ICAM-1 nanoclusters regulate hepatic epithelial cell polarity by leukocyte adhesion-independent control of apical actomyosin
- Centro de Biologia Molecular Severo Ochoa, CSIC-UAM, Spain
- William Harvey Research Institute, Faculty of Medicine and Dentistry, Queen Mary University of London, United Kingdom
- Centro Nacional de Biotecnologia (CSIC), Spain
- Facultat de Ciències, Tecnologia i Enginyeries, Universitat de Vic – Universitat Central de Catalunya (UVic-UCC), Spain
- Servicio de Anatomía Patológica, Hospital Universitario de Salamanca, Spain
- Molecular Biology Unit, Hospital Universitario de la Princesa, Spain
- Instituto de Investigación Sanitaria Hospital Universitario de La Princesa (IIS-Princesa), Spain
- Centro de Investigación Biomédica en Red de Enfermedades Hepáticas y Digestivas (CIBERehd), Spain
- Department of Cellular Biology, Universidad Complutense de Madrid, Spain
- Max Planck Institute of Molecular Cell Biology and Genetics, Germany
Figures
Figure 1 with 1 supplement
Intercellular adhesion molecule-1 (ICAM-1) regulates the size of apical bile canaliculi (BCs) in polarized HepG2 cells.
(A) ICAM-1 concentrates in bile canaliculi (top images) and bile ducts (bottom images) from polarized hepatocytes and cholangiocytes, respectively (arrows), and in sinusoids in human livers from …
-
Figure 1—source data 1
Original file for the western blot analysis in Figure 1B.
- https://cdn.elifesciences.org/articles/89261/elife-89261-fig1-data1-v1.zip
-
Figure 1—source data 2
PDF containing Figure 1B and original scans of the relevant western blot analysis (anti-ICAM-1 and anti-tubulin), with the highlighted bands squared.
- https://cdn.elifesciences.org/articles/89261/elife-89261-fig1-data2-v1.zip
-
Figure 1—source data 3
Original file for the western blot analysis in Figure 1F.
- https://cdn.elifesciences.org/articles/89261/elife-89261-fig1-data3-v1.zip
-
Figure 1—source data 4
PDF containing Figure 1F and original scans of the relevant western blot analysis (anti-ICAM-1 and anti-ERK), with the highlighted bands squared.
- https://cdn.elifesciences.org/articles/89261/elife-89261-fig1-data4-v1.zip
Figure 1—figure supplement 1
Effect of ICAM-1 depletion on cell apicobasal polarity, proliferation, size and survival.
(A) Cells were seeded at very low density and counted for 96 hr. Bars represent the SD of the mean. n = 3. ** p<0.01. (B) In each cell passage, cell density, size (left graph), and percentage of …
-
Figure 1—figure supplement 1—source data 1
Original file for the western blot analysis in Figure 1—figure supplement 1F (anti-ICAM-1 and anti-ERK).
- https://cdn.elifesciences.org/articles/89261/elife-89261-fig1-figsupp1-data1-v1.zip
-
Figure 1—figure supplement 1—source data 2
PDF containing Figure 1—figure supplement 1F and original scans of the relevant western blot analysis (anti-ICAM-1 and anti-ERK), with the highlighted bands squared.
- https://cdn.elifesciences.org/articles/89261/elife-89261-fig1-figsupp1-data2-v1.zip
Figure 2 with 1 supplement
Intercellular adhesion molecule-1 (ICAM-1) regulates bile canaliculi (BC) dynamics in polarized HepG2 cells.
(A) Correlative cryo-soft X-ray tomography (cryo-SXT) of ICAM-1_KO cells stably expressing GFP-Rab11 showing two fusing BCs. The SXT image shows a slice of the reconstructed tomogram from the boxed …
Figure 2—figure supplement 1
Long-term ICAM-1 depletion induces massively enlarged BCs.
(A) WT and ICAM-1_KO HepG2 cells were cultured for 6 d, fixed and stained for ZO-1 and F-actin. Right images show enlargements of the boxed areas in the left images. Scale bar, 20 μm. (B) HepG2 …
-
Figure 2—figure supplement 1—source data 1
Original file for the western blot analysis in Figure 2—figure supplement 1B (anti-ICAM-1 and anti-tubulin).
- https://cdn.elifesciences.org/articles/89261/elife-89261-fig2-figsupp1-data1-v1.zip
-
Figure 2—figure supplement 1—source data 2
PDF containing Figure 2—figure supplement 1B and original scans of the relevant western blot analysis (anti-ICAM-1 and anti-tubulin), with the highlighted bands squared.
- https://cdn.elifesciences.org/articles/89261/elife-89261-fig2-figsupp1-data2-v1.zip
Figure 3
Upregulation of intercellular adhesion molecule-1 (ICAM-1) expression in response to inflammatory cytokines reduces bile canaliculi (BC) frequency.
(A–D) Polarized hepatic epithelial cells were stimulated or not for 48 hr with 50 ng/ml TNF-α, 15 ng/ml IL-1β, and IFN-γ 1000 U/ml as indicated. (A) Cells were lysed and ICAM-1 expression levels …
-
Figure 3—source data 1
Original file for the western blot analysis in Figure 3A.
- https://cdn.elifesciences.org/articles/89261/elife-89261-fig3-data1-v1.zip
-
Figure 3—source data 2
PDF containing Figure 3A and original scans of the relevant western blot analysis (anti-ICAM-1 and anti-tubulin), with the highlighted bands squared.
- https://cdn.elifesciences.org/articles/89261/elife-89261-fig3-data2-v1.zip
Figure 4 with 1 supplement
Intercellular adhesion molecule-1 (ICAM-1) controls canalicular membrane expansion by regulating a distal canalicular actomyosin network.
(A, B) Bile canaliculi (BC) contain a ring of actomyosin. (A) Polarized HepG2 cells expressing GFP-MLC were incubated with SirActin for 2 hr and subjected to time-lapse confocal microscopy. Left …
Figure 4—figure supplement 1
ROCK inhibition phenocopies the effect of ICAM-1 depletion and myosin-II inhibition on BC size.
Canalicular localization of RhoB and RhoC GTPases .(A) Representative images of cells quantified in Figure 4D. (B) HepG2 cells were exposed or not to 5 μM of the ROCK inhibitor Y27632 for the …
Figure 5 with 1 supplement
Intercellular adhesion molecule-1 (ICAM-1) signals to actomyosin, thereby reducing apicobasal polarity.
(A) Surface ICAM-1 engagement reduces bile canaliculi (BC) morphogenesis. ICAM-1-GFP HepG2 cells were cultured for 24 hr on coverslips precoated with the indicated antibodies (α), IgG control or …
-
Figure 5—source data 1
Original file for the western blot analysis in Figure 5E (anti-pMLC).
- https://cdn.elifesciences.org/articles/89261/elife-89261-fig5-data1-v1.zip
-
Figure 5—source data 2
Original file for the western blot analysis in Figure 5E (anti-MLC).
- https://cdn.elifesciences.org/articles/89261/elife-89261-fig5-data2-v1.zip
-
Figure 5—source data 3
Original file for the western blot analysis in Figure 5E (anti-tubulin).
- https://cdn.elifesciences.org/articles/89261/elife-89261-fig5-data3-v1.zip
-
Figure 5—source data 4
PDF containing Figure 5E and original scans of the relevant western blot analysis (anti-pMLC, anti-MLC, and anti-tubulin), with the highlighted bands squared.
- https://cdn.elifesciences.org/articles/89261/elife-89261-fig5-data4-v1.zip
Figure 5—figure supplement 1
Localization of ICAM-1 in membrane regions close to stellate stress fibers.
Effect of cell adhesion to FN on apicobasal polarity and myosin-II activation.(A) Surface intercellular adhesion molecule-1 (ICAM-1) engagement generates stellate stress fibers that concentrate pMLC …
-
Figure 5—figure supplement 1—source data 1
Original file for the western blot analysis in Figure 5—figure supplement 1C (anti-pMLC).
- https://cdn.elifesciences.org/articles/89261/elife-89261-fig5-figsupp1-data1-v1.zip
-
Figure 5—figure supplement 1—source data 2
Original file for the western blot analysis in Figure 5—figure supplement 1C (anti-MHCIIa and anti-tubulin).
Exposure corresponding to ICAM-1_KO cells.
- https://cdn.elifesciences.org/articles/89261/elife-89261-fig5-figsupp1-data2-v1.zip
-
Figure 5—figure supplement 1—source data 3
Original file for the western blot analysis in Figure 5—figure supplement 1C (anti-MHCIIa and anti-tubulin).
Exposure corresponding to WT cells.
- https://cdn.elifesciences.org/articles/89261/elife-89261-fig5-figsupp1-data3-v1.zip
-
Figure 5—figure supplement 1—source data 4
PDF containing Figure 5—figure supplement 1C and original scans of the relevant western blot analysis (anti-pMLC, anti-pMHCIIa, and anti-tubulin), with the highlighted bands squared.
- https://cdn.elifesciences.org/articles/89261/elife-89261-fig5-figsupp1-data4-v1.zip
Figure 6 with 1 supplement
Proximal interaction of intercellular adhesion molecule-1 (ICAM-1) with EBP50/NHERF1/SLC9A3R1 into nano-scale microvillar domains.
(A) The ICAM-1 BioID interactome reveals the proximal interaction of ICAM-1 with EBP50. Parental polarized HepG2 cells (WT) and HepG2 cells stably expressing ICAM-1-BirA* were incubated with 50 μM …
-
Figure 6—source data 1
Original file for the western blot analysis in Figure 6A (anti-EBP50).
- https://cdn.elifesciences.org/articles/89261/elife-89261-fig6-data1-v1.zip
-
Figure 6—source data 2
Original file for the western blot analysis in Figure 6A (anti-EXO70).
- https://cdn.elifesciences.org/articles/89261/elife-89261-fig6-data2-v1.zip
-
Figure 6—source data 3
Original file for the western blot analysis in Figure 6A (anti-ICAM-1).
- https://cdn.elifesciences.org/articles/89261/elife-89261-fig6-data3-v1.zip
-
Figure 6—source data 4
Original file for the western blot analysis in Figure 6A (anti-ERK).
- https://cdn.elifesciences.org/articles/89261/elife-89261-fig6-data4-v1.zip
-
Figure 6—source data 5
PDF containing Figure 6A and original scans of the relevant western blot analysis (anti-ICAM-1, anti-EBP50, anti-EXO70, and anti-ERK), with the highlighted bands squared.
- https://cdn.elifesciences.org/articles/89261/elife-89261-fig6-data5-v1.zip
-
Figure 6—source data 6
Original file for the western blot analysis in Figure 6E (anti-ICAM-1 and anti-flag).
- https://cdn.elifesciences.org/articles/89261/elife-89261-fig6-data6-v1.zip
-
Figure 6—source data 7
PDF containing Figure 6E and original scans of the relevant western blot analysis (anti-ICAM-1 and anti-flag), with the highlighted bands squared.
- https://cdn.elifesciences.org/articles/89261/elife-89261-fig6-data7-v1.zip
Figure 6—figure supplement 1
Intercellular adhesion molecule-1 (ICAM-1) BioID reveals the proximal interaction of the receptor with a new set of proteins.
(A) Schematic representation of the proximal biotinylation of proteins by the ICAM-1-BirA* chimeric protein. (B) Cells expressing ICAM-1-BirA* or not were incubated with 50 μM biotin for 16 hr, …
-
Figure 6—figure supplement 1—source data 1
Original file for the western blot analysis in Figure 6—figure supplement 1B (neutravidin-HRP).
- https://cdn.elifesciences.org/articles/89261/elife-89261-fig6-figsupp1-data1-v1.zip
-
Figure 6—figure supplement 1—source data 2
PDF containing Figure 6—figure supplement 1B and original scan of the relevant western blot (neutravidin-HRP), with the highlighted region squared.
- https://cdn.elifesciences.org/articles/89261/elife-89261-fig6-figsupp1-data2-v1.zip
-
Figure 6—figure supplement 1—source data 3
Original file for the western blot analysis in Figure 6—figure supplement 1D (anti-ICAM-1 and anti-SNAP23).
- https://cdn.elifesciences.org/articles/89261/elife-89261-fig6-figsupp1-data3-v1.zip
-
Figure 6—figure supplement 1—source data 4
Original file for the western blot analysis in Figure 6—figure supplement 1D (anti-ERMs).
- https://cdn.elifesciences.org/articles/89261/elife-89261-fig6-figsupp1-data4-v1.zip
-
Figure 6—figure supplement 1—source data 5
PDF containing Figure 6—figure supplement 1D and original scan of the relevant western blot (anti-ICAM-1, anti-ERMs, and anti-SNAP23), with the highlighted region squared.
- https://cdn.elifesciences.org/articles/89261/elife-89261-fig6-figsupp1-data5-v1.zip
-
Figure 6—figure supplement 1—source data 6
Original file for the western blot analysis in Figure 6—figure supplement 1F (anti-ICAM-1).
- https://cdn.elifesciences.org/articles/89261/elife-89261-fig6-figsupp1-data6-v1.zip
-
Figure 6—figure supplement 1—source data 7
Original file for the western blot analysis in Figure 6—figure supplement 1F (anti-EBP50).
- https://cdn.elifesciences.org/articles/89261/elife-89261-fig6-figsupp1-data7-v1.zip
-
Figure 6—figure supplement 1—source data 8
Original file for the western blot analysis in Figure 6—figure supplement 1F (anti-tubulin).
- https://cdn.elifesciences.org/articles/89261/elife-89261-fig6-figsupp1-data8-v1.zip
-
Figure 6—figure supplement 1—source data 9
Original file for the western blot analysis in Figure 6—figure supplement 1F (anti-ERMs).
- https://cdn.elifesciences.org/articles/89261/elife-89261-fig6-figsupp1-data9-v1.zip
-
Figure 6—figure supplement 1—source data 10
Original file for the western blot analysis in Figure 6—figure supplement 1F (anti-GAPDH).
- https://cdn.elifesciences.org/articles/89261/elife-89261-fig6-figsupp1-data10-v1.zip
-
Figure 6—figure supplement 1—source data 11
PDF containing Figure 6—figure supplement 1F and original scan of the relevant western blot (anti-ICAM-1, anti-EBP50, anti-tubulin, anti-ERMs, and anti-GAPDH), with the highlighted region squared.
- https://cdn.elifesciences.org/articles/89261/elife-89261-fig6-figsupp1-data11-v1.zip
Figure 7
EBP50 regulates intercellular adhesion molecule-1 (ICAM-1)-mediated signaling.
(A, B) HepG2 cells were transfected with siRNA control (siControl) or with siRNA targeting EBP50 (siEBP50) and cultured for 72 hr. Cells were lysed and analyzed by western blot for the indicated …
-
Figure 7—source data 1
Original file for the western blot analysis in Figure 7A (anti-EBP50 and anti-GAPDH).
- https://cdn.elifesciences.org/articles/89261/elife-89261-fig7-data1-v1.zip
-
Figure 7—source data 2
PDF containing Figure 7A and original scans of the relevant western blot analysis (anti-EBP50 and anti-GAPDH), with the highlighted bands squared.
- https://cdn.elifesciences.org/articles/89261/elife-89261-fig7-data2-v1.zip
Figure 8 with 1 supplement
Intercellular adhesion molecule-1 (ICAM-1) and non-muscle myosin-II regulate the size of canalicular-like cavities in hepatic organoids.
(A) ICAM-1 concentrates in bile canaliculi and bile ducts in livers of LPS-stimulated mice (arrows). S, sinusoids. Scale bars, 20 μm (left image) and 10 μm (right image). (B) ICAM-1, F-actin, and …
Figure 8—figure supplement 1
Generation of liver organoids from bipotent precursor cells and the effect of ICAM1 gene knockout on their cellular morphology.
(A) Graphical protocol of ductal stem cell isolation and differentiation from human and murine liver biopsies ( Broutier et al., 2016). Briefly, ductal stem cells were isolated from hepatic tissue …
-
Figure 8—figure supplement 1—source data 1
Original file of the gel containing PCR analyses of several transcripts in murine liver organoids grown in expanding medium and in hepatic tissue shown in Figure 8—figure supplement 1B (panels ICAM-1 and hrpt).
- https://cdn.elifesciences.org/articles/89261/elife-89261-fig8-figsupp1-data1-v1.zip
-
Figure 8—figure supplement 1—source data 2
Original file of the gel containing PCR analyses of several transcripts of murine liver organoids cultivated in expanding medium (EM) and differentiated medium (DM) and of liver tissue shown in Figure 8—figure supplement 1B (panels ICAM-1 and albumin).
- https://cdn.elifesciences.org/articles/89261/elife-89261-fig8-figsupp1-data2-v1.zip
-
Figure 8—figure supplement 1—source data 3
PDF containing Figure 8—figure supplement 1B and original scan of the relevant PCR analyses (ICAM-1, hrpt, albumin), with the highlighted region squared.
- https://cdn.elifesciences.org/articles/89261/elife-89261-fig8-figsupp1-data3-v1.zip
Figure 9
A model for the control of actomyosin-mediated contraction of bile canaliculi (BC) mediated by intercellular adhesion molecule-1 (ICAM-1) expression levels, which determine the size and frequency of these apical structures in hepatic epithelial cells.
Top images: canalicular ICAM-1 signals toward a distal canalicular actomyosin network at the base of microvilli. EBP50 links ICAM-1 to F-actin and localizes into membrane nano-scale domains to …
Videos
Video 1
Time-lapse fluorescence microscopy of polarized WT HepG2 cells stably expressing MDR1-GFP.
Images were acquired at 15 min intervals for 18 hr and displayed at four frames per second. Note the fusion of two bile canaliculi (BC) between 14 and 18 hr. Scale bar, 10 μm.
Video 2
Time-lapse fluorescence microscopy of polarized ICAM-1_KO HepG2 cells stably expressing MDR1-GFP.
Images were acquired at 15 min intervals for 18 hr and displayed at four frames per second. Scale bar, 10 μm.
Video 3
Time-lapse spinning disc confocal microscopy of polarized HepG2 cells expressing GFP-tagged myosin light chain (GFP-MLC) (green) and incubated with SirActin (red).
Images were acquired at 4 min intervals for 48 min and displayed at one frame per second. Scale bar, 3 μm.
Tables
Appendix 1—key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Gene (Homo sapiens) | ICAM1 | GenBank | Gene ID: 3383 | Also known as BB2; CD54; P3.58 |
| Gene (H. sapiens) | NHERF1 | GenBank | Gene ID: 9368 | Also known as EBP50; NHERF; NHE-RF; NHERF- 1; NPHLOP2; SLC9A3R1 |
| Gene (Mus musculus) | Icam1 | GenBank | Gene ID: 15894 | Also known as CD54; Ly-47; Icam-1; MALA-2 |
| Cell line (H. sapiens) | HepG2 | ATCC | ATCC HB- 8065 | |
| Cell line (H. sapiens) | Human T lymphoblasts | Donors | Human primary cells prepared from isolated peripheral blood mononuclear cells | |
| Transfected construct (H. sapiens) | ICAM-1-BirA* | This paper and Cacho-Navas et al., 2022 | Backbone pEGFP-N1 | |
| Transfected construct (H. sapiens) | ICAM-1-GFP | Dr. F. Sánchez- Madrid (Madrid, Spain) (Barreiro et al., 2002) | Backbone pEGFP-N1 | |
| Transfected construct (H. sapiens) | pSpCas9(BB)-2ª- GFP | PX458 | Addgene; 48138 | Vector for CRISPR-CAS9-medited gene edition Dr. F. Zhang (Cambridge, MA) |
| Transfected construct (H. sapiens) | GFP | Clontech | pEGFP-N1 | |
| Transfected construct (H. sapiens) | GFP-Rab11 | Dr. F. Martín- Belmonte (Madrid, Spain) (Rodríguez-Fraticelli et al., 2015) | Backbone pEGFP-C1 | |
| Transfected construct (H. sapiens) | MDR1-GFP | Dr. I.M. Arias, (Bethesda, MD) (Sai et al., 1999) | ||
| Transfected construct (H. sapiens) | GFP-RhoB | Dr. D. Pérez- Sala (Madrid, Spain) (Marcos-Ramiro et al., 2016) | Backbone pEGFP-C1 | |
| Transfected construct (H. sapiens) | GFP-Rac1 | Dr. G. Bokoch | Addgene; 12980 | |
| Transfected construct (H. sapiens) | GFP-RhoC | From Channing Der (Chapel Hill, NC) | Addgene; 23226 | Backbone pEGFP-C2 |
| Transfected construct (H. sapiens) | pCMV-FLAG-EBP50(NHERF1)-FL | Dr. M.M. Georgescu (Houston, TX) | Addgene; 28291 | Backbone pCMV-2-FLAG |
| Transfected construct (H. sapiens) | pCMV-FLAG- EBP50(NHERF1)-PDZ1-2 | Dr. M.M. Georgescu (Houston, TX) | Addgene; 28294 | Backbone pCMV-2-FLAG |
| Transfected construct (H. sapiens) | pCMV-FLAG- EBP50(NHERF1)-PDZ1iP | Dr. M.M. Georgescu (Houston, TX) | Addgene; 28295 | Backbone pCMV-2-FLAG |
| Transfected construct (H. sapiens) | pCMV-FLAG- EBP50(NHERF1)-PDZ2 | Dr. M.M. Georgescu (Houston, TX) | Addgene; 28296 | Backbone pCMV-2-FLAG |
| Transfected construct (H. sapiens) | pCMV-FLAG- EBP50(NHERF1)-EB | Dr. M.M. Georgescu (Houston, TX) | Addgene; 28297 | Backbone pCMV-2-FLAG |
| Antibody | Anti-ICAM-1 (mouse monoclonal) | R&D Systems | #BBA3; RRID:AB_356950 | IF 1/400; IP 1/100 |
| Antibody | Anti-ICAM-1 (rabbit polyclonal) | Santa Cruz Biotechnology | sc-7891; RRID:AB_647486 | WB 1/1000 |
| Antibody | Anti-ICAM-1 (mouse monoclonal) | Santa Cruz Biotechnology | sc-107; RRID:AB_627120 | IHC 1/1000 |
| Antibody | Anti-ICAM-1 (rat monoclonal) | EBioscience | 14-0542-81; RRID:AB_529544 | WB 1/1000; IF 1/200 |
| Antibody | Anti-ERK1/2 (rabbit polyclonal) | Santa Cruz Biotechnology | sc-94; RRID:AB_2140110 | WB 1/1000 |
| Antibody | Anti-EBP50 (mouse monoclonal) | Santa Cruz Biotechnology | sc-271552; RRID:AB_10649999 | WB 1/1000; IF 1/400 |
| Antibody | Anti-EBP50 (rabbit polyclonal) | Thermo Fisher Scientific | PA1-090; RRID:AB2191493 | WB 1/1000; IF 1/250 |
| Antibody | Anti-tubulin (mouse monoclonal) | Santa Cruz Biotechnology | sc-134241; RRID:AB_2009282 | WB 1/5000 |
| Antibody | Anti-SNAP23 (rabbit polyclonal) | Synaptic Systems | 111 202; RRID:AB_887788 | WB 1/1000; IF 1/400 |
| Antibody | Anti-SNAP23 (mouse monoclonal) | Santa Cruz Biotechnology | sc-374215; RRID:AB_10990315 | WB 1/1000 |
| Antibody | Anti-CD59 (mouse monoclonal) | EXBIO | MEM43 (11-233C100); RRID:AB_10735273 | IF 1/400 |
| Antibody | Anti-ERM (rabbit polyclonal) | Cell Signaling Technology | 3142; RRID:AB_2100313 | WB 1/1000; IF 1/400 |
| Antibody | Anti-GFP (mouse monoclonal) | Roche | 11814460001; RRID:AB_390913 | WB 1/1000 |
| Antibody | Anti-ZO-1 (rabbit polyclonal) | Thermo Fisher Scientific | 40-2200; RRID:AB_2533456 | IF 1/500 |
| Antibody | Anti-Rab11 (mouse monoclonal) | Thermo Fisher Scientific | 71-5300; RRID:AB_2533987 | WB 1/1000 |
| Antibody | Anti-TfR (mouse monoclonal) | Thermo Fisher Scientific | 13-6800; RRID:AB_2533029 | WB 1/1000 |
| Antibody | Anti-MLC (rabbit polyclonal) | Cell Signaling Technology | 3672; RRID:AB_10692513 | WB 1/1000; IF 1/200 |
| Antibody | Anti-p(T18/S19)- MLC (rabbit polyclonal) | Cell Signaling Technology | 3671; RRID:AB_330248 | WB 1/1000; IF 1/200 |
| Antibody | Anti-MHC-IIb (rabbit polyclonal) | BioLegend | 909902; RRID:AB_2749903 | IF 1/200 |
| Antibody | Rabbit anti-MHC- IIa (rabbit polyclonal) | BioLegend | 909802; RRID:AB_2734686 | IF 1/200 |
| Antibody | Anti-Exo70 (mouse monoclonal) | Merck (Millipore) | MABT186 clone 70X13F3 | WB 1/500 |
| Antibody | Anti-IgG (mouse monoclonal) | Merck (Sigma-Aldrich) | I5381; RRID:AB_1163670 | IP 1/100 |
| Antibody | Anti-IgG (rabbit polyclonal) | Merck (Sigma-Aldrich) | I5006; RRID:AB_1163659 | IP 1/100 |
| Antibody | Anti-F4/80 (rat monoclonal) | Abcam | ab6640; RRID:AB_1140040 | IF 1/1000 |
| Antibody | Anti-HA-4 antigen (CEACAM) (mouse monoclonal) | University of Iowa | RRID:AB_ 10659875 | IF 1/100 |
| Antibody | Anti-plasmolipin (rabbit polyclonal) | In-house (Cacho-Navas et al., 2022) | IF 1/250 | |
| Antibody | Anti-Radixin (rabbit polyclonal) | Cell Signaling | C4G7; RRID:AB_2238294 | IF 1/250 |
| Antibody | Anti-MRP2 (mouse monoclonal) | Enzo Life Sciences | ALX-801-016; RRID:AB_22 73479 | IF 1/250 |
| Antibody | Anti-CD3 OKT3 (mouse monoclonal) | ATCC | CRL-8001 | Purified from mouse hybridomas producing anti-CD3ε mAb OKT3 (our laboratory); IF 1/250 |
| Antibody | Goat F(ab) anti-mouse IgG 596 | Abcam | Abcam (ab6723); RRID:AB_955573 | IF 1/100 |
| Antibody | Donkey anti-mouse Alexa Fluor 488 | Thermo Fisher Scientific | A-21202; RRID:AB_141607 | IF 1/500 |
| Antibody | Donkey anti-mouse Alexa Fluor 555 | Thermo Fisher Scientific | A-31570; RRID:AB_2536180 | IF 1/500 |
| Antibody | Donkey anti-mouse Alexa Fluor 647 | Thermo Fisher Scientific | A-31571; RRID:AB_162542 | IF 1/500 |
| Antibody | Donkey anti-rabbit Alexa Fluor 488 | Thermo Fisher Scientific | A-21206; RRID:AB_141708 | IF 1/500 |
| Antibody | Donkey anti-rabbit Alexa Fluor 555 | Thermo Fisher Scientific | A-31572; RRID:AB_162543 | IF 1/500 |
| Antibody | Donkey anti-rabbit Alexa Fluor 647 | Thermo Fisher Scientific | A-31573; RRID:AB_2536183 | IF 1/500 |
| Antibody | Donkey anti-rat Alexa Fluor 488 | Thermo Fisher Scientific | A-21208; RRID:AB_2535794 | IF 1/500 |
| Antibody | Donkey anti-mouse HRP | Jackson Immunoresearch | 715-035-151; RRID:AB_2340771 | WB 1/5000 |
| Antibody | Donkey anti-rabbit HRP | GE Healthcare | NA934; RRID:AB_772206 | WB 1/5000 |
| Sequence-based reagent | sgRNA ICAM-1 fw | This paper | Single-guide RNA | CACCGCGCACTCCTGGTCCTGC TCG |
| Sequence-based reagent | sgRNA ICAM-1 rv | This paper | Single-guide RNA | AAACCGAGCAGGACCAGGAGT GCGC |
| Sequence-based reagent | msICAM-1 Fw | This paper | PCR primer | CTTCAACCCGTGCCAAGC |
| Sequence-based reagent | msICAM-1 Rv | This paper | PCR primer | GAAGGCTTCTCTGGGATGGA |
| Sequence-based reagent | msHRPT Fw | This paper | PCR primer | AAGCTTGCTGGTGAAAAGGA |
| Sequence-based reagent | msHRPT Rv | This paper | PCR primer | TTGCGCTCATCTTAGGCTTT |
| Sequence-based reagent | msALB Fw | This paper | PCR primer | GCGCAGATGACAGGGCGGAA |
| Sequence-based reagent | msALB Rv | This paper | PCR primer | GTGCCGTAGCATGCGGGAGG |
| Sequence-based reagent | siControl | Dharmacon | siRNA | AUGUAUUGGCCUGUAUUAGUU |
| Sequence-based reagent | siICAM-1 3’UTR | Dharmacon | siRNA | GAACAGAGUGGAAGACAUAUU |
| Sequence-based reagent | siSLC9A3R1 05 | Dharmacon | siRNA | (TS) CCAGAAACGCAGCAGCAAA |
| Sequence-based reagent | siSLC9A3R1 06 | Dharmacon | siRNA | (TS) GCGAAAACGUGGAGAAGGA |
| Sequence-based reagent | siSLC9A3R1 07 | Dharmacon | siRNA | GCGAGGAGCUGAAUUCCCA |
| Sequence-based reagent | siSLC9A3R1 08 | Dharmacon | siRNA | GAACAGUCGUGAAGCCCUG |
| Peptide, recombinant protein | Streptavidin-Alexa Fluor 555 | Thermo Fisher Scientific | S21381; RRID:AB_2307336 | IF 1/1000 |
| Peptide, recombinant protein | Streptavidin-HRP | Thermo Fisher Scientific | 815-968-0747 | WB 1/10,000 |
| Peptide, recombinant protein | Phalloidin-Alexa Fluor 647 | Thermo Fisher Scientific | A-22287; RRID:AB_2620155 | IF 1/250 |
| Peptide, recombinant protein | PHA | Thermo Fisher Scientific | 10576015 | |
| Peptide, recombinant protein | IL-2 | Thermo Fisher Scientific | PHC0021 | |
| Peptide, recombinant protein | IL-1β | Peprotech | 200-01B | |
| Peptide, recombinant protein | TNF-α | R&D Systems | 210-TA/CF | |
| Peptide, recombinant protein | IFN-γ | Peprotech/Teb- bio | 300-02 | |
| Peptide, recombinant protein | Fibronectin | Corning | 356008 | |
| Commercial assay or kit | BCG albumin assay kit | Merck (Sigma-Aldrich) | MAK124 | |
| Chemical compound, drug | DAPI | Merck | 268298 | IF 1/1000 |
| Chemical compound, drug | Geneticin | Santa Cruz Biotechnology | 29065B | |
| Chemical compound, drug | Sulfo-NHS-biotin | Thermo Fisher Scientific | 21217 | |
| Chemical compound, drug | Phorbol 12- miristate 13- acetate (PMA) | Merck (Sigma-Aldrich) | P8139 | |
| Chemical compound, drug | Calcein-AM | Thermo Fisher Scientific | C3099 | |
| Chemical compound, drug | Y-27632 | Merck (Calbiochem) | 688000 | |
| Chemical compound, drug | Blebbistatin | Merck (Sigma-Aldrich) | B-0560 | |
| Chemical compound, drug | Biotin | Merck (Sigma-Aldrich) | B4501 | |
| Chemical compound, drug | (5-and-6)- Carboxyfluorescein Diacetate (CFDA) | Thermo Fisher Scientific | C195 | |
| Other | Tissue-Tek O.C.T. | Sakura | 4583 | For preparing liver tissue samples for immunohistochemistry; see ‘Tissue immunofluorescence and immunohistochemistry’ |
| Other | Holey Carbon Grids for Cryo EM | Quantifoil | R2/2G200F1 | For culturing cells for cryo-soft-X-ray tomography; see ‘Correlative cryo-soft X-ray tomography’ |
| Other | Neutravidin Agarose | Thermo Fisher Scientific | 29201 | Neutravidin conjugated to solid substrate to perform pull-down assays of biotinylated proteins; see ‘Biotinylation of ICAM-1-proximal proteins: BioID assay’ |
| Other | Protein-G- sepharose | Rockland | PG50-00-0002 | Protein G-coated Sepharose to conjugate mouse monoclonal antibodies and perform immunoprecipitation; see ‘Immunoprecipitation assays’ |
| Other | Ficoll | STEMCELL Technologies | 07801 | Reagent for isolating human peripheral blood mononuclear cells (PBMCs) as in Millán et al., 2002; see ‘Cells and culture’ |
