Main text

Peng D, Ando K, Hußmann M, Gloger M, Skoczylas R, Mochizuki N, Betsholtz C, Fukuhara S, Schulte-Merker S, Lawson ND, Koltowska K. 2022. Proper migration of lymphatic endothelial cells requires survival and guidance cues from arterial mural cells. eLife 11:e74094. doi: 10.7554/eLife.74094.

Published 22 March 2022

This error occurred during the misaligned “copy and paste” from the primer list while drafting the paper. It did not affect anyone qPCR experiments or the results. We regret any confusion or difficulties it may have caused.

In the Materials and methods session - FACS and qPCR analysis, there is a mix-up for the dll4 primers

Corrected sequence:

GGACAAATGCACCAGTATGC

GTTTGCGCAGTCGTTAATGT

Original sequence:

CGTTCCCAGGAGCCTTTTCT

TTGGGATCAGGGATGGGGAT

The article has been corrected accordingly.

Article and author information

Author details

  1. Di Peng

  2. Koji Ando

  3. Melina Hußmann

  4. Naoki Mochizuki

  5. Christer Betsholtz

  6. Shigetomo Fukuhara

  7. Stefan Schulte-Merker

Version history

  1. Version of Record published:

Copyright

© 2023, Peng et al.

This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.

Metrics

  • 201
    views
  • 0
    citations

Views, downloads and citations are aggregated across all versions of this paper published by eLife.

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Open citations (links to open the citations from this article in various online reference manager services)

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

  1. Di Peng
  2. Koji Ando
  3. Melina Hußmann
  4. Marleen Gloger
  5. Renae Skoczylas
  6. Naoki Mochizuki
  7. Christer Betsholtz
  8. Shigetomo Fukuhara
  9. Stefan Schulte-Merker
  10. Nathan D Lawson
  11. Katarzyna Koltowska
(2023)
Correction: Proper migration of lymphatic endothelial cells requires survival and guidance cues from arterial mural cells
eLife 12:e90048.
https://doi.org/10.7554/eLife.90048

Share this article

https://doi.org/10.7554/eLife.90048