups had more nuclear expression and less cytoplasmic expression of IL-33 compared to labor groups while the total IL-33 had no obvious differences between groups. Quantitative real-time PCR (qRT-PCR) discovered no apparent alteration in the levels of IL-33 mRNA (n = 3). Representative blots are shown. The data are presented as the mean percentages of control ± standard deviation (SD). The data from western blots and immunofluorescence are presented as the means ± standard error of the mean (SEM) of the ratios. Statistical analyses were compared using an unpaired two-tailed Student’s t test. **p＜0.01, ***p＜0.001, ****P ＜0.0001 when compared to control; bar, 50 μm.
-
Figure 1—source data 1
Nuclear localization of the IL-33 and reduced level associated with the onset of labor.
- https://cdn.elifesciences.org/articles/75072/elife-75072-fig1-data1-v1.zip
Figure 2
Dynamic changes in the localization of interleukin-33 (IL-33) during lipopolysaccharide (LPS) stimulation.
(A) Localization analysis using confocal laser scanning microscopy images of IL-33 with the stimulation of 10 μg/ml LPS, IL-33 can be seen in the nucleus and this declines sharply compared with the control group, especially after 3 hr. However, with the longer time of the LPS treatment, the expression of IL-33 rises again from 6 hr and reaches peak at 12 hr. The lower panel is the percentage of cells of whereby IL-33 is expressed mainly in the nuclei (n = 3). Representative immunofluorescence photomicrographs are shown. (B) After the primary cells were loaded with LPS for different lengths of time, the cytoplasmic and nuclear proteins were isolated. In the cytoplasmic and nucleus fractions, IL-33 was quantified by western blotting, and the experiment was performed as described for (B). Each experiment was performed minimum of three times and the three representative results shown (n = 3). Representative blots are also shown. From the blots, we can see that the cytoplasmic and nuclear fraction IL-33 levels presented the same trend changes as the immunofluorescence data. The data from western blots and immunofluorescence are presented as means ± standard error of the mean (SEM) of the ratios. Statistical analyses were compared using an unpaired two-tailed Student’s t test. *p＜0.05, **p＜0.01, *** P＜0.001, **** P＜0.0001, when compared to control; bar, 50 μm.
-
Figure 2—source data 1
Dynamic changes in the localization of IL-33 during LPS stimulation.
- https://cdn.elifesciences.org/articles/75072/elife-75072-fig2-data1-v1.zip
Figure 3
Interleukin-33 (IL-33) silencing enhanced lipopolysaccharide (LPS)-induced expression of calcium channels and the intracellular calcium concentration.
Primary myometrium cells were transfected with IL-33 or nontargeting (as control) siRNAs and treated with 10 μg/ml LPS or phosphate-buffered saline (PBS) (as control) for 0.5, 1, 3, and 6 hr, respectively. (A) Immunofluorescence staining analysis was performed with fluo-3AM (green) and nuclei were stained with DAPI (blue) (n = 3). Representative immunofluorescence photomicrographs are shown. (B) Western blot analysis for the expression levels of Cav 3.1 and Cav 3.2 in stably transfected and nontransfected myometrial cells with the treatments as indicated (n = 5). Representative blots are shown. The data from western blots and immunofluorescence are presented as means ± standard error of the mean (SEM) of the ratios. Statistical analyses were compared using a one-way analysis of variance and Bonferroni multiple comparisons test. *p＜0.05, **p＜0.01 when compared to controls; bar, 50 μm.
-
Figure 3—source data 1
IL-33 silencing enhanced LPS-induced expression of calcium channels and the intracellular calcium concentration.
- https://cdn.elifesciences.org/articles/75072/elife-75072-fig3-data1-v1.zip
Figure 4
BAPTA-AM inhibited the expression of cyclooxygenase-2 (COX-2) and the endoplasmic reticulum (ER) stress response.
(A) Study of COX-2 protein expression with lipopolysaccharide (LPS) treatment in the absence or presence of BAPTA-AM (25 μg/ml) (n = 5). (B) The protein expression of p-IRE1α, XBP1s, and GRP78 was analyzed by western blotting after 6 and 12 hr LPS stimulate and with or without BAPTA-AM (n = 5). Representative blots are shown for both (A) and (B). The data from western blots are presented as means ± standard error of the mean (SEM) of the ratios. Statistical analyses were compared using a one-way analysis of variance and Bonferroni multiple comparisons test. *p＜0.05, **p＜0.01 when compared to controls.
-
Figure 4—source data 1
BAPTA-AM inhibited the expression of COX-2 and the ER stress response.
- https://cdn.elifesciences.org/articles/75072/elife-75072-fig4-data1-v1.zip
Figure 5
Interleukin-33 (IL-33) silencing highlighted the lipopolysaccharide (LPS)-induced endoplasmic reticulum (ER) stress response.
Based on the discovery that calcium ions affected ER stress, western blotting and quantitative real-time PCR (qRT-PCR) were performed to explore the expression of ER stress in tissues at the protein and mRNA levels. (A) The protein levels of P-IRE1α and XBP1s in the term labor (TL) and preterm labor (PTL) groups were higher than those in the term nonlabor (TNL) and preterm nonlabor (PNL) groups while there was no alteration in the levels of GRP78 protein (n = 6). (B) The mRNA level of XBP1s in the PTL groups was higher than that in the PNL groups (n = 6). Furthermore, in order to illustrate the protein-level changes of ER stress during labor, LPS was used to stimulate primary uterine smooth muscle cells for different times and then western blot was used to assess the alteration of ER stress. (C) It was found that the protein levels of pIRE1α reached its peak at 10 min while XBP1s was at 15 min, while those of GRP78 did not change significantly (n = 5). We also detected apparent alterations in the ER stress protein when cells were stimulated based knockdown experiments targeting IL-33. (D) It revealed that the ER stress response in the siRNA-based group was more obvious compared with the LPS stimulated directly especially at 30 min (n = 5). For western blotting data with respect to (A), (C), and (D) representative blots are shown. The data are presented as mean percentages of control ± standard deviation (SD). The data from western blots are presented as means ± standard error of the mean (SEM) of the ratios. Statistical analyses were compared using an unpaired two-tailed Student’s t test for (A–C), while a one-way analysis of variance and Bonferroni multiple comparisons test for (D). *p＜0.05, **p＜0.01, ***p＜0.001, ****p＜0.001 when compared to controls.
-
Figure 5—source data 1
IL-33 silencing highlighted the LPS-induced endoplasmic reticulum stress response.
- https://cdn.elifesciences.org/articles/75072/elife-75072-fig5-data1-v1.zip
Figure 6
Interleukin-33 (IL-33) siRNA and the endoplasmic reticulum stress response affected cyclooxygenase-2 (COX-2) expression in myometrial cells.
(A) In the process of studying whether IL-33 affects COX-2, we found that the COX-2 expression in the siRNA-mediated group was significantly increased compared with the lipopolysaccharide (LPS) alone group (n = 5). (B) Western blot analyses showing protein expression of COX-2 in myometrium cells was decreased following treatment with LPS for 12 hr (n = 5). Representative blots are shown for figures (A) and (B). The data from western blots are presented as means ± standard error of the mean (SEM) of the ratios. Statistical analyses were compared using an unpaired two-tailed Student’s t test. **p＜0.01 when compared to controls.
-
Figure 6—source data 1
IL-33 siRNA and the endoplasmic reticulum stress response affected COX-2 expression in myometrial cells.
- https://cdn.elifesciences.org/articles/75072/elife-75072-fig6-data1-v1.zip
Figure 7
Interleukin-33 (IL-33) knockdown enhanced lipopolysaccharide (LPS)-induced nuclear factor kappa-B (NF-κB) and p38/mitogen-activated protein kinase (MAPK) signaling pathways.
(A) Relative levels of p-P38, P38, p-NF-κB, and NF-κB were assessed by western blot analysis at the indicated time point after LPS (10 μg/ml) stimulation. Phosphorylation levels of P38 and NF-κB increased gradually with LPS stimulation and peaked at 15 min and 1 hr, respectively (n = 5). (B) Western blot analysis of p-P38, P38, p-NF-κB, and NF-κB expression in cells transfected with siRNA targeting IL-33 after treatment with LPS for 30 min. Compared with the LPS group, the protein expression of phosphorylated P38 and NF-κB were increased in the LPS + siRNA IL-33 group (n = 5). (C) The protein levels of cyclooxygenase-2 (COX-2) were decreased when SB-202190 and JSH-23 blocked the p38/MAPK and NF-κB signaling pathways, respectively (n = 5). Representative blots are shown for A–C. The data from western blots are presented as means ± standard error of the mean (SEM) of the ratios. Statistical analyses were compared using an unpaired two-tailed Student’s t test for A and C, while a one-way analysis of variance and Bonferroni multiple comparisons test forB. *p＜0.05, **p＜0.01, ***p＜0.001, ****P＜0.0001, when compared to controls.
-
Figure 7—source data 1
IL-33 knockdown enhanced LPS-induced NF-κB and p38/MAPK signaling pathways.
- https://cdn.elifesciences.org/articles/75072/elife-75072-fig7-data1-v1.zip
Figure 8
Interleukin-33 (IL-33) siRNA and the cytoplasmic calcium influenced the expression of IL-8 and IL-6.
Compared with the lipopolysaccharide (LPS) group, the expression of IL-8 and IL-6 was increased in the LPS + IL-33 siRNA group and decreased in the LPS + BAPTA AM group (n = 5). The data are presented as mean percentages of control ± standard deviation (SD). Statistical analyses were compared using a one-way analysis of variance and Bonferroni multiple comparisons test. *p＜0.05 when compared to controls.
Figure 9
Diagrammatic model for the role of interleukin-33 (IL-33) in the myometrium where it participates in maintaining a uterine quiescent state at the tissue-to-cellular level during late pregnancy.
Author response image 1
Author response image 2
Tables
Table 1
The following primers were used in this study.
| Target genes | Forward primer | Reverse primer |
|---|---|---|
| IL-33 | TGCCAACAACAAGGAACACTCTG | CACTCCAGGATCAGTCTTGCATTC |
| XBP1s | CTGAGTCCGCAGCAGGTG | GTCCAGAATGCCCAACAGGA |
| GRP78 | CCCGTCCAGAAAGTGTTG | CAGCACCATACGCTACAG |
| β-Actin | CTCCATCCTGGCCTCGCTGT | GCTGTCACCTTCACCGTTCC |
Additional files
-
Transparent reporting form
- https://cdn.elifesciences.org/articles/75072/elife-75072-transrepform1-v1.docx
-
Reporting standard 1
STROBE checklist.
- https://cdn.elifesciences.org/articles/75072/elife-75072-repstand1-v1.docx
Download links
A two-part list of links to download the article, or parts of the article, in various formats.
Downloads (link to download the article as PDF)
Open citations (links to open the citations from this article in various online reference manager services)
Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)
Interleukin-33 regulates the endoplasmic reticulum stress of human myometrium via an influx of calcium during initiation of labor
eLife 11:e75072.
https://doi.org/10.7554/eLife.75072
