Correction: Proper migration of lymphatic endothelial cells requires survival and guidance cues from arterial mural cells
Main text
Peng D, Ando K, Hußmann M, Gloger M, Skoczylas R, Mochizuki N, Betsholtz C, Fukuhara S, Schulte-Merker S, Lawson ND, Koltowska K. 2022. Proper migration of lymphatic endothelial cells requires survival and guidance cues from arterial mural cells. eLife 11:e74094. doi: 10.7554/eLife.74094.
Published 22 March 2022
This error occurred during the misaligned “copy and paste” from the primer list while drafting the paper. It did not affect anyone qPCR experiments or the results. We regret any confusion or difficulties it may have caused.
In the Materials and methods session - FACS and qPCR analysis, there is a mix-up for the dll4 primers
Corrected sequence:
GGACAAATGCACCAGTATGC
GTTTGCGCAGTCGTTAATGT
Original sequence:
CGTTCCCAGGAGCCTTTTCT
TTGGGATCAGGGATGGGGAT
The article has been corrected accordingly.
Article and author information
Author details
Version history
Copyright
© 2023, Peng et al.
This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.
Metrics
-
- 209
- views
-
- 0
- citations
Views, downloads and citations are aggregated across all versions of this paper published by eLife.