Replication stress-inducing ELF3 upregulation promotes BRCA1-deficient breast tumorigenesis in luminal progenitors
- Department of Radiation Medicine, School of Basic Medical Sciences, Peking University International Cancer Institute, Institute of Advanced Clinical Medicine, State Key Laboratory of Molecular Oncology, Peking University Health Science Center, China
- Familial and Hereditary Cancer Center, Peking University Cancer Hospital and Institute, China
- Department of Anatomy, Histology and Embryology, School of Basic Medical Sciences, Peking University Health Science Center, China
- Medical Isotopes Research Center, Department of Radiation Medicine, School of Basic Medical Sciences, Peking University Health Science Center, China
- State Key Laboratory of Molecular Oncology, Beijing, Key Laboratory of Carcinogenesis and Translational Research, Department of Thoracic Surgery I, Peking University Cancer Hospital and Institute, China
- Department of Gastrointestinal Translational Research, Peking University Cancer Hospital, China
Figures
Figure 1 with 1 supplement
LPs have higher levels of replication stress compared with other mammary cell populations.
(A) Replication stress pathway scores of different human normal mammary cell populations, scaled by row, transformed to mean = 0 and variance = 1. The gene expression data were from Lim et al., 2009. The gene expression signatures were from Dreyer et al., 2021 and Takahashi et al., 2022. (B) T-distributed statistical neighbor embedding (t-SNE) plots visualizing the replication stress scores and ELF3 expression levels in breast cancer and normal mammary tissue from a BRCA1-mutated triple-negative breast cancer patient. The cells are colored by cell type (top) and replication stress score (bottom). (C) Monocle-generated cell trajectories visualizing the change in replication stress scores during tumorigenesis. The tumor cells and compared normal luminal cells were obtained from a triple-negative breast cancer patient (case #3) carrying a BRCA1 germline mutation. LP, luminal progenitor cells; ML, mature luminal cells. (D) Volcano plots showing differentially expressed genes (DEGs) in MCF10A-shBRCA1-Tet-on cell RNA-seq results after 1 μg/mL doxycycline (DOX) treatment for 2 (left), 5 (middle), and 10 (right) days versus the Ctrl group. DEGs are genes with |log2-fold change|>2 and FDR <0.001. (E) PCA plot of MCF10A-shBRCA1-Tet-on cell RNA-seq results. (F) Mfuzz clustering analysis of Day 10 versus Ctrl DEGs. The heatmap (left) shows the differential expression mode of all genes in each cluster. The line chart (right) shows the global changing mode of each cluster. (G) Overlap of HU-treated MCF10A RNA-seq results and MCF10A-shBRCA1-Tet-on cell RNA-seq Cluster 1 genes.
Figure 1—figure supplement 1
Luminal progenitor cells (LPs) have higher levels of replication stress compared with other mammary cell populations.
(A) Replication scores of various cell types in single-cell sequencing. (Mann-Whitney U test). (B) Heatmap showing the expression pattern of replication stress-related genes in BRCA1-mutated triple-negative breast cancer cells. The cancer cells were ordered based on Monocle-generated cell trajectories of tumorigenesis (Figure 1C). (C) RT–qPCR (mean ± SD, n=3, paired two-tailed Student’s t test, ****p<0.0001) and Western blot assay results of MCF10A-shBRCA1-Tet-on cells with or without 1 μg/mL doxycycline (DOX) treatment for 48 hr. (D) Colony formation assay results of MCF10A-shBRCA1-Tet-on cells treated with or without 1 μg/mL DOX for 14 days. (E) Neutral comet assay results of MCF10A-shBRCA1-Tet-on cells with or without 1 μg/mL DOX treatment for 48 h (mean ± SD, unpaired two-tailed Student’s t-test, ****p<0.0001). (F) Schematic of the experimental procedure of MCF10A-shBRCA1-Tet-on RNA-Seq. (G) Scatter plot of the principal component analysis (PCA) results. The horizontal axis represents different principal components.
-
Figure 1—figure supplement 1—source data 1
Original western blots for Figure 1—figure supplement 1C, indicating the relevant bands.
- https://cdn.elifesciences.org/articles/89573/elife-89573-fig1-figsupp1-data1-v1.zip
-
Figure 1—figure supplement 1—source data 2
Original files for western blot analysis displayed in Figure 1—figure supplement 1C.
- https://cdn.elifesciences.org/articles/89573/elife-89573-fig1-figsupp1-data2-v1.zip
Figure 2 with 1 supplement
ELF3 is upregulated in BRCA1-associated breast cancers and is related to a worse prognosis.
(A) ELF3 expression levels in BRCA1-associated breast cancers and BRCA1-non-associated breast cancers in the TCGA and METABRIC databases. BRCA1-associated breast cancers comprise samples with BRCA1 mutations, heterozygous loss, and homozygous deletion (Mann–Whitney U test) (TCGA: BRCA1-associated, N=362; BRCA1-non-associated, N=720; METABRIC: BRCA1-associated, N=540, BRCA1-non-associated, N=1364). The bars (whiskers) in the boxplots represent the minimum and maximum values within the range of Q1-1.5*IQR and Q3+1.5*IQR, but do not include outliers. (B) Correlation of ELF3 and BRCA1 expression levels in TCGA breast cancer datasets. (C) ELF3 expression levels of different molecular subtypes of breast cancers in the TCGA and METABRIC databases (one-way ANOVA). (TCGA: Basal N=171, Her2 N=78, LumA N=499, LumB N=197, Normal N=36; METABRIC: Basal N=199, Her2 N=220, LumA N=679, LumB N=461, Normal N=140) (D) ELF3 expression levels of different IntClusts of breast cancers in the METABRIC database (one-way ANOVA; for IntClust 5 and 10, Mann–Whitney U test, ns, no significance; 5 N=184, 10 N=219, 8 N=289, 9 N=142, 6 N=84, 1 N=132, 3 N=282, 2 N=72, 7 N=182, 4 N=318). (E) Immunohistochemistry images of human triple-negative, Her2+, and ER+ PR+ Her2+ breast cancer samples stained with the ELF3 antibody. (F) ELF3 expression levels of the indicated types of human breast cancers (Mann-Whitney U test, *p<0.05). (G) Survival analysis of the indicated subtypes of human breast cancer in the KMplot database. For the TNBC group, samples with negative expression of all hormone receptors (estrogen receptor ER, progesterone receptor PR, and human epidermal growth factor receptor 2 Her2) are included. In the TNBC group, high expression (n=54), low expression (n=62); in the basal group, high expression (n=85), low expression (n=211); in the Lum A group, high expression (n=121), low expression (n=101); in the Lum B group, high expression (n=133), low expression (n=67); and in the Her2 group, high expression (n=72), low expression (n=126).
Figure 2—figure supplement 1
ELF3 expression upregulation in basal-like breast cancers is not due to amplification.
Proportions of ELF3 amplification in different molecular subtypes of TCGA breast cancers. The numbers represent the percentage of ELF3 amplification in each subtype.
Figure 3 with 1 supplement
ELF3 upregulation is induced by replication stress via the ATR-Chk1-E2F axis and by BRCA1 deficiency via GATA3 transcription.
(A) Spearman correlation analysis of ELF3 expression levels and replication stress scores in normal mammary tissue from non carriers (left) and BRCA1 mutation carriers (right). Expression data is from single-cell RNAseq data, including three BRCA1 WT patients and four BRCA1 mutant patients. All cells (normal cells and tumor cells) are involved, and ELF3 expression was normalized by reads in each cell. (B) Western blot and RT–qPCR results of MCF10A cells treated with the indicated drugs for 12 hr. Drug concentration: HU 1 mM, ATRi (VE821) 10 μM, ATMi (KU5593) 10 μM. (C) Western blot and RT–qPCR results of MCF10A cells treated with the indicated drugs for 12 hr. Drug concentrations: HU 1 mM, ATRi (VE821) 10 μM, Chk1i (GDC-0575) 50 μM, Chk2i (BML-277) 10 μM. (D) Western blot results of MCF10A cells transfected with the empty vector or Myc-E2F6 and treated with DMSO or 1 mM HU for 12 hr. (E) ChIP-Seq enrichment signal (green plot, ENCODE ENCFF858GLM; data are representative of two independent experiments) and the location of detected peaks (black line, ENCODE ENCFF692OYJ; irreproducible discovery rate (IDR) thresholded peaks) of E2F1 in MCF7 cells from the ENCODE database. (F) ELF3 expression changes as BRCA1 deficiency duration increases. ELF3 expression levels are indicated by the CPM of the RNA-seq results (means ± SD, n=3). (G) Western blot and RT–qPCR results of MCF10A cells transfected with siNC or siBRCA1 for 48 hr. (H) RT–qPCR results of MCF10A cells transfected with siNC or siGATA3 for 48 hr. (I) ChIP-Seq enrichment signal (yellow plot up, ENCODE ENCFF384CPN; yellow plot down, ENCODE ENCFF342GNN. Data are representative of two independent experiments) and the location of detected peaks (black line up, ENCODE ENCFF352QVM; black line down, ENCODE ENCFF437NQS; both are irreproducible discovery rate (IDR) thresholded peaks) of GATA3 in MCF7 cells from two independent studies (ENCSR423RTK and ENCSR000BST) from the ENCODE database. The motif sequences were obtained from the JASPAR database. (J) RT–qPCR results of MCF10A cells transfected with the indicated siRNA for 48 hr. (K) Western blot and RT–qPCR results of MCF10A cells transfected with siNC or siBRCA1 for 24 hr followed by treatment with DMSO or 1 mM HU for 12 hr. (L) RT–qPCR results of MCF10A cells transfected with siNC or siGATA3 for 24 h followed by treatment with 1 mM HU for 12 hr. In all panels of RT–qPCR results, data are presented as the mean ± SD, n=3, *p<0.05; **p<0.01; ***p<0.001; ns, no significance, by paired two-tailed Student’s t-test.
-
Figure 3—source data 1
Original western blots for Figure 3C, D, E, H and L, indicating the relevant bands.
- https://cdn.elifesciences.org/articles/89573/elife-89573-fig3-data1-v1.zip
-
Figure 3—source data 2
Original files for western blot analysis displayed in Figure 3C, D, E, H and L.
- https://cdn.elifesciences.org/articles/89573/elife-89573-fig3-data2-v1.zip
Figure 3—figure supplement 1
The replication stress response pathway is activated in BRCA1-associated breast cancers.
(A) ATR-Chk1-E2F axis gene expression levels in BRCA1-associated breast cancers and BRCA1-non-associated breast cancers in the TCGA and METABRIC databases (Mann–Whitney U test). (B) ATR-Chk1-E2F axis gene expression levels of different molecular subtypes of breast cancers in the TCGA and METABRIC databases (one way ANOVA). (C) RT–qPCR knockdown results related to Figure 3H. (D) Scores of E2F1, GATA3, and MYC motif enrichment in the ELF3 promoter sequence. (E) RT–qPCR knockdown results related to Figure 3K. (F) RT–qPCR knockdown results related to Figure 3L. In all panels of RT–qPCR results, data are presented as the mean ± SD, n=3, *p<0.05; **p<0.01; ***p<0.001, by paired two-tailed Student’s t-test.
Figure 4 with 1 supplement
ELF3 helps suppress excessive genomic instability.
(A and B) Cell viability curve of MCF10A cells transfected with siNC or siELF3 for 48 hr, treated with the indicated drugs, and measured by the CCK-8 assay (mean ± SD, n=3, two-way ANOVA, **p<0.01; ***p<0.001; ****p<0.0001). (C and D) Cell viability of HCC1937 (C) and SUM149PT (D) cells transfected with siNC or siELF3 for 5 days detected by the CCK-8 assay (mean ± SD, n=4, paired two-tailed Student’s t-test, **p<0.01; ***p<0.001; ****p<0.0001). (E and F) Cell viability curve of HCC1937 cells transfected with siNC or siELF3 for 48 hr, treated with the indicated drugs, and measured by the CCK-8 assay (mean ± SD, n=3, two-way ANOVA, **p<0.01; ***p<0.001; ****p<0.0001). (G and H) Correlation of ELF3 expression levels and cell sensitivity of the indicated drugs in the CellMiner (G) and GDSC (H) databases. (I) Nude mouse tumors of SUM149PT cells infected with shCtrl or shELF3 lentivirus (mean ± SD, unpaired two-tailed Student’s t-test, *p<0.05, shCtrl n=6, shELF3 n=5).
Figure 4—figure supplement 1
ELF3 helps suppress excessive genomic instability.
(A) Western blot knockdown results related to Figure 4A and B. (B and C) Western blot knockdown results related to Figure 4C and D. (D and E) Cell viability curve of SUM149PT cells infected with shCtrl or shELF3 lentivirus and treated with the indicated concentration of drugs (HU: μM; cisplatin: nM) and detected by the CCK-8 assay (mean ± SD, n=3, paired two-tailed Student’s t-test, *p<0.05). (F) Cell viability curve of HCC1937 cells transfected with siNC or siELF3, treated with Indicated concentration of olaparib (nM) and measured by the CCK-8 assay (mean ± SD, n=3, two-way ANOVA, **p<0.01; ***p<0.001). (G) Correlation of ELF3 expression levels and cell sensitivity to PARPi in the GDSC database.
-
Figure 4—figure supplement 1—source data 1
Original western blots for Figure 4—figure supplement 1A, B, C, E indicating the relevant bands.
- https://cdn.elifesciences.org/articles/89573/elife-89573-fig4-figsupp1-data1-v1.zip
-
Figure 4—figure supplement 1—source data 2
Original files for western blot analysis displayed in Figure 4—figure supplement 1A, B, C, E.
- https://cdn.elifesciences.org/articles/89573/elife-89573-fig4-figsupp1-data2-v1.zip
Figure 5 with 1 supplement
ELF3 helps maintain the stability of DNA replication.
(A) Spontaneous γH2AX foci of HCC1937 cells transfected with siNC or siELF3 for 72 hr (mean ± SEM, n>100, unpaired two-tailed Student’s t-test, **p<0.01; ****p<0.0001). (B and C) γH2AX and 53BP1 foci of MCF10A cells transfected with siNC or siELF3 for 48 hr and treated with 2 mM HU for 4 hr followed by release for 20 hr (mean ± SEM, n>100, unpaired two-tailed Student’s t-test, *p<0.05; **p<0.01; ***p<0.001). (D) Proportions of cells with γH2AX (≥3) and 53BP1 foci from (B and C) (mean ± SD, unpaired two-tailed Student’s t-test, *p<0.05; **p<0.01; ***p<0.001). (E) Enrichment plot of DNA replication pathways in MCF10A ELF3 knockdown RNA seq. (F) RT–qPCR results of MCF10A cells transfected with siNC or siELF3 (#4) for 72 hr (mean ± SD, n=3, paired two-tailed Student’s t-test, *p<0.05; **p<0.01; ns, no significance). (G) Replication fork velocity indicated by DNA fiber assay of MCF10A cells transfected with the indicated siRNA for 72 hr (mean ± SD, n>80, unpaired two-tailed Student’s t-test, ****p<0.0001). (H) Replication fork symmetry indicated by the DNA fiber assay of MCF10A cells transfected with the indicated siRNA for 72 hr (mean ± SD, Mann–Whitney test, ***p<0.001; ****p<0.0001). (I) Replication fork stability of MCF10A cells transfected with the indicated siRNA for 72 hr (mean ± SD, n>100, unpaired two-tailed Student’s t-test, **p<0.01; ****p<0.0001).
Figure 5—figure supplement 1
ELF3 helps maintain the stability of DNA replication.
(A) Neutral comet assay results of MCF10A cells transfected with siNC or siELF3 for 72 hr (mean ± SEM, unpaired two-tailed Student’s t test, **p<0.01; ***p<0.001).(B) RT–qPCR results of MCF10A cells transfected with siNC or siELF3 (#5) for 72 hr (mean ± SD, n=3, paired two-tailed Student’s t-test).
Figure 6 with 1 supplement
BRCA1 deficiency disturbs the differentiation of luminal progenitor cells (LPs).
(A) LP signature score of samples of MCF10A-shBRCA1-Tet-on RNA-seq. The signature score was generated using data from Lim et al., 2009. The bars (whiskers) in the boxplots represent the minimum and maximum values within the range of Q1-1.5*IQR and Q3+1.5*IQR, but do not include outliers. n=3 for each group(B) Barcode plot of LP gene set enrichment in Day 10 vs. Ctrl. LP gene sets were obtained from data from Pellacani et al. (Shiah et al., 2015). (C) Gene set enrichment analysis (GSEA) plots of the transcriptional profile of MCF10A cells with BRCA1 deficiency, MCF10A cells with ELF3 overexpression, and normal human LPs. The LP gene set was obtained from the data of Pellacani et al. (Shiah et al., 2015). (D) Violin plots displaying the distribution of ELF3 expression levels in distinct cell types in normal mammary tissue from non-carriers (left) and BRCA1 mutation carriers (right). (E) ETS subfamily transcription factor motif enrichment results of LP gene promoters. (F) Expression levels of ETS subfamily transcription factors in LPs from BRCA1 mutation carriers and non-carriers of the single-cell sequencing data. (G) ETS subfamily transcription factor enrichment of ATAC-Seq of LPs of BRCA1-deficient mice and wild-type (WT) mice from Bach et al. (Sedic et al., 2015).
Figure 6—figure supplement 1
Luminal progenitor cells (LPs) have a trait of higher replication stress, endowing them with the potential for transformation with BRCA1 deficiency.
(A) Violin plots displaying the distribution of ELF3 expression levels in distinct cell populations in normal mammary tissue from two non-carriers. (B) ELF3 expression levels (RPKM) in different cell populations from human normal mammary tissue in data of Pellacani et al. (Shiah et al., 2015). (C) Heatmap showing the expression pattern of replication stress-related genes in BRCA1-mutated triple-negative breast cancer cells. The cancer cells were ordered based on Monocle-generated cell trajectories of tumorigenesis (Figure 6E).
Figure 7
Replication stress-inducing ELF3 upregulation promotes BRCA1-deficient breast tumorigenesis.
Luminal progenitor cells (LPs) have higher replication stress levels under normal conditions (left) and thus are more likely to exceed the tumorigenesis threshold under BRCA1 deficiency (right). Replication stress and BRCA1 deficiency result in further ELF3 upregulation (top right). ELF3 can suppress excessive replication stress and help LPs maintain moderate levels of genomic instability, which is tolerable for cells to proliferate and enough to fuel cancer evolution (a). In non-LP mammary cells, which exhibit inherently low replicative stress, the ELF3 upregulation may enable cells to endure the increased replicative stress caused by BRCA1 deficiency without leading to malignancy. However, in LP cells, which naturally experience higher levels of replicative stress, this ELF3-mediated mechanism may increase susceptibility to cancerous transformation. In addition, ELF3 upregulation can boost LP gene transcription, leading to LP dedifferentiation and expansion (b). Finally, as an EMT promoter in the mammary tissue, ELF3 can accelerate the transformation process from LPs to malignant cells (c).
Author response image 1
Replication stress pathway scores of different human normal mammary cell populations.
The gene expression data were from Lim et al. (3).
Author response image 2
Average counts of Top 50 genes for the replication stress signature.
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Gene (Homo sapiens) | ELF3 | HGNC | HGNC:3318 | |
| Strain, strain background (include species and sex here) | BALB/c nude mice Female | Charles River | 401 | |
| Cell line (Homo sapiens) | MCF10A | Zomanbio | ZKC1102 | |
| Cell line (Homo sapiens) | SUM149PT | BMCR | 3101HUMSCSP5090 | |
| Cell line (Homo sapiens) | HCC1937 | BMCR | 1101HUM-PUMC000471 | |
| Antibody | anti-BRCA1 (Mouse monoclonal) | Merck-Millipore | OP92 | WB (1:1000) |
| Antibody | anti-ELF3 (Rabbit monoclonal) | Abcam | Ab133621 | WB (1:2000) |
| Recombinant DNA reagent | Tet-pLKO-hygro-shBRCA1 | This paper | shBRCA1 version of Tet-pLKO-hygro | |
| Recombinant DNA reagent | pCDH-CMV-MCS-EF1-puro-ELF3 | This paper | ELF3 version of pCDH-CMV-MCS-EF1-puro | |
| Recombinant DNA reagent | pLKO.1-shBRCA1 | This paper | shBRCA1 version of pLKO.1 | |
| Recombinant DNA reagent | pLKO.1-shELF3 | This paper | shELF3 version of pLKO.1 | |
| Sequence-based reagent | ELF3 siRNA#3 sense | This paper | siRNA sequences | GAAGUGACGUGGACCUGGATT |
| Sequence-based reagent | ELF3 siRNA#3 anti-sense | This paper | siRNA sequences | UCCAGGUCCACGUCACUUCCA |
| Sequence-based reagent | ELF3 siRNA#4 sense | This paper | siRNA sequences | GCCGAUGACUUGGUACUGATT |
| Sequence-based reagent | ELF3 siRNA#4 anti-sense | This paper | siRNA sequences | UCAGUACCAAGUCAUCGGCCC |
| Sequence-based reagent | BRCA1 siRNA sense | This paper | siRNA sequences | CAGCUACCCUUCCAUCAUATT |
| Sequence-based reagent | BRCA1 siRNA anti-sense | This paper | siRNA sequences | UAUGAUGGAAGGGUAGCUGTT |
| Chemical compound, drug | Doxycycline hydrochloride | HARVEYBIO | D31646 | |
| Software, algorithm | Mfuzz | PMID:18084642 | Mfuzz 2.46.0 |
Additional files
-
MDAR checklist
- https://cdn.elifesciences.org/articles/89573/elife-89573-mdarchecklist1-v1.docx
-
Supplementary file 1
Expression matrix of genes for the replication stress signature (case 7).
- https://cdn.elifesciences.org/articles/89573/elife-89573-supp1-v1.csv
-
Supplementary file 2
Detailed information on the BRCA1 germline mutation and clinicopathological characteristics of seven patients.
- https://cdn.elifesciences.org/articles/89573/elife-89573-supp2-v1.docx
-
Supplementary file 3
Key reagents, oligonucleotide sequences, and primers used in this study.
- https://cdn.elifesciences.org/articles/89573/elife-89573-supp3-v1.docx
Download links
A two-part list of links to download the article, or parts of the article, in various formats.
Downloads (link to download the article as PDF)
Open citations (links to open the citations from this article in various online reference manager services)
Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)
Replication stress-inducing ELF3 upregulation promotes BRCA1-deficient breast tumorigenesis in luminal progenitors
eLife 12:RP89573.
https://doi.org/10.7554/eLife.89573.3
