NAB2-STAT6 drives an EGR1-dependent neuroendocrine program in solitary fibrous tumors
- The Wistar Institute, United States
- Cell and Molecular Biology Graduate Group, Perelman School of Medicine, University of Pennsylvania, United States
- Graduate Group in Biochemistry and Molecular Biophysics, Perelman School of Medicine, University of Pennsylvania, United States
- Department of Orthopedic Surgery, University of Pennsylvania, United States
- Abramson Cancer Center, Perelman School of Medicine, University of Pennsylvania, United States
Figures
Figure 1 with 1 supplement
Solitary fibrous tumors express a neuronal gene signature.
(a) Table of the eight formalin-fixed paraffin-embedded (FFPE) samples used for RNA-seq listing the sample ID, Age at surgery, sex, diagnosis of tumor status, and site of resection. (b) Graphic demonstrating the workflow for FFPE RNA-seq. RNA was extracted from FFPE tumor and matching normal tissue and sequenced using exon-targeted sequencing which increases quality of FFPE RNA-seq’s. (c) Most abundant gene fusion present in all solitary fibrous tumors (SFTs) in FFPE RNA-seq, NAB2-STAT6 with exons 1–4 of NAB2 and exons 2–22 of STAT6. Graphic generated with Arriba, a fusion detection algorithm. (d) Volcano plot showing differentially expressed genes in SFTs versus normal matching tissues as determined by FFPE RNA-seq (n=8). 2429 genes were upregulated (indicated by red dots) and 3769 genes were downregulated (indicated by blue dots). Fold change >1, FDR <0.1. (e) Biological pathway gene ontology (GO) analysis of 2429 upregulated genes in INTS10 KO cells revealed enrichment for developmental and specifically neuronal developmental pathways. (f) TRANSFAC motif (transcription factor motifs at +/-1 kb from transcription start site) GO analysis of 2429 upregulated genes in INTS10 KO cells revealed enrichment for DB1, MAZ, MOVO-B, EGR1, and WT1 motifs.
Figure 1—figure supplement 1
Solitary fibrous tumors express a neuronal gene signature.
(a) Chromosomal rearrangements present in SFT 004 detected by Arriba. The inversion producing NAB2-STAT6 was the most abundant. (b) Spearman’s correlation analysis of gene expression between 26 previously published RNA-seqs of solitary fibrous tumors (SFTs) (Robinson et al., 2013) and our eight SFTs and normal matching tissues from the formalin-fixed paraffin-embedded (FFPE) RNA. (c) Principal component analysis (PCA) of FFPE RNA-seq datasets of SFTs and normal matching tissue. All SFTs cluster away from Normal matching tissue along the PC1 axis (27% of variance), suggesting broad and consistent transcriptome changes in SFTs. (d) Biological pathway gene ontology (GO) analysis of 3769 downregulated genes in SFTs cells revealed enrichment for immune and cell signaling pathways. (e) Dot plot of gene set enrichment analysis (GSEA) analysis shows the upregulation of neuronal signatures in SFT and downregulation of immune signatures. (f) TRANSFAC motif (transcription factor motifs at +/-1 kb from transcription start site) GO analysis of 3769 downregulated genes in SFTs revealed enrichment for HTF4 and MRF4, transcription factors that are usually active in mesoderm-derived tissues.
Figure 2 with 1 supplement
Generation of an inducible NAB2-STAT6 system to investigate early transcriptional changes.
(a) We generated a doxycycline-inducible clone that expresses NAB2-STAT6 (NAB2 exons 1–4, STAT6 exons 2–22) with a C-terminal FLAG tag. Immunoblot analysis of whole cell extracts shows strong expression of NAB2-STAT6 after 1, 2, and 3 days of doxycycline treatment using a FLAG antibody. GAPDH was used as control. (b) Heatmap clustering analysis of 2430 genes that are differentially expressed (fold change >1, FDR <0.1) across 1, 2, and 3 days of NAB2-STAT6 expression (Dox) as determined by 3' mRNA Quant-seq (n=4) (c) Volcano plot showing differentially expressed genes in cells expressing NAB2-STAT6 (Dox) for 2 days versus control cells as determined by 3' mRNA Quant-seq (n=4). 562 genes were upregulated (indicated by red dots) and 211 genes were downregulated (indicated by blue dots). Fold change >1, FDR <0.1. (e) Biological pathway GO analysis of 562 upregulated genes in INTS10 KO cells revealed enrichment for neuronal developmental pathways. (e) TRANSFAC motif (transcription factor motifs at +/-1 kb from transcription start site) gene ontology (GO) analysis of 562 upregulated genes in INTS10 KO cells revealed enrichment for EGR1 and PATZ motifs. (f) We plotted normalized read counts of NAB1, NAB2, EGR1, EGR2, STAT6, EGR target IGF2, and neuronal markers m (LHX2, ROBO2, and SHOX2) over 3 days of NAB2-STAT6 (Dox) expression. Targets of EGR1 were gradually upregulated; NAB1, NAB2, EGR1, IGF2, LHX2, ROBO2, and SHOX2.
-
Figure 2—source data 1
Original scans with captions.
- https://cdn.elifesciences.org/articles/98072/elife-98072-fig2-data1-v1.zip
-
Figure 2—source data 2
Raw immunoblot scans for Figure 2.
- https://cdn.elifesciences.org/articles/98072/elife-98072-fig2-data2-v1.zip
Figure 2—figure supplement 1
Generation of an inducible NAB2-STAT6 system to investigate early transcriptional changes.
(a) Principal component analysis (PCA) of 3' mRNA Quant-seq (n=4) datasets of Dox treated (1, 2, or 3 days) and control cells. The longer NAB2-STAT6 is expressed the more cells (Dox) move further along the PC1 axis (27% of variance), suggesting NAB2-STAT6 induces broad and consistent transcriptome changes in U2OS cells. (b) Biological pathway gene ontology (GO) analysis of 299 upregulated genes in cluster 1 of heatmap from Figure 2b. revealed enrichment for translation and biosynthetic pathways. (c) TRANSFAC motif (transcription factor motifs at +/-1 kb from transcription start site) GO analysis 299 upregulated genes in cluster 1 of heatmap from Figure 2b revealed enrichment for DP-1 and ZF5 motifs. (d) Heatmap clustering analysis of 166 genes that are differentially expressed (fold change >1, FDR <0.1) across 1, 2, and 3 days of NAB2-STAT6 expression (Dox) and solitary fibrous tumors (SFTs) as determined by 3' mRNA Quant-seq (n=4). Includes EGR1 targets like IGF2, LHX2, and ROBO2.
Figure 3 with 1 supplement
EGR1 targeted promoters and enhancers are activated by NAB2-STAT6.
(a) Average profiles and heatmaps of NAB2-STAT6 FLAG and EGR1 ChIP-seq and ATAC-seq in both control and 2 days NAB2-STAT6 (Dox) expressing U2OS cells at 1394 NAB2-STAT6 FLAG peaks. NAB2-STAT6 FLAG becomes significantly localized to these peaks which have significant increases in EGR1 and ATAC-seq signal. (b) Motif analysis of 1394 NAB2-STAT6 FLAG peaks using HOMER shows EGR1, EGR2, and WT1 as the most significantly enriched TF matrices. (c) Gene set enrichment analysis (GSEA) shows that genes nearest to NAB2-STAT6 FLAG peaks (n=1394) are significantly upregulated after 2 days of NAB2-STAT6 (Dox) expression in U2OS cells when compared with control cells from Figure 2. (d) Screenshot displays two enhancers and the promoter (highlighted in yellow) of KNDC1 that gains NAB2-STAT6 FLAG localization and has increases in EGR1 localization and accessibility by ATAC-seq. (e) Screenshot displays an enhancer (highlighted in yellow) of IGF2 that gains NAB2-STAT6 FLAG localization and has increased EGR1 localization and accessibility by ATAC-seq.
Figure 3—figure supplement 1
EGR1 targeted promoters and enhancers are activated by NAB2-STAT6.
(a) Pie chart showing the percentage of enhancer (1 kb >from nearest TSS) and promoter (1 kb <from nearest TSS) sites from NAB2-STAT6 Flag Peaks (n=1394). (b) Average profiles and heatmaps of NAB2 and STAT6 in both control U2OS cells at 1394 NAB2-STAT6 FLAG peaks. There is significant NAB2 but no STAT6 localization. (c) Average profiles and heatmaps of STAT6 in control U2OS cells and NAB2-STAT6 FLAG in control and 2 days NAB2-STAT6 (Dox) expressing U2OS cells at 4488 STAT6 control peaks. There is significant STAT6 but limited NAB2-STAT6 FLAG localization. (d) Screenshot displays two enhancers (highlighted in yellow) of UNCX that gains NAB2-STAT6 FLAG localization and have increases in EGR1 localization and accessibility by ATAC-seq. (e) Screenshot displays the promoter (highlighted in yellow) of EGR1 that gains NAB2-STAT6 FLAG localization and has increased in EGR1 localization and accessibility by ATAC-seq.
Figure 4 with 1 supplement
NAB2-STAT6 localizes to EGR1 targets in primary tumors.
(a) Summary of the strategy to profile NAB2-STAT6 binding in a primary solitary fibrous tumor (SFT). The primary tumor was designated and single cells were isolated and fixed. Fixed cells were then used for NAB2 and STAT6 ChIP-seq. Peaks overlapping in both NAB2 and STAT6 ChIP-seq were characterized as NAB2-STAT6 peaks. (b) Average profiles and heatmaps of NAB2, STAT6, and RNAPII ChIP-seq in a primary SFT at 5921 NAB2 only peaks, 718 NAB2-STAT6 peaks, and 1285 STAT6 only peaks. NAB2-STAT6 peaks had significant NAB2, STAT6, and RNAPII signal. (c) Top 2 motifs from motif analysis of 5921 NAB2 only peaks, 718 NAB2-STAT6 peaks, and 1285 STAT6 only peaks using HOMER shows EGR1 and WT1 as the most significantly enriched TF matrices at NAB2 and NAB2-STAT6 sites and GRE and STAT3 at STAT6 sites. (d) GSEA shows that genes nearest to NAB2-STAT6 peaks (n=718) are significantly upregulated in SFTs when compared with matching normal tissue from Figure 1. (e) Screenshot displays the promoter (highlighted in yellow) of KLF10 that has significant NAB2, STAT6, and RNAPII localization in SFTs and in U2OS gains NAB2-STAT6 FLAG localization and has increased EGR1 localization and accessibility by ATAC-seq. (f) Screenshot displays an enhancer and promoter (highlighted in yellow) of NAB2 that has significant NAB2 and STAT6 localization in SFTs and in U2OS gains NAB2-STAT6 FLAG localization and has increased EGR1 localization and accessibility by ATAC-seq.
Figure 4—figure supplement 1
NAB2-STAT6 localizes to EGR1 targets in primary tumors.
(a) The most abundant gene fusion present in the primary solitary fibrous tumor (SFT) used in Figure 4 by RNA-seq was NAB2-STAT6 with exons 1–6 of NAB2 and exons 17–22 of STAT6. Graphic generated with Arriba, a fusion detection algorithm. (b) Venn diagram of overlapping NAB2 and STAT6 peaks from ChIP-seq in control U2OS cells showing minimal overlap in physiological conditions confirming validity of dual antibody from Figure 4a. (c) Pie chart showing the percentage of enhancer (1 kb >from nearest TSS) and promoter (1 kb <from nearest TSS) sites from SFT NAB2-STAT6 Peaks (n=718). (d) Motif analysis of 5921 NAB2 only peaks using HOMER shows EGR1, EGR2, and WT1 as the most significantly enriched TF matrices. (e) Motif analysis of 718 NAB2-STAT6 peaks using HOMER shows EGR1 and WT1 as the most significantly enriched TF matrices. (f) Motif analysis of 1285 STAT6 only peaks using HOMER shows GRE and STAT3 as the most significantly enriched TF matrices. (g) Venn diagram of overlapping U2OS NAB2-STAT6 FLAG and SFT NAB2-STAT6 peaks. (h) Screenshot displays an enhancer (highlighted in yellow) of ARHGAP32 that has significant NAB2, STAT6, and RNAPII localization in SFTs and in U2OS gains NAB2-STAT6 FLAG localization and has increased EGR1 localization and accessibility by ATAC-seq.
Figure 5 with 1 supplement
NAB2-STAT6 interacts with EGR1 and NAB1 directs them to the nucleus.
(a) Eluates from NAB2 and STAT6 IPs from U2OS nuclear extracts expressing NAB2-STAT6 for 1 day were subjected to MudPIT LC-MS/MS analysis for unbiased identification of the top interactors. Log2 iBAQ protein scores of STAT6 IP interactors are plotted against scores of NAB IP. NAB1 and EGR1 were the top interactors. (b) Control and U2OS cells expressing NAB2-STAT6 for 1 day were subcellularly fractionated into nuclear and cytoplasmic fractions. Immunoblot analysis shows that NAB2-STAT6 was only present in the nuclear fraction of Dox conditions. STAT6 was nuclear in both conditions. NAB2 and EGR1 were cytoplasmic in control conditions but became nuclear in Dox conditions. GAPDH was cytoplasmic control and Histone H3 was nuclear control. (c) Immunocytochemistry (ICC) of NAB2 (red), STAT6 (green), and DAPI (blue) in solitary fibrous tumor (SFT) primary cells from Figure 4 and U2OS control and NAB2-STAT6 (Dox) expressing for one day cells. SFT and NAB2-STAT6 expressing cells show strong nuclear staining for NAB2 and STAT6. Control U2OS cells have nuclear STAT6 and cytoplasmic NAB2 staining. (d) Immunocytochemistry (ICC) of NAB1 (red), FLAG (green), and DAPI (blue) in U2OS control and NAB2-STAT6 (Dox) expressing cells for 1 day. NAB2-STAT6 expressing cells show strong nuclear staining for FLAG and NAB1. Control U2OS cells have no FLAG and cytoplasmic and nuclear NAB1 staining.
-
Figure 5—source data 1
Immunoblot scans with captions.
- https://cdn.elifesciences.org/articles/98072/elife-98072-fig5-data1-v1.zip
-
Figure 5—source data 2
Raw immunoblot scans for Figure 5.
- https://cdn.elifesciences.org/articles/98072/elife-98072-fig5-data2-v1.zip
Figure 5—figure supplement 1
NAB2-STAT6 interacts with EGR1 and NAB1 directs them to the nucleus.
(a) Eluates from EGR1 IPs from control U2OS and U2OS nuclear extracts expressing NAB2-STAT6 for 1 day were subjected to MudPIT LC-MS/MS analysis for unbiased identification of the top interactors. Log2 iBAQ protein scores of control IP interactors are plotted against scores of NAB2-STAT6 expressing IP. NAB2 and STAT6 were only pulled down in NAB2-STAT6 expressing cells. (b) We generated a clone that constitutively expressed NAB2-STAT6 (NAB2 exons 1–4, STAT6 exons 2–22) with a C-terminal FLAG tag in HEK293T. Immunoblot analysis of whole cell extracts shows strong expression of NAB2-STAT6. GAPDH was used as control. (C) Eluates from FLAG IPs from U2OS nuclear extracts expressing NAB2-STAT6 for 1 day and HEK293T clone #1 constitutively expressing NAB2-STAT6 were subjected to MudPIT LC-MS/MS analysis for unbiased identification of the top interactors. Log2 iBAQ protein scores of U2OS IP interactors are plotted against scores of HEK293T IP. NAB1 was the top interactor. (d) Peptide counts pulled down from IP-MS. (e) Map showing the position of peptides pulled down by U2OS NAB2-STAT6 FLAG IP on NAB2. Peptides were pulled down that are only present in the WT NAB2, not NAB2-STAT6. (f) Map showing the position of peptides pulled down by HEK293T NAB2-STAT6 FLAG IP on NAB2. Peptides were pulled down that are only present in the WT NAB2, not NAB2-STAT6. (g) Immunocytochemistry (ICC) of NAB2 (red), STAT6 (green), and DAPI (blue) in WT U2OS cells. NAB2 was primarily cytoplasmic and STAT6 primarily nuclear. (h) Immunocytochemistry (ICC) of NAB1 (red), FLAG (green), and DAPI (blue) in WT U2OS cells. NAB2 was cytoplasmic and nuclear while FLAG staining was absent.
Figure 6 with 1 supplement
The solitary fibrous tumor (SFT) gene signature resembles EGR1-activated tumors.
(a) Ranking of TCGA tumors by their average single sample gene set enrichment analysis (ssGSEA) score using the SFT gene signature of upregulated genes from Figure 1. (n=2429). Neuroendocrine tumors highly express the signature while leukemias downregulate the signature. (b) Kaplan-Meier curve showing survival analysis of tumors in the TCGA database stratified by high or low expression of SFT gene signature of upregulated genes from Figure 1 (n=2429). (c) ssGSEA of 87 mesotheliomas from TCGA using SFT gene signature of upregulated genes from Figure 1 (n=2429). Shows significant upregulation of the SFT gene signature in the TCGA SH A7BH sample. (d) NAB2-STAT6 gene fusion in (NAB2 exons 1–6, STAT6 exons 17–22) present in TCGA SH A7BH, originally diagnosed mesothelioma. Graphic generated with Arriba, a fusion detection algorithm. (e) InterPro domain analysis of the top 400 most upregulated genes in SFTs shows Homeobox and Cadherin as the most significantly enriched protein domains. (f) Screenshot displays HOXA locus which has significant RNAPII localization in SFTs indicating that the Homeobox genes are actively transcribed in SFTs. (g) Motif analysis of 11155 distal enhancer (1>kb from nearest TSS) RNAPII peaks using HOMER shows HOX, GRE, and PGR as the most significantly enriched TF matrices.
Figure 6—figure supplement 1
The solitary fibrous tumor (SFT) gene signature resembles EGR1-activated tumors.
Log2 fold change of Spearman correlation of human tissues vs SFT. We analyzed RNA-seq datasets of primary human samples from the Human Protein Atlas project (https://www.proteinatlas.org/). SFTs are more correlated with neuronal tissues than mesodermal and endodermal-derived organs and tissues.
Figure 7
NAB2-STAT6 drives the expression of EGR1 targets by driving co-activators to the nucleus.
Model for NAB2-STAT6’s function; NAB2-STAT6 is directed to the nucleus by its STAT6 moiety. The fusion protein then directs co-activators NAB1, NAB2, and EGR1 to the nucleus which in turn directs NAB2-STAT6 to EGR1 target promoters and enhancers which are highly activated by the complex of co-activators recruited. This figure was created using BioRender.com.
Author response image 1
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Antibody | NAB2 | Thermo Fisher | Cat#PA5-27925 | WB, 1:1000, IF, 1:500, ChIP |
| Antibody | STAT6 | Santa Cruz Biotechnology | Cat#sc-374021 | WB, 1:1000, IF, 1:500, ChIP |
| Antibody | EGR1 | Bethyl | Cat#A303-390A | WB, 1:1000, ChIP |
| Antibody | Rabbit polyclonal anti-GAPDH | Cell Signaling | Cat#2118 | WB, 1:10,000 |
| Antibody | Mouse monoclonal anti-FLAG | Sigma | Cat#F1804 | WB, 1:5000, IF 1:500, ChIP |
| Antibody | Rabbit polyclonal anti-H3K27ac | Abcam | Cat#ab4279 | ChIP |
| Antibody | Rabbit polyclonal anti-H3K4me1 | Abcam | Cat#ab8895 | ChIP |
| Antibody | Rabbit polyclonal anti-NAB1 | Protein Tech | 18541–1-AP | IF, 1:500 |
| Antibody | Rabbit polyclonal anti-RNAPII | Barbieri et al., 2018 | Custom made | ChIP |
| Antibody | Anti-rabbit IgG (HRP) | Cell Signaling | Cat#7074 | WB, 1:10,000 |
| Antibody | Anti-mouse IgG (HRP) | Cell Signaling | Cat#7076 | WB, 1:10,000 |
| Antibody | Goat anti-Rabbit IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa Fluor 594 | Thermo Fisher Scientific | Cat#A-11012 | IF, 1:500 |
| Antibody | Goat anti-Rabbit IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa Fluor 488 | Thermo Fisher Scientific | Cat#A-11008 | IF, 1:500 |
| Commercial assay or kit | Gibson Assembly Master Mix | New Englands Biolabs | Cat#E2611S | |
| Commercial assay or kit | Phusion High-fidelity DNA polymerase kit | New Englands Biolabs | Cat#M0530S | |
| Commercial assay or kit | Direct-zol RNA Miniprep kit | Zymo Research | Cat#R2051 | |
| Commercial assay or kit | Rvertaid first strand cDNA synthesis kit | Thermo Fisher Scientific | Cat#K1622 | |
| Commercial assay or kit | ChIP DNA Clean & Concentrator kit | Zymo Research | Cat#D5201 | |
| Commercial assay or kit | NEBNext Ultra II DNA Library Prep Kit for Illumina | New Englands Biolabs | Cat#E7645S | |
| Commercial assay or kit | TruSeq RNA Library Prep for Enrichment TruSeq | Illumina | Cat#20020189 | |
| Commercial assay or kit | TruSeq RNA Enrichment | Illumina | Cat#20020490 | |
| Commercial assay or kit | TruSeq RNA Enrichment | Illumina | Cat#20020490 | |
| Commercial assay or kit | TruSeq RNA Single Indexes Set A | Illumina | Cat#20020492 | |
| Commercial assay or kit | Illumina Exome Panel | Illumina | Cat#20020183 | |
| Commercial assay or kit | NEBNext Multiplex Oligos for Illumina (Index Primers set 1) | New Englands Biolabs | Cat#E6310S | |
| Commercial assay or kit | RNeasy DSP FFPE Kit | Qiagen | Cat#73604 | |
| Commercial assay or kit | Illumina Stranded Total RNA Prep, Ligation with Ribo-Zero Plus | Illumina | Cat#20040525 | |
| Other | Dynabeads Protein A | Invitrogen | Cat#10002D | |
| Other | Dynabeads Protein G | Invitrogen | Cat#10004D | |
| Other | IgG elution buffer | G-Biosciences | Cat#786–545 | |
| Other | Anti-FLAG M2 Magnetic Beads | Sigma-Aldrich | Cat#M8823 | |
| Other | FLAG peptide | Sigma-Aldrich | Cat#F3299 | |
| Cell line (Homo sapiens) | 293T cells | ATCC | Cat#CRL-3216 | |
| Cell line (Homo sapiens) | U2OS | Lakadamyali Lab, University of Pennsylvania | ||
| Peptide, recombinant protein | FLAG peptide | Sigma-Aldrich | Cat#F3299 | |
| Sequence-based reagent | pINTO_INTS13-F | This paper | Gibson assembly cloning | AACCGGTAGCGGTAC C AAGATTTTTTCTGAATCT |
| Sequence-based reagent | pINTO_INTS13-R | This paper | Gibson assembly cloning | ATCCGAGCTCGGTACCTCACTGCCGGCTGGCTTT |
| Sequence-based reagent | pINTO_INTS14-F | This paper | Gibson assembly cloning | AACCGGTAGCGGTAC C CCGACAGTGGTGGTAATG |
| Sequence-based reagent | pINTO_INTS14-R | This paper | Gibson assembly cloning | ATCCGAGCTCGGTACCTCAAATTCTTTCAGTGCT |
| Sequence-based reagent | pINTO_INTS10-F | This paper | Gibson assembly cloning | AACCGGTAGCGGTAC C TCTGCCCAGGGGGACTGC |
| Sequence-based reagent | pINTO_INTS10-R | This paper | Gibson assembly cloning | ATCCGAGCTCGGTACC TCAGGTCAGAGTCTGAAG |
| Sequence-based reagent | INTS10-F | This paper | PCR primers | TATACCAGTGGCCTCTTGTC |
| Sequence-based reagent | INTS10-R | This paper | PCR primers | CGTCTTCCTTTATCCATCTGCC |
| Recombinant DNA reagent | pLVX-Tight-Puro | Clontech | ||
| Recombinant DNA reagent | pLVX-Tet-On Advanced | Clontech | ||
| Recombinant DNA reagent | pLENTI-CMV-GFP-Puro | Addgene | ||
| Recombinant DNA reagent | Tet-pLKO-puro | Addgene | ||
| Recombinant DNA reagent | pLVX-NAB2-STAT6-FLAG-Tight-Puro | This paper | ||
| Recombinant DNA reagent | pLenti-NAB2-STAT6-FLAG-puro | This paper | ||
| Software, algorithm | STAR (2.5) | Dobin et al., 2013 | ||
| Software, algorithm | Samtools (0.1.19) | Danecek et al., 2021 | ||
| Software, algorithm | FeatureCounts | Liao et al., 2014 | ||
| Software, algorithm | DESeq2 (1.38.3) | Love et al., 2014 | ||
| Software, algorithm | MACS2 | Zhang et al., 2008 | ||
| Software, algorithm | bedtools (2.26.0) | Quinlan and Hall, 2010 | ||
| Software, algorithm | ggplot | Hamilton and Ferry, 2018 | ||
| Software, algorithm | deeptools (3.5.1) | Ramírez et al., 2016 | ||
| Software, algorithm | DiffBind (3.4.11) | Stark and Brown, 2011 | ||
| Software, algorithm | gprofiler2 (0.2.1) | Kolberg et al., 2020 | ||
| Software, algorithm | Survival (3.5–5) | Therneau and Lumley, 2019 | ||
| Software, algorithm | GSVA (1.48.1) | Hänzelmann et al., 2013 | ||
| Software, algorithm | HOMER (4.10.1) | Heinz et al., 2010 |
Additional files
-
Supplementary file 1
Solitary fibrous tumors express a neuronal gene signature.
Table of differentially expressed genes in solitary fibrous tumors (SFTs) versus normal matching tissues as determined by formalin-fixed paraffin-embedded (FFPE) RNA-seq (n=8). 2429 genes were upregulated (indicated by red dots) and 3769 genes were downregulated. Fold change >1, FDR <0.1.
- https://cdn.elifesciences.org/articles/98072/elife-98072-supp1-v1.txt
-
Supplementary file 2
Generation of an inducible NAB2-STAT6 system to investigate early transcriptional changes.
Table of differentially expressed genes in cells expressing NAB2-STAT6 (Dox) for 2 days versus control cells as determined by 3' mRNA Quant-seq (n=4). 562 genes were upregulated and 211 genes were downregulated. Fold change >1, FDR <0.1.
- https://cdn.elifesciences.org/articles/98072/elife-98072-supp2-v1.txt
-
Supplementary file 3
EGR1 targeted promoters and enhancers are activated by NAB2-STAT6.
Table of 1394 NAB2-STAT6 FLAG peaks in 2 days NAB2-STAT6 (Dox) expressing U2OS cells annotated to the nearest TSS and classified as either enhancer (greater than 1 kb to nearest TTS) or promoter peaks.
- https://cdn.elifesciences.org/articles/98072/elife-98072-supp3-v1.txt
-
Supplementary file 4
NAB2-STAT6 localizes to EGR1 targets in primary tumors.
Table of 718 NAB2-STAT6 peaks (overlapping in NAB2 and STAT6 ChIP-seq experiments) in a primary solitary fibrous tumor (SFT) annotated to the nearest TSS and classified as either enhancer (greater than 1 kb to nearest TTS) or promoter peaks.
- https://cdn.elifesciences.org/articles/98072/elife-98072-supp4-v1.txt
-
MDAR checklist
- https://cdn.elifesciences.org/articles/98072/elife-98072-mdarchecklist1-v1.docx
Download links
A two-part list of links to download the article, or parts of the article, in various formats.
Downloads (link to download the article as PDF)
Open citations (links to open the citations from this article in various online reference manager services)
Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)
NAB2-STAT6 drives an EGR1-dependent neuroendocrine program in solitary fibrous tumors
eLife 13:RP98072.
https://doi.org/10.7554/eLife.98072.3
