Superoxide dismutases maintain niche homeostasis in stem cell populations
- Department of Zoology, Institute of Science, Banaras Hindu University, India
Figures
Figure 1 with 1 supplement
Mitochondrial distribution and redox profile of GSCs and CySCs in adult Drosophila testes.
(A) Schematic representation of adult Drosophila testicular niche showing arrangement of different stem cell populations (GSC-Germinal stem cell, CySC-cyst stem cell). (B–E) Differential distribution of mitochondria labelled with ATP5A (monochrome/green) in Vasa+ GSCs of wild-type fly testis with cellular boundaries marked by Dlg; B# shows a digitally zoomed image of the dotted area of B. (F) Quantification of mitochondrial area per cell. Bars represent mean ± s.e.m., n=10 fields of view; ***p (unpaired t-test)<0.0001. (G–P) Redox profiling of testicular stem cell niche using gstD1-GFP as intrinsic reactive oxygen species (ROS) reporter in control (G–K) and Tj-Gal4 driven Sod1RNAi (Sod1i) testis (L–P). Dotted area denotes the region of CySC occupancy and asterisk denotes the hub. (Q) Quantification of gstD1-GFP mean fluorescence intensity (MFI) represented as fold change between GSCs and CySCs in controls. Data denotes mean ± s.e.m., n=25, ***p (unpaired t-test)<0.0001. (R) Quantification of cell-specific ROS content upon Sod1RNAi. Data denotes mean ± s.e.m., n=25, ***p (punpaired t-test)<0.0001. Controls are the indicated driver line crossed with Oregon R+. Scale bar: 10 µm.
Figure 1—figure supplement 1
Mitochondrial distribution and effect of elevated cyst stem cell (CySC) reactive oxygen species (ROS) on stem cell numbers.
(A) Co-localisation of TFAM-GFP (mitochondrial reporter line) with voxels labelled with ATP5A antibody. (B) Immunostaining ATP5A subunit of mitochondrial ATPase and marking cell boundary by discs-large (Dlg) in Tj positive CySCs. (C–D) Measurement of ROS level using gstD1-GFP reporter line where cell boundary marked using Dlg, CySC marked with Tj in control testis (C-C’’’) and in Sod1i testis (D-D’’’). (E) Quantification of overall mean gstD1-GFP fluorescence intensity (MFI) upon Sod1 knockdown represented as fold change over control, n=30. (F) Control and Sod1i testis were stained with dihydroxyethidium (DHE) reflecting superoxide level, and the mean fluorescence intensity (MFI) represented a fold change over control, mean ± s.e.m, n=10. (G–H) Change in the number of Tj+ cells due to enhancement of ROS using C587-Gal4 in control (G-G’’) and C587-Gal4 driven Sod1i testis (H-H’’). Tj+ CySCs (M) and Vasa+ germline stem cells (GSCs) (N) cells were quantified and denoted as mean ± s.e.m, n=10. (I–L) Change in number of CySCs (I’’-J’’) and GSCs (K’-L’) cells due to enhancement of ROS using Tj-Gal4 driven third chromosome Sod1RNAi. Tj+ (O) and Vasa+ (P) cells were quantified and denoted as mean ± s.e.m, n=10. Scale bar: 10 µm. For all graphs ***p (unpaired t-test)<0.0001. Scale bar: 10 µm.
Figure 2 with 1 supplement
Redox disequilibrium in the cyst stem cell lineage deregulates early cyst stem cells (CySCs) and decreases the germline stem cell (GSC) number.
(A–B) Distribution of Tj+ CySC/early cyst cell around the hub (FasIII) in control and Tj driven Sod1RNAi testis. (C–D) Represents the rosette arrangement of Vasa+ GSCs flanking the hub (dotted area). (E–G) Mean number of Tj+ cells, Zfh1+ early CySCs and GSCs in control and Sod1RNAi lines shown as mean ± s.e.m, n=10, ***p (unpaired t-test)<0.0001, **p (unpaired t-test)<0.0001. (H) Construct the design of the fluorescent ubiquitination-based cell cycle indicator (FUCCI) reporter line for tracking the cell cycle stages in Drosophila tissues, containing degrons of Cyclin B and E2F1 proteins fused with RFP or GFP. G1, S, and G2/M is represented by GFP+, RFP+, and dual labelled cells, respectively. (I–J) Comparative changes in the cell cycle phases (I) or Zfh1+ cells (J) present in G1, S, and G2/M phase at the niche zone between control and Tj >Sod1 i. Data denote mean ± s.e.m, n=10, ***p (unpaired t-test)<0.0001, **p (unpaired t-test)<0.001. (K) Mean number of pH3 + cells, a mitotic marker. Data points denote mean ± s.e.m, n=10. Scale bar: 10 µm.
Figure 2—figure supplement 1
Niche composition upon depletion of Sod paralogs in cyst stem cells (CySCs) or germline stem cells (GSCs).
(A–F) Distribution of Tj+ CySCs (A’-B’) and Vasa+ GSCs (C’’-D’’) in control (nos-Gal4/+) compared to that of nos-Gal4/SOD1i was imaged (A–D) and quantified (E–F). (G–M) Changes in the number of Tj+ (G’’, H’’ and I’’) and Vasa+ cells (G’, H’, and I’) when Sod2 was depleted either in CySCs (using Tj-Gal4 driver) (I, J and K) or GSCs (using Nos-Gal4 driver) (H, L, and M). Data denotes mean ± s.e.m, n=10. (N) Immunoblot using Vasa-specific antibody showing changes in overall Vasa levels when Sod1 was knockdown. β-tubulin was used as loading control. (O–P) Assessment of cell proliferation in Tj>Sod1 i (O) and Nos >Sod1 i (P) using UAS-fluorescent ubiquitination-based cell cycle indicator (FUCCI) reporter line, n=10. (Q) Quantitative RT-PCR reflecting the fold change difference of CyclinD expression in Tj>SOD1 i testes compared to control. Data is depicted as mean ± s.e.m, n=3. (R–S) Representative images showing variations in Zfh1+ cells present in different phases of cell cycle among control (R: I-VII) and experimental flies (S: I-VII). (R:V & S:V) shows co-localisation of Zfh1 with S-phase cell. Scale bar: 10 µm, ns: non-significant. Data points denote mean ± s.e.m, n=10. (T–U) Control (T) and Tj-Gal4 driven Sod1RNAi (U) testes stained with pH3, a mitotic marker denoting the cell proliferation. For all graphs ***p (unpaired t-test)<0.0001, **p (unpaired t-test)<0.001. Scale bar: 10 µm.Data denotes mean ± s.e.m, n=10.
-
Figure 2—figure supplement 1—source data 1
Individual original raw unlabelled blots to Figure 2—figure supplement 1N.
- https://cdn.elifesciences.org/articles/96446/elife-96446-fig2-figsupp1-data1-v1.zip
-
Figure 2—figure supplement 1—source data 2
Labelled original blots corresponding to Figure 2—figure supplement 1N.
- https://cdn.elifesciences.org/articles/96446/elife-96446-fig2-figsupp1-data2-v1.zip
Figure 3 with 1 supplement
Reactive oxygen species (ROS) imbalance in cyst stem cells (CySCs) promotes differentiation of both germline stem cells (GSCs) and CySCs.
(A–D) Number of early CySCs (Zfh1+) (A’- B’), late differentiating CCs (Eya+) (A - B) and Zfh1, Eya co-expressing population (A’’- B’’) were imaged, represented schematically (C), and quantified with respect to control and Sod1RNAi lines (D). Data points represent mean ± s.e.m, n=10, ***p (unpaired t-test)<0.0001. (E–F) The effect of Sod1 depletion in CySCs on the differentiation status of GSCs as observed using Bam-GFP reporter line. (G) The relative distance of the differentiation initiation zone (Bam+) from the hub (red) in control and Sod1i testis quantified in single sections and shown as mean ± s.e.m, n=10, ***p (unpaired t-test)<0.0001. (H–J) The shape and size of the spectrosomes marked with α-spectrin (green) were imaged (I’’-J’’) and quantified for their distance from the hub (marked with asterisk) (H), n=10, ***p (unpaired t-test)<0.0001. Branched fusome marks differentiating populations (I’-J’). (K–L) Represents the rosette arrangement of Vasa+ GSCs flanking the hub. The digitally magnified region around the hub (dotted line) as seen in control (K#) and Sod1RNAi (L#). (M–N) Comparative staining of CySC-GSC contacts through adherens junction using E-cadherin (monochrome/green). Dotted area near the hub has been expanded as an inset to show loss of E-cadherin network. (O) E-cadherin intensity histogram plot generated from ImageJ representing the mean intensity of expression in the region flanking the hub and GSCs. (P–Q) Fold change in expression of Stat-dependent transcripts Socs36E (P) and Ptp61F (Q) among control and Sod1i niche, obtained through qPCR. Data is shown as mean ± s.e.m, n=3, ***p (unpaired t-test)<0.0001. ns: not significant. Scale bar: 10 µm.
Figure 3—figure supplement 1
Enhanced reactive oxygen species (ROS) in germline stem cells (GSCs) has no effect on early CySCs and late cyst cells, but changes in CySCs affect differentiation and cell-cell adhesion.
(A–D) Distribution of the Zfh1+ early CySCs (A’-B’) and Eya+ late cyst cells (A–B) were imaged and quantified (C–D) under nos >Sod1 RNAi background where (D) represents the number of Eya+ cells present near the niche and not the total count. (E) Mean distance between the detectable origin of anti-Eya labelled cells and hub in control and Tj-Gal4>Sod1 i testis. (F) Total number of round spectrosome present in Sod1i testis with respect to controls. Data represents mean ± s.e.m, n=10 for all the above quantification and **p (unpaired t-test)<0.001, *p (unpaired t-test)<0.01. ns: not significant. Scale bar: 10 µm.
Figure 4 with 1 supplement
Altered cyst stem cells (CySC) redox state affects niche maintenance signals.
(A–B) The expression of cell polarity marker discs-large (Dlg) (red) in control and Sod1i stem-cell niche (A’’-B’’), (C–D) Representative image showing pErk distribution parallel to Tj+ cells and its expression pattern through Fire LUT (C’’-D’’). Scale bar - 10 µm. Mean fluorescence intensity (MFI) corresponding to Dlg level (E) was quantified, n=75, ***p (unpaired t-test)<0.0001. (F) MFI of total pErk expression was quantified, n=200, ***p (unpaired t-test)<0.0001. (G’-H’) Representative image showing distribution of Patched (Ptc) in Tj+ cells in control and Tj >Sod1 i. (I–J) Quantification of Ptc (I) and Hh effector Ci (J) expression through fluorescence intensity as mean ± s.e.m, n (Ptc)=90, n (Ci)=200, ***p (unpaired t-test)<0.0001 (K–L) The number of Vasa+ (K) and Tj+ (L) cells across control, Sod1i, and Sod1i/Hhi rescue samples depicted as mean ± s.e.m, n=10, ***p (unpaired t-test)<0.0001. Scale bar: 10 µm.
Figure 4—figure supplement 1
Activation of cyst stem cell (CySC) maintenance signalling promoting CySC proliferation.
(A) Relative spread of the discs-large (Dlg)+ cells irrespective of their expression state was calculated, n=10. (B) Mean fluorescence intensity (MFI) of total pErk expression was quantified in control and Tj-Gal4 driven EGFR RNAi, n=200 (C–F) Quantitative RT-PCR reflecting the fold change differences among Hh (C), Patched (Ptc) (D), Smo (E), and Ci (F) expression in Tj>SOD1 i testes compared to control. Data is depicted as mean ± s.e.m, n=3. (G–L) Representative images showing distribution of Tj (G’’,H’’, and I’’) and Vasa (J’’, K’’, and L’’) labelled cells in control, Tj-Gal4 driven Sod1i, and Sod1i/Hhi. (M) Quantitative RT-PCR reflecting the fold change differences of SOD1 level among control, single UAS, and double UAS construct. Data is depicted as mean ± s.e.m, n=3. (N–R) Distribution of Tj (P’’,Q’’, and R’’) and Vasa (P’’’,Q’’’, and R’’’) labelled cells were imaged in control (P-P’’’’), C-587 Gal4 driven UAS-Ci (Q-Q’’’) and Tj-Gal4 driven UAS-Ci (R-R’’’) and quantification of CySC number (N) and GSC number (O). (S–U) More representative images of Tj-Gal4 driven UAS-Ci under 40 x magnification showing over-proliferative Tj+ cells. (V, W) Fold Ptc and Ci levels with respect to controls, normalised using total Tj+ cells near the hub, n (Ptc)=90, n (Ci)=170, ***p (unpaired t-test)<0.0001. Scale bar: 10 µm.
Figure 5 with 1 supplement
Low cyst stem cell (CySC) reactive oxygen species (ROS) sustains germline stem cell (GSC) maintenance.
(A–B) Bar graphs illustrating variations in Vasa+ GSC (A) and Tj+ CySCs (B) numbers upon overexpressing Sod1 (Tj>SodOE), represented as mean ± s.e.m, n=10, ***p (unpaired t-test)<0.0001, *p (unpaired t-test)<0.01. (C–E) The spectrosomes labelled with α-spectrin (α-spec) were imaged (C’-D’) and their number was quantified (E), n=10, **p (unpaired t-test)<0.001. (F–H) The initiation of gonialblast differentiation was determined by measuring the distance of Bam+ zone from hub (red), n=10, *p (unpaired t-test)<0.01 (F), (G’’-H’’) shows distribution of Bam+ reporter expressing cells. Scale bar: 10 µm.
Figure 5—figure supplement 1
Overexpression of Sod1 either in germline stem cells (GSCs) or cyst stem cells (CySCs) sustains self-renewing propensity of GSC-like cells.
(A’’-D’’) Images showing rosette arrangement of GSCs around the hub in control and experimental testis overexpressing Sod1 in CySCs (Tj-Gal4/Sod1OE) and GSCs (nos-Gal4/Sod1OE). (E–H) The number of Tj+ cells in Tj-Gal4/Sod1OE and nos/Sod1OE testis were imaged (E’’-H’’). (I) Fold dihydroxyethidium (DHE) mean fluorescence intensity of Tj-Gal4/Sod1OE testis over controls. The GSCs (J) and CySCs (K) were quantified over control and represented as a bar graph. Data denotes mean ± s.e.m., n=10, ***p (unpaired t-test)<0.0001, ns: not significant. Scale bar: 10 µm.
Figure 6
Proposed role of intercellular redox balance in germline maintenance and differentiation.
germline stem cell (GSC) and cyst stem cell (CySC) are associated with different mitochondria abundance which corresponds to the presence of a redox differential between two stem cell populations. Disequilibrated redox potential among the two populations due to depletion of superoxide dismutase enhances CySC proliferation and precocious GSC differentiation, thereby disrupting the homeostatic balance between the two stem populations.
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Genetic reagent (Drosophila melanogaster) | Oregon R+ | S.C. Lakhotia, BHU, India | ||
| Genetic reagent (Drosophila melanogaster) | UAS-Sod1RNAi | Bloomington Drosophila Stock Center | RRID:BDSC_24493 | RNAi present in Chr 2 |
| Genetic reagent (Drosophila melanogaster) | UAS-Sod1RNAi | Bloomington Drosophila Stock Center | RRID:BDSC_32909 | RNAi present in Chr 3 |
| Genetic reagent (Drosophila melanogaster) | UAS-Sod1RNAi | Bloomington Drosophila Stock Center | RRID:BDSC_29389 | RNAi present in Chr 3 |
| Genetic reagent (Drosophila melanogaster) | UAS-Sod2RNAi | Bloomington Drosophila Stock Center | RRID:BDSC_32983 | |
| Genetic reagent (Drosophila melanogaster) | UAS-hhRNAi | Bloomington Drosophila Stock Center | RRID:BDSC_32489 | |
| Genetic reagent (Drosophila melanogaster) | Nos-Gal4 | Bloomington Drosophila Stock Center | RRID:BDSC_25751 | |
| Genetic reagent (Drosophila melanogaster) | UAS-FUCCI | Bloomington Drosophila Stock Center | RRID:BDSC_55122 | |
| Genetic reagent (Drosophila melanogaster) | Tj-GAL4 | Pralay Majumder, Presidency University, India | ||
| Genetic reagent (Drosophila melanogaster) | Tj-Gal4 bamGFP/Cyo | Krishanu Ray, TIFR-Mumbai, India | ||
| Genetic reagent (Drosophila melanogaster) | gstD1-GFP | B.C. Mandal, BHU | ||
| Genetic reagent (Drosophila melanogaster) | TFAM-GFP | Hong Xu, NIH, USA | ||
| Antibody | Anti-FasIII (Mouse monoclonal) | Developmental Studies Hybridoma Bank (DSHB) | Cat# 7G10, RRID:AB_528238 | IF (1:120) |
| Antibody | Anti-Eya (Mouse monoclonal) | DSHB | Cat# eya10H6, RRID:AB_528232 | IF (1:20) |
| Antibody | Anti DE-Cadherin (Rat monoclonal) | DSHB | Cat# DCAD2, RRID:AB_528120 | IF (1:20) |
| Antibody | Anti-α-Spectrin (Mouse monoclonal) | DSHB | Cat# 3A9, RRID:AB_528473 | IF (1:50) |
| Antibody | Anti beta-tubulin (Mouse monoclonal) | DSHB | Cat# E7, RRID:AB_528499 | Western (1:300) |
| Antibody | Anti-Phospho-p44/42 MAPK (Rabbit monoclonal) | Cell Signaling Technology | Cat# 4370, RRID:AB_2315112 | IF (1:100) |
| Antibody | anti-ATP5A 915H4C4 (Mouse monoclonal) | Abcam | Cat# ab14748, RRID:AB_301447 | IF (1:700) |
| Antibody | Anti-Traffic jam (Tj) | Godt (University of Toronto, Canada) | IF (1:5000) | |
| Antibody | Anti-Vasa | Lehmann (Whitehead Institute, USA) | IF (1:4000) | |
| Antibody | Anti-Zfh1 | Lehmann (Whitehead Institute, USA) | IF (1:2000) | |
| Sequence-based reagent | CycD (F) | This paper | PCR primers | CCAGAACAATGCCGTAGTGTG |
| Sequence-based reagent | CycD (R) | This paper | PCR primers | AACGCGGATAACTTTGGATTGA |
| Sequence-based reagent | Hh (F) | This paper | PCR primers | CGCCAGTGTCACCTGTCTC |
| Sequence-based reagent | Hh (R) | This paper | PCR primers | TTCTTGCGGGATTGCGGAG |
| Sequence-based reagent | Ptc (F) | This paper | PCR primers | TTCCAGTCCCACCTCGAAAC |
| Sequence-based reagent | Ptc (R) | This paper | PCR primers | GATCGTCTTCTGTGTGTAGGC |
| Sequence-based reagent | Smo (F) | This paper | PCR primers | CTGTTTCGGCTCAAAATTGCC |
| Sequence-based reagent | Smo (R) | This paper | PCR primers | GTAGTCGTTCAGCTTATCGTTCA |
| Sequence-based reagent | Ci (F) | This paper | PCR primers | GATTTTCGCCAAACTCTTTAGCC |
| Sequence-based reagent | Ci (R) | This paper | PCR primers | ACATGGGATTAAGGGCGGTAG |
| Sequence-based reagent | RP49 (F) | This paper | PCR primers | TTCAAGATGACCATCCGC |
| Sequence-based reagent | RP49 (R) | This paper | PCR primers | TTAGCATATCGATCCGACTG |
| commercial assay or kit | Rneasy Mini kit | Qiagen | Cat# 74104 | |
| Chemical compound, drug | DAPI stain | Invitrogen | D1306 | (1 µg/mL) |
| Chemical compound, drug | Phosphatase inhibitor cocktail 2 | Sigma | Cat# P5726 | (1:100) |
| Chemical compound, drug | PIPES | Sigma | Cat# P6757 | |
| Chemical compound, drug | EGTA | Sigma | Cat# E4378 | |
| Software, algorithm | ImageJ | NIH | RRID:SCR_003070 | https://imagej.nih.gov/ij/download.html |
| Software, algorithm | GraphPad Prism | GraphPad Software | RRID:SCR_002798 | Version 8 |
| Software, algorithm | Adobe Photoshop 2021 | Adobe | RRID:SCR_014199 | Version 22.4.2 |
Additional files
Download links
A two-part list of links to download the article, or parts of the article, in various formats.
Downloads (link to download the article as PDF)
Open citations (links to open the citations from this article in various online reference manager services)
Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)
Superoxide dismutases maintain niche homeostasis in stem cell populations
eLife 13:RP96446.
https://doi.org/10.7554/eLife.96446.4
