Mitochondrial protein carboxyl-terminal alanine-threonine tailing promotes human glioblastoma growth by regulating mitochondrial function
- Department of Biological Sciences, Dedman College of Humanities and Sciences, Southern Methodist University, United States
- Department of Neurological Surgery, University of California, San Francisco, United States
- Department of Biological Sciences, Clemson University, United States
- Center for Human Genetics, Clemson University, United States
Figures
Figure 1 with 3 supplements
Evidence for mitochondrial stress-induced protein carboxyl-terminal alanine and threonine tailing (msiCAT-tailing) on mitochondrial proteins in glioblastoma multiforme (GBM) cells.
(A) Ribosome-associated quality control (RQC) gene expression levels in GBM tumor tissues (n=153) compared to normal brain tissues (n=206) (unpaired Student’s t-test; *, logFC (fold change)>1; adj.P.Val<0.001). (B) Western blot analysis of msiCAT-tailed mitochondrial proteins and RQC factors in patient-derived glioblastoma stem cells (GSCs) and control neural stem cells (NSCs), using ACTIN as the loading control. Red arrowheads indicate short CAT-tailed mitochondrial proteins; ‘short’ and ‘long’ refer to exposure time; the red numbers represent fold changes compared to controls (NSC). (C) Western blot of 5×FLAG-tagged β-globin reporter proteins in GBM and control cells, showing more CAT-tailed proteins in GBM cells, using ACTIN as the loading control. The red numbers represent fold changes compared to controls (NHA without any treatment); the purple numbers represent the ratio of red (CAT-tailed) to green (non-CAT-tailed) sections. (D) Western blot of overexpressed ATP5α-AT3 and ATP5α-AT20 in GBM and control cells, using GAPDH as the loading control; arrowheads indicate endogenous ATP5α, ATP5α-AT3, ATP5α-AT20, and oligomers/aggregates of msiCAT-tailed ATP5α proteins. The purple numbers represent the ratio of red (exogenous) to green (endogenous) sections. (E) Immunofluorescence staining shows endogenous ATP5α protein aggregates in GBM cells, with TOM20 (red) as a mitochondrial marker. White arrows indicate ATP5α protein aggregates. (F) Quantification of E (n=3; chi-squared test; ***, p<0.001; ****, p<0.0001); the total number of cells counted is indicated in the columns.
-
Figure 1—source data 1
PDF file containing original western blots for Figure 1B, C, and D, indicating the relevant bands and treatments.
- https://cdn.elifesciences.org/articles/99438/elife-99438-fig1-data1-v1.zip
-
Figure 1—source data 2
Original files for western blot analysis shown in Figure 1B, C, and D.
- https://cdn.elifesciences.org/articles/99438/elife-99438-fig1-data2-v1.zip
-
Figure 1—source data 3
Numerical source data shown in Figure 1A, F.
- https://cdn.elifesciences.org/articles/99438/elife-99438-fig1-data3-v1.xlsx
Figure 1—figure supplement 1
Ribosome-associated quality control (RQC) pathway activity in glioblastoma multiforme (GBM) cells.
(A) Immunofluorescence staining shows elevated NEMF and reduced ANKZF1 endogenous protein levels in the tumor tissue of the GBM mouse model compared to wild-type brain tissue. Tumor identification is indicated by GFP (green). (B) Quantification of A (n=3; unpaired Student’s t-test; ****, p<0.0001). (C) Western blot analysis of select RQC factors in control cell lines (SVG, NHA) and GBM cell lines (SF268, GSC827), using ACTIN as the loading control. Red numbers represent fold changes in protein levels relative to controls (SVG).
-
Figure 1—figure supplement 1—source data 1
PDF file containing original western blots for Figure 1—figure supplement 1C, indicating the relevant bands and treatments.
- https://cdn.elifesciences.org/articles/99438/elife-99438-fig1-figsupp1-data1-v1.zip
-
Figure 1—figure supplement 1—source data 2
Original files for western blot analysis shown in Figure 1—figure supplement 1C.
- https://cdn.elifesciences.org/articles/99438/elife-99438-fig1-figsupp1-data2-v1.zip
-
Figure 1—figure supplement 1—source data 3
Numerical source data shown in Figure 1—figure supplement 1B.
- https://cdn.elifesciences.org/articles/99438/elife-99438-fig1-figsupp1-data3-v1.xlsx
Figure 1—figure supplement 2
AT repeat sequences mimicking CAT-tails induce protein aggregates in cells.
(A) Western blot analysis of ATP5α in glioblastoma stem cell (GSC) and NHA cells, using GAPDH as the loading control. The purple arrowhead indicates the modified ATP5α form; ‘short’ and ‘long’ refer to exposure time. Red numbers represent fold changes in protein levels relative to controls (the leftmost bands); purple numbers represent fold changes in protein levels of the modified ATP5α form relative to the control (the leftmost band) in the GSC long exposure blots. (B) Western blot analysis of Flag-tagged ATP5α in GSC and control cells, using ACTIN as the loading control. The red arrowhead indicates the modified Flag-ATP5α form. (C) Immunofluorescence staining shows that Flag-tagged ATP5α-AT3 and ATP5α-AT20 (green) form aggregates in glioblastoma multiforme (GBM) and control cells, using TOM20 (red) as a mitochondrial marker. (D) Quantification of C (n=3; chi-squared test; ***, p<0.001; ****, p<0.0001); the total number of cells counted is indicated in the columns. (E) Western blot of Flag-tagged ATP5α-GS3 and ATP5α-GS20 in GBM cells, using ACTIN as the loading control. (F) Immunofluorescence staining shows that Flag-tagged ATP5α-GS3 and ATP5α-GS20 (green) do not form aggregates in GBM cells, using TOM20 (red) as a mitochondrial marker. (G) Quantification of F (n=3; chi-squared test; ns, not significant); the total number of cells counted is indicated in the columns.
-
Figure 1—figure supplement 2—source data 1
PDF file containing original western blots for Figure 1—figure supplement 2A, B, and E, indicating the relevant bands and treatments.
- https://cdn.elifesciences.org/articles/99438/elife-99438-fig1-figsupp2-data1-v1.zip
-
Figure 1—figure supplement 2—source data 2
Original files for western blot analysis shown in Figure 1—figure supplement 2A, B, and E.
- https://cdn.elifesciences.org/articles/99438/elife-99438-fig1-figsupp2-data2-v1.zip
-
Figure 1—figure supplement 2—source data 3
Numerical source data shown in Figure 1—figure supplement 2D, G.
- https://cdn.elifesciences.org/articles/99438/elife-99438-fig1-figsupp2-data3-v1.xlsx
Figure 1—figure supplement 3
Aggregation of CAT-tailed mitochondrial proteins observed in vivo.
(A) Immunofluorescence staining shows that endogenous NDUS3 protein aggregates in glioblastoma multiforme (GBM) cells, with TOM20 (red) as a mitochondrial marker. White arrows indicate NUDS3 protein aggregates. (B) Quantification of A (n=3; chi-squared test; *, p<0.05); the total number of cells counted is indicated in the columns. (C) Immunofluorescence staining reveals that endogenous ATP5α protein forms aggregates in tumor tissue from the GBM mouse model, but not in wild-type brain tissue, using TOM20 (blue) as a mitochondrial marker. Tumor identification is indicated by GFP (green). White arrowheads indicate ATP5α (red) aggregates. Yellow lines indicate the regions selected for intensity analysis in (D). (D) Fluorescence intensity profiles show the signals of ATP5α (red) and TOM20 (blue) in wild-type and tumor tissues. Black arrows indicate ATP5α aggregates located outside of mitochondria. (E) Quantification of C (n=3; chi-squared test; ****, p<0.0001); the total number of cells counted is indicated in the columns.
-
Figure 1—figure supplement 3—source data 1
Numerical source data shown in Figure 1—figure supplement 3B, D.
- https://cdn.elifesciences.org/articles/99438/elife-99438-fig1-figsupp3-data1-v1.xlsx
Figure 2 with 1 supplement
Impact of msiCAT-tailed ATP5α proteins on mitochondrial functions in glioblastoma multiforme (GBM) cells.
(A) TMRM staining shows a high mitochondrial membrane potential in patient-derived glioblastoma stem cells (GSCs) (n=3; unpaired Student’s t-test; ***, p<0.001; ****, p<0.0001). (B) ATP measurement shows a low mitochondrial ATP production in patient-derived GSCs (n=3; unpaired Student’s t-test; **, p<0.01; ***, p<0.001). (C, D) JC-10 staining reveals a reduced mitochondrial membrane potential in GBM cells, but not in NHA control cells, upon both genetic (C) and pharmacological (D) inhibition of the mitochondrial stress-induced protein carboxyl-terminal alanine and threonine tailing (msiCAT-tailing) pathway (n=3; unpaired Student’s t-test; ***, p<0.001; ****, p<0.0001; ns, not significant). (E) JC-10 staining reveals an increased mitochondrial membrane potential in GBM cells, but not in control cells, upon overexpression of ATP5α-AT3 and ATP5α-AT20 (n=3; unpaired Student’s t-test; ****, p<0.0001; ns, not significant). (F) Western blot of FLAG-tagged ATP5α, NEMF, and ANKZF1 in GBM cells and control cells, using ACTIN as the loading control. (G) JC-10 staining reveals an increased mitochondrial membrane potential in GBM cells, but not in NHA control cells, upon overexpression of ATP5α-AT3 and ATP5α-AT20 with concurrent genetic inhibition of the endogenous msiCAT-tailing pathway (n=3; unpaired Student’s t-test; *, p<0.05; **, p<0.01). (H) Blue Native polyacrylamide gel electrophoresis (BN-PAGE) western blot of ATP5α and Flag shows that ATP5α-AT3 is incorporated into the mitochondrial Complex-V (ATP synthase), while ATP5α-AT20 forms high-molecular-weight protein aggregates in GBM cells. SC: respiratory supercomplex; C-V: Complex-V/ATP synthase. (I, K) Oxygen consumption rate (OCR) data indicate a reduction in mitochondrial oxygen consumption in SF268 cells expressing ATP5α-AT3 and ATP5α-AT20. Oligomycin (1.5 µM), FCCP (1.0 µM), and rotenone/antimycin A (R/A, 0.5 µM) were sequentially added. (J, L) Statistics of mitochondrial respiration parameters in (I, K), including non-mitochondrial respiration, basal respiration, maximum respiration, spare respiration, proton leaks, and ATP production (n=3; unpaired Student’s t-test; *, p<0.05; **, p<0.01; ***, p<0.001; ****, p<0.0001; ns, not significant).
-
Figure 2—source data 1
PDF file containing original western blots for Figure 2F and H, indicating the relevant bands and treatments.
- https://cdn.elifesciences.org/articles/99438/elife-99438-fig2-data1-v1.zip
-
Figure 2—source data 2
Original files for western blot analysis shown in Figure 2F and H.
- https://cdn.elifesciences.org/articles/99438/elife-99438-fig2-data2-v1.zip
-
Figure 2—source data 3
Numerical source data shown in Figure 2A–L.
- https://cdn.elifesciences.org/articles/99438/elife-99438-fig2-data3-v1.xlsx
Figure 2—figure supplement 1
Aberrant mitochondrial function in glioblastoma multiforme (GBM) cells.
(A) JC-10 staining reveals elevated mitochondrial membrane potentials in GBM cells compared to NHA (control) cells (n=3; unpaired Student’s t-test; ***, p<0.001). (B) Analysis with BioTracker ATP‐red dye staining shows reduced mitochondrial ATP production in GBM cells compared to NHA (control) cells, using MitoTracker-Green as the mitochondrial mass indicator for normalization. (C) Quantification of (B) (n=3; unpaired Student’s t-test; ****, p<0.0001). (D) Western blot of NEMF and ANKZF1 in GBM and control cells, confirming the successful overexpression and knockdown of target proteins, using ACTIN as the loading control. (E) JC-10 staining reveals no change of mitochondrial membrane potential in GBM cells, upon overexpression of ATP5α-GS3 and ATP5α-GS20 (n=3; unpaired Student’s t-test; ****, p<0.0001; ns, not significant).
-
Figure 2—figure supplement 1—source data 1
PDF file containing original western blots for Figure 2—figure supplement 1D, indicating the relevant bands and treatments.
- https://cdn.elifesciences.org/articles/99438/elife-99438-fig2-figsupp1-data1-v1.zip
-
Figure 2—figure supplement 1—source data 2
Original files for western blot analysis shown in Figure 2—figure supplement 1D.
- https://cdn.elifesciences.org/articles/99438/elife-99438-fig2-figsupp1-data2-v1.zip
-
Figure 2—figure supplement 1—source data 3
Numerical source data shown in Figure 2—figure supplement 1A, C and E.
- https://cdn.elifesciences.org/articles/99438/elife-99438-fig2-figsupp1-data3-v1.xlsx
Figure 3 with 2 supplements
Mitochondrial stress-induced protein carboxyl-terminal alanine and threonine tailing (msiCAT-tailing) product regulates mitochondrial permeability transition pore (MPTP) status in glioblastoma multiforme (GBM) cells.
(A, C) MPTP activity assay shows reduced MPTP opening in glioblastoma stem cells (GSCs) compared to NHA (control) cells. Pharmacological (A, anisomycin 200 nM) and genetic (sgNEMF) inhibition of CAT-tailing reverse it. (B, D) Quantification of (A, C) (n=3; unpaired Student’s t-test; ****, p<0.0001; ns, not significant). (E, G) Immunofluorescence staining shows that anisomycin treatment (E) and sgNEMF (G) inhibit endogenous ATP5α protein aggregation in GBM cells, using TOM20 (red) as a mitochondrial marker. (F, H) Quantification of (E, G) (n=3; chi-squared test; *, p<0.05; **, p<0.01; ***, p<0.001); the total number of cells counted is indicated in the columns. (I) The calcium retention capacity (CRC) assay of isolated mitochondria, measured using the Calcium Green-5N dye, reveals a significantly higher CRC in GBM cells compared to control NHA cells. CsA (Cyclosporin A, MPTP inhibitor) serves as a positive control. (J) Statistic of (I) shows attenuated CRC in mitochondria pre-treated with anisomycin or with sgNEMF (n=10; unpaired Student’s t-test; ***, p<0.001; ****, p<0.0001). (K) MPTP activity assay shows that ectopic expression of ATP5α-AT3 and ATP5α-AT20 inhibits MPTP opening in GBM cells. (L) Quantification of (K) (n=3; unpaired Student’s t-test; ****, p<0.0001). (M) Blue Native polyacrylamide gel electrophoresis (BN-PAGE) western blot shows that ATP5α-AT3 and ATP5α-AT20 expression alters ANT1/2 protein patterns in GBM cells, resulting in a missing band (circled in yellow dashed line) and formation of high-molecular-weight aggregates. SC: respiratory supercomplex; C-V: Complex V/ATP synthase.
-
Figure 3—source data 1
PDF file containing original western blots for Figure 3M, indicating the relevant bands and treatments.
- https://cdn.elifesciences.org/articles/99438/elife-99438-fig3-data1-v1.zip
-
Figure 3—source data 2
Original files for western blot analysis shown in Figure 3M.
- https://cdn.elifesciences.org/articles/99438/elife-99438-fig3-data2-v1.zip
-
Figure 3—source data 3
Numerical source data shown in Figure 3B, D, F, H, I, J, and L.
- https://cdn.elifesciences.org/articles/99438/elife-99438-fig3-data3-v1.xlsx
Figure 3—figure supplement 1
Cycloheximide does not impact mitochondrial functions.
(A) Mitochondrial permeability transition pore (MPTP) activity assay shows that MPTP opening is not affected by the cycloheximide treatment (100 µg/mL) in cells. (B) Quantification of (A) (n=3; unpaired Student’s t-test; ns, not significant). (C) Immunofluorescence staining reveals no inhibition of endogenous ATP5α protein aggregation by cycloheximide (100 µg/mL) treatment in glioblastoma multiforme (GBM) cells, using TOM20 (red) as a mitochondrial marker. (D) Quantification of (C) (n=3; chi-squared test; ns, not significant); the total number of cells counted is indicated in the columns. (E) MPTP activity assay reveals the increased Calcein signal in GBM cells, upon overexpression of ATP5α-AT3 and ATP5α-AT20 with concurrent genetic inhibition of the mitochondrial stress-induced protein carboxyl-terminal alanine and threonine tailing (msiCAT-tailing) pathway (n=3; unpaired Student’s t-test; **, p<0.01; ***, p<0.001; ****, p<0.0001).
-
Figure 3—figure supplement 1—source data 1
Numerical source data shown in Figure 3—figure supplement 1B, D, and E.
- https://cdn.elifesciences.org/articles/99438/elife-99438-fig3-figsupp1-data1-v1.xlsx
Figure 3—figure supplement 2
The CAT-tailed ATP5α variant has no interaction with mitochondrial permeability transition pore (MPTP) proteins.
(A) Calcium retention capacity (CRC) assay of isolated mitochondria, measured with Calcium Green-5N dye, upon cycloheximide (100 µg/mL) treatment and CAT-tailing enhancement (oeNEMF and siANKZF1). (B) Statistic of (A) shows changes in CRC in glioblastoma multiforme (GBM) cells or control cells (n=10; unpaired Student’s t-test; **, p<0.01; ***, p<0.001). (C) Co-immunoprecipitation data show no direct interaction between ATP5α and either cyclophilin D (CypD) or ANT1/2 can be found in GBM cells. Red arrowheads indicate target proteins. (D) Western blotting of cytosolic and isolated mitochondrial fractions shows ATP5α-AT3 expression reduces CypD levels in GBM cells, using TOM20 as a mitochondrial marker and loading control.
-
Figure 3—figure supplement 2—source data 1
PDF file containing original western blots for Figure 3—figure supplement 2C and D, indicating the relevant bands and treatments.
- https://cdn.elifesciences.org/articles/99438/elife-99438-fig3-figsupp2-data1-v1.zip
-
Figure 3—figure supplement 2—source data 2
Original files for western blot analysis shown in Figure 3—figure supplement 2C and D.
- https://cdn.elifesciences.org/articles/99438/elife-99438-fig3-figsupp2-data2-v1.zip
-
Figure 3—figure supplement 2—source data 3
Numerical source data shown in Figure 3—figure supplement 2A, B.
- https://cdn.elifesciences.org/articles/99438/elife-99438-fig3-figsupp2-data3-v1.xlsx
Figure 4 with 2 supplements
msiCAT-tailed ATP5α protein promotes glioblastoma multiforme (GBM) progression.
(A) MTT assay indicates increased proliferation caused by ATP5α-AT3 and ATP5α-AT20 expression in GBM cells (n=3; unpaired Student’s t-test; **, p<0.01; ***, p<0.001). (B) MTT assay indicates no change in proliferation caused by ATP5α-AT3 and ATP5α-AT20 expression in NHA cells (n=3; unpaired Student’s t-test; ns, not significant). (C) Transwell assay reveals enhanced migration induced by ATP5α-AT3 and ATP5α-AT20 expression in GBM (SF) cells but not in control (NHA) cells. (D) Quantification of (C) shows the number of migrated cells (n=3; unpaired Student’s t-test; ***, p<0.001; ns, not significant). (E) MTT assay indicates an increased proliferation in GBM cells, upon overexpression of ATP5α-AT3 and ATP5-AT20 with concurrent genetic inhibition of the endogenous mitochondrial stress-induced protein carboxyl-terminal alanine and threonine tailing (msiCAT-tailing) pathway (n=3; unpaired Student’s t-test; *, p<0.05; **, p<0.01). (F) Transwell assay reveals enhanced migration upon overexpression of ATP5α-AT3 and ATP5α-AT20 with concurrent genetic inhibition of the endogenous msiCAT-tailing pathway. (G) Quantification of (F) shows the number of migrated cells (n=3; unpaired Student’s t-test; ***, p<0.001; ****, p<0.0001). (H) TUNEL staining shows that staurosporine (STS, 1 µM)-induced apoptosis is attenuated by ATP5α-AT3 and ATP5α-AT20 expression in GBM cells, using TUNEL-Cy3 as an apoptotic cell indicator and DAPI as a nucleus indicator. (I) Quantification of (H) shows the percentage of TUNEL-positive cells in the population (n=3; unpaired Student’s t-test; ***, p<0.001), using DMSO as the vehicle control. (J) MTT assay indicates an enhanced resistance to temozolomide (TMZ, 150 µM) induced by ATP5α-AT3 and ATP5α-AT20 expression. The TMZ-treated/SF-Ctrl group is used as the control (n=3; unpaired Student’s t-test; ***, p<0.001).
-
Figure 4—source data 1
Numerical source data shown in Figure 4A, B, D, E, G, I, and J.
- https://cdn.elifesciences.org/articles/99438/elife-99438-fig4-data1-v1.xlsx
Figure 4—figure supplement 1
Effect of GS repeat tails on glioblastoma multiforme (GBM) proliferation and migration.
(A) MTT assay indicates no significant change in GBM proliferation upon ATP5α-GS3 and ATP5α-GS20 expression (n=3; unpaired Student’s t-test; **, p<0.01; ns, not significant). (B) Wound healing assay reveals enhanced GBM migration upon ATP5α-AT3 and ATP5α-AT20 expression. (C) Quantification of (B) shows an increased healing rate, indicated by scratch wound coverage at both 24 and 48 hr (n=3; unpaired Student’s t-test; **, p<0.01). (D) Transwell assay reveals no significant alteration in GBM migration upon ATP5α-GS3 and ATP5α-GS20 expression. (E) Quantification of (D) shows the number of migrated cells (n=3; unpaired Student’s t-test; ns, not significant). (F) qRT-PCR reveals no increase in mRNA levels of mitochondrial unfolded protein response genes, as normalized to ACTB as the control (n=4; unpaired Student’s t-test; **, p<0.01; ns, not significant).
-
Figure 4—figure supplement 1—source data 1
Numerical source data shown in Figure 4—figure supplement 1A, C, E, and F.
- https://cdn.elifesciences.org/articles/99438/elife-99438-fig4-figsupp1-data1-v1.xlsx
Figure 4—figure supplement 2
Glioblastoma multiforme (GBM) cells exhibit increased resistance to apoptosis.
(A) TUNEL staining shows that GBM cells are more resistant to staurosporine (STS, 1 µM)-induced apoptosis compared to control cells, using TUNEL-Cy3 as an apoptotic cell indicator and DAPI as a nucleus indicator. (B) Quantification of A shows the percentage of TUNEL-positive cells in the population (n=3; unpaired Student’s t-test; ***, p<0.0001; ****, p<0.0001), using DMSO as the vehicle control. (C) Western blot analysis of PARP shows that GBM cells are more resilient against STS-induced apoptosis at 30, 90, and 180 min posttreatment. Cleaved PARP is used as an apoptosis marker. ACTIN and GAPDH are used as loading controls. Red numbers below each blot represent the ratios of cleaved PARP (c-PARP) to total PARP protein. (D, F) Flow cytometry analysis using Annexin V-FITC/Propidium Iodide (PI) staining shows alterations in apoptosis rates in GBM cells upon ATP5α-AT3, ATP5α-AT20, ATP5α-GS3, and ATP5α-GS20 expression. The apoptotic cell population (Annexin V positive, PI negative) is represented in the fourth quadrant (right lower). (E, G) Quantification of (D, F) shows the percentages of apoptotic cells (n=3; unpaired Student’s t-test; **, p<0.001; ***, p<0.0001).
-
Figure 4—figure supplement 2—source data 1
PDF file containing original western blots for Figure 4—figure supplement 2C, indicating the relevant bands and treatments.
- https://cdn.elifesciences.org/articles/99438/elife-99438-fig4-figsupp2-data1-v1.zip
-
Figure 4—figure supplement 2—source data 2
Original files for western blot analysis shown in Figure 4—figure supplement 2C.
- https://cdn.elifesciences.org/articles/99438/elife-99438-fig4-figsupp2-data2-v1.zip
-
Figure 4—figure supplement 2—source data 3
Numerical source data shown in Figure 4—figure supplement 2B, E, and G.
- https://cdn.elifesciences.org/articles/99438/elife-99438-fig4-figsupp2-data3-v1.xlsx
Figure 5 with 1 supplement
Inhibition of mitochondrial stress-induced protein carboxyl-terminal alanine and threonine tailing (msiCAT-tailing) impedes glioblastoma multiforme (GBM) progression.
(A) Cell viability assay shows greater sensitivity to anisomycin treatment in patient-derived glioblastoma stem cells (GSCs) than control neural stem cells (NSCs) at 48 hr (n=3; unpaired Student’s t-test; **, p<0.001; ****, p<0.0001; compared to controls at the corresponding dose). (B) MTT assay indicates reduced GBM cell proliferation by genetic inhibition of the msiCAT-tailing pathway (n=3; unpaired Student’s t-test; **, p<0.01; ***, p<0.001; ****, p<0.0001, compared to controls at the corresponding time). (C) MTT assay indicates reduced NHA cell proliferation by genetic inhibition of the msiCAT-tailing pathway (n=3; unpaired Student’s t-test; **, p<0.01; ****, p<0.0001, compared to controls at the corresponding time). (D, F) Transwell assay reveals that both genetic (D) and pharmacological (F) inhibition of the msiCAT-tailing pathway hampers the migration of GBM cells but not control cells. (E, G) Quantification of (D, F) showing the number of migrated cells (n=3; unpaired Student’s t-test; ***, p<0.001; ****, p<0.0001; ns, not significant). (H, J) TUNEL staining reveals that both genetic (H) and pharmacological (J) inhibition of the msiCAT-tailing pathway promote staurosporine (STS)-induced apoptosis in GBM cells, utilizing TUNEL-Cy3 as an apoptotic cell marker and DAPI as a nuclear stain. (I, K) Quantification of (H, J) showing the percentage of TUNEL-positive cells in the population (n=3; unpaired Student’s t-test; ****, p<0.0001), using DMSO as the vehicle control. (L) MTT assay shows that pharmacological inhibition of the msiCAT-tailing pathway decreases the resistance of GBM cells to temozolomide (TMZ, 150 µM) treatment (n=3; unpaired Student’s t-test; * p<0.05; **, p<0.01). (M) The neurosphere formation assay shows that reduced spheroid formation, caused by pharmacological inhibition of the msiCAT-tailing pathway, can synergize with TMZ in GBM cells. (N) Quantification of (M) (n=3; unpaired Student’s t-test; **, p<0.01).
-
Figure 5—source data 1
Numerical source data shown in Figure 5A, B, C, E, G, I, K, L, and N.
- https://cdn.elifesciences.org/articles/99438/elife-99438-fig5-data1-v1.xlsx
Figure 5—figure supplement 1
No effect of cycloheximide on glioblastoma multiforme (GBM) apoptosis response.
(A) Caspase-3/7 activity assay shows increased apoptosis in GBM cells caused by anisomycin treatment (n=3; unpaired Student’s t-test; ***, p<0.001; ****, p<0.0001; compared to the control group (DMSO) at the corresponding time). (B, C) Western blot analysis of PARP in anisomycin-treated and cycloheximide-treated glioblastoma stem cells (GSCs) indicates that pharmacological inhibition of the mitochondrial stress-induced protein carboxyl-terminal alanine and threonine tailing (msiCAT-tailing) pathway enhances staurosporine (STS)-induced apoptosis, using ACTIN as a loading control. Red numbers below each blot represent the ratios of cleaved PARP (c-PARP) to total PARP protein. (D, F) Flow cytometry analysis using Annexin V-FITC/Propidium Iodide (PI) staining shows alterations in apoptosis rates in GBM cells upon genetic (D) and pharmacological (F) inhibition of the msiCAT-tailing pathway. The apoptotic cell population (Annexin V positive, PI negative) is represented in the fourth quadrant (right lower). (E, G) Quantification of (D, F) shows the percentages of apoptotic cells (n=3; unpaired Student’s t-test; **, p<0.01; ***, p<0.001; ****, p<0.0001; ns, not significant).
-
Figure 5—figure supplement 1—source data 1
PDF file containing original western blots for Figure 5—figure supplement 1B and C, indicating the relevant bands and treatments.
- https://cdn.elifesciences.org/articles/99438/elife-99438-fig5-figsupp1-data1-v1.zip
-
Figure 5—figure supplement 1—source data 2
Original files for western blot analysis shown in Figure 5—figure supplement 1B and C.
- https://cdn.elifesciences.org/articles/99438/elife-99438-fig5-figsupp1-data2-v1.zip
-
Figure 5—figure supplement 1—source data 3
Numerical source data shown in Figure 5—figure supplement 1A, E, and G.
- https://cdn.elifesciences.org/articles/99438/elife-99438-fig5-figsupp1-data3-v1.xlsx
Figure 6
Impact of msiCAT-tail-modified ATP5α protein on mitochondrial function in glioblastoma multiforme (GBM) cells.
In healthy cells, ATP5α protein, encoded by the nuclear genome, is imported into the mitochondrial matrix via the TOM/TIM complex through co-translational import and incorporated into ATP synthase (left). Conversely, in GBM cells, the CAT-tailed ATP5α protein can either form aggregates near the mitochondrial outer membrane or be imported into the mitochondria. Within the mitochondrial matrix, proteins with shorter CAT-tails readily integrate into ATP synthase, disrupting its functionality. This dysfunction is characterized by a reduced ATP synthesis rate and proton (H+) accumulation, resulting in an elevated mitochondrial membrane potential (ΔΨm). These alterations in ATP synthase ultimately trigger malfunction of the mitochondrial permeability transition pore (MPTP), consequently affecting cell proliferation, migration, and resistance to drug-induced apoptosis (right). Created with BioRender.com.
Tables
Table 1
Differential expression analysis of ribosome-associated quality control (RQC) genes in glioblastoma multiforme (GBM) patients compared to healthy controls.
| Gene | logFC | AveExpr | t | P.Value | adj.P.Val |
|---|---|---|---|---|---|
| RACK1 | 2.224548565 | 9.048113333 | 19.24641934 | 2.62E-57 | 6.69E-56 |
| ASCC3 | 1.738216567 | 2.717246389 | 19.27211713 | 2.05E-57 | 5.27E-56 |
| ASCC1 | 1.689584768 | 4.257915556 | 17.8774401 | 1.20E-51 | 2.18E-50 |
| ASCC2 | 1.471467207 | 4.153399167 | 15.9118075 | 1.43E-43 | 1.68E-42 |
| ABCE1 | 1.32826428 | 3.81695 | 13.79248369 | 4.69E-35 | 3.60E-34 |
| VCP | 1.050066326 | 6.321021667 | 9.828944092 | 2.33E-20 | 9.31E-20 |
| GIGYF2 | 0.985695112 | 3.786421389 | 10.25440005 | 8.00E-22 | 3.41E-21 |
| MAP3K20 | 0.962218073 | 1.863793889 | 8.711292467 | 1.10E-16 | 3.75E-16 |
| PELO | 0.92860628 | 2.2885625 | 10.60122263 | 4.85E-23 | 2.18E-22 |
| KLHDC10 | 0.854921284 | 3.492322222 | 9.064976509 | 8.08E-18 | 2.88E-17 |
| EDF1 | 0.82091202 | 8.444505 | 7.278600017 | 2.12E-12 | 5.94E-12 |
| XRN1 | 0.809119864 | 1.518371111 | 8.54020086 | 3.80E-16 | 1.26E-15 |
| LTN1 | 0.786409776 | 1.9716 | 9.962815742 | 8.14E-21 | 3.32E-20 |
| MKRN1 | 0.769369764 | 5.745359444 | 7.400071791 | 9.65E-13 | 2.74E-12 |
| RCHY1 | 0.652647968 | 4.276126111 | 6.840213538 | 3.40E-11 | 8.93E-11 |
| ZNF598 | 0.62380412 | 4.006663611 | 6.043582081 | 3.76E-09 | 8.90E-09 |
| HBS1L | 0.291107388 | 4.701389722 | 2.72853772 | 0.006672805 | 0.010370549 |
| NEMF | 0.194631373 | 4.566962778 | 2.575063266 | 0.010419695 | 0.015855894 |
| ANKZF1 | –0.436070986 | 4.620298333 | –3.65005718 | 0.000300886 | 0.000525859 |
Appendix 1—key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background (mice) | C57BL/6J mice | Dr. Rongze Olivia Lu | RRID:IMSR_JAX:000664 | |
| Cell line (Homo sapiens) | SVG p12 | ATCC | RRID:CRL-8621 | |
| Cell line (H. sapiens) | SF268 | Dr. Rongze Olivia Lu | RRID:CVCL_1689 | |
| Cell line (H. sapiens) | GL261 | Dr. Rongze Olivia Lu | RRID:CVCL_Y003 | |
| Cell line (H. sapiens) | SB28 | Dr. Rongze Olivia Lu | RRID:CVCL_A5ED | |
| Cell line (H. sapiens) | GSC827 | Dr. Chun-Zhang Yang | Patient-derived | |
| Cell line (H. sapiens) | NSC | Dr. John S Kuo | Human-derived | |
| Cell line (H. sapiens) | NSC26 | Dr. John S Kuo | Human-derived | |
| Cell line (H. sapiens) | GSC33 | Dr. John S Kuo | Patient-derived | |
| Cell line (H. sapiens) | GSC22 | Dr. John S Kuo | Patient-derived | |
| Cell line (H. sapiens) | GSC99 | Dr. John S Kuo | Patient-derived | |
| Cell line (H. sapiens) | GSC105 | Dr. John S Kuo | Patient-derived | |
| Cell line (H. sapiens) | GSC107 | Dr. John S Kuo | Patient-derived | |
| Cell line (H. sapiens) | NHA | Dr. Russell O Pieper | RRID:CVCL_E3G5 | |
| Transfected construct (human) | pLV[CRISPR]-hCas9:T2A:Neo-U6>Scramble [gRNA#1] | Made by VectorBuilder | Cat#: VB240227-1635qjy | Lentiviral construct to express control sgRNA. |
| Transfected construct (human) | pLV[CRISPR]-hCas9:T2A:Neo-U6>hNEMF [gRNA#1579] | Made by VectorBuilder | Cat#: VB900124-2190daq | Lentiviral construct to express human NEMF sgRNA |
| Transfected construct (human) | pLV[Exp]-Bsd-EF1A>ORF_Stuffer | Made by VectorBuilder | Cat#: VB900145-3633yjp | The control lentiviral construct to express target gene |
| Transfected construct (human) | pLV[Exp]-EGFP:T2A:Puro-EF1A>mCherry | Made by VectorBuilder | Cat#: VB010000-9298rtf | The control lentiviral construct to express target gene |
| Transfected construct (human) | pLV[Exp]-Bsd-EF1A>hANKZF1 [NM_001042410.2]/HA | Made by VectorBuilder | Cat#: VB240227-1626epe | Lentiviral construct to express human ANKZF1 gene |
| Transfected construct (human) | pLV[Exp]-mCherry/Neo-EF1A>hANKZF1 [NM_001042410.2] | Made by VectorBuilder | Cat#: VB900124-2193gcv | Lentiviral construct to express human ANKZF1 gene |
| Antibody | Anti-COX4 (Rabbit polyclonal) | Abcam | Cat#: ab209727, RRID:AB_3717302 | WB (1:1000) |
| Antibody | Anti-β-Actin [C4] (Mouse monoclonal) | Santa Cruz | Cat#: sc-47778, RRID:AB_626632 | WB (1:1000) |
| Antibody | Anti-Flag (Mouse monoclonal) | Millipore Sigma | Cat#: F1804, RRID:AB_262044 | WB (1:1000) |
| Antibody | Anti-ANT1/2 (Rabbit polyclonal) | Proteintech | Cat#: 17796-1-AP, RRID:AB_2190358 | WB (1:1000) |
| Antibody | Anti-CypD (Rabbit polyclonal) | Proteintech | Cat#: 15997-1-AP, RRID:AB_2190199 | WB (1:1000) |
| Antibody | Anti-ATP5a (Rabbit polyclonal) | Cell Signaling Technology | Cat#: 18023, RRID:AB_2687556 | WB (1:1000) IF (1:500) |
| Antibody | Anti-PARP1 (Rabbit polyclonal) | Abclonal | Cat#: A0942, RRID:AB_2757470 | WB (1:1000) |
| Antibody | Anti-GAPDH (Rabbit polyclonal) | Abclonal | Cat#: A19056, RRID:AB_2862549 | WB (1:1000) |
| Antibody | Anti-TOMM20 (Mouse monoclonal) | Santa Cruz | Cat#: sc-17764, RRID:AB_628381 | WB (1:1000) IF (1:500) |
| Antibody | Anti-MTCO2 (Rabbit polyclonal) | Proteintech | Cat#: 55070-1-AP, RRID:AB_10859832 | WB (1:1000) IF (1:500) |
| Antibody | Anti-NDUS3 (Mouse monoclonal) | Abcam | Cat#: ab14711, RRID:AB_301429 | WB (1:1000) IF (1:1000) |
| Antibody | Anti-NEMF (Rabbit polyclonal) | Proteintech | Cat#: 11840-1-AP, RRID:AB_2183413 | WB (1:1000) IF (1:500) |
| Antibody | Anti-ANKZF1 (Mouse monoclonal) | Santa Cruz | Cat#: sc-398713, RRID:AB_3094545 | WB (1:1000) IF (1:500) |
| Antibody | Anti-ATP5a (Mouse monoclonal) | Abcam | Cat#: ab14748, RRID:AB_301447 | WB (1:1000) IF (1:500) |
| Antibody | Anti-TOMM20 (Rat monoclonal) | Abcam | Cat#: Ab289670, RRID:AB_3097753 | WB (1:1000) IF (1:500) |
| Antibody | Anti-GFP (Chicken polyclonal) | Abcam | Cat#: Ab13970, RRID:AB_300798 | WB (1:1000) IF (1:500) |
| Antibody | Anti-rabbit HRP (Goat polyclonal) | Invitrogen | Cat#: G21234, RRID:AB_2536530 | WB (1:5000) |
| Antibody | Anti-mouse HRP (Goat polyclonal) | Invitrogen | Cat#: PI31430, RRID:AB_228307 | WB (1:5000) |
| Antibody | Anti-Mouse IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 488 (Goat polyclonal) | Invitrogen | Cat#: A32723, RRID:AB_2633275 | IF (1:300) |
| Antibody | Anti-Rabbit IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa Fluor 633 (Goat polyclonal) | Invitrogen | Cat#: A21071, RRID:AB_2535732 | IF (1:300) |
| Antibody | Anti-Rabbit IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 568 (Goat polyclonal) | Invitrogen | Cat#: A11036, RRID:AB_10563566 | IF (1:300) |
| Recombinant DNA reagent | pcDNA3.1+/C-(K)-DYK-ATP5F1A | Made by GenScript | Clone ID: OHu25769D | Construct to express human ATP5F1A. Available from Wu Lab |
| Recombinant DNA reagent | pcDNA3.1+/C-(K)-DYK-ATP5F1A-AT3 | Made by GenScript | Modified from OHu25769D | Construct to express human ATP5F1A with AT3 tail. Available from Wu Lab |
| Recombinant DNA reagent | pcDNA3.1+/C-(K)-DYK-ATP5F1A-AT20 | Made by GenScript | Modified from OHu25769D | Construct to express human ATP5F1A with AT20 tail. Available from Wu Lab |
| Recombinant DNA reagent | pcDNA3.1+/C-(K)-DYK-ATP5F1A-GS3 | Made by GenScript | Modified from OHu25769D | Construct to express human ATP5F1A with GS3 tail. Available from Wu Lab |
| Recombinant DNA reagent | pcDNA3.1+/C-(K)-ATP5F1A-DYK-GS20 | Made by GenScript | Modified from OHu25769D | Construct to express human ATP5F1A with GS20 tail. Available from Wu Lab |
| Recombinant DNA reagent | pCMV-5×FLAG-β-globin-control | Dr. Hoshino and Dr. Inada | Available from Inada Lab | |
| Recombinant DNA reagent | pCMV-5×FLAG-β-globin-non-stop | Dr. Hoshino and Dr. Inada | Available from Inada Lab | |
| Recombinant DNA reagent | pCMV6-DDK-NEMF (NM_004713) | ORIGENE | Cat#: RC216806L3 | |
| Sequence-based reagent | lonp1_F | Made by GeneWiz | PCR primers | TGCCTTGAACCCTCTCTAC |
| Sequence-based reagent | lonp1_R | Made by GeneWiz | PCR primers | TCTGCTTGATCTTCTCCTCC |
| Sequence-based reagent | mthsp70_F | Made by GeneWiz | PCR primers | ACTCCTCCATTTATCCGCC |
| Sequence-based reagent | mthsp70_R | Made by GeneWiz | PCR primers | ACCTTTGCTTGTTTACCTTCC |
| Sequence-based reagent | hsp60_F | Made by GeneWiz | PCR primers | ACCTGCTCTTGAAATTGCC |
| Sequence-based reagent | hsp60_R | Made by GeneWiz | PCR primers | CAATCCCTCTTCTCCAAACAC |
| Sequence-based reagent | actb_F | Made by GeneWiz | PCR primers | TGTTTGAGACCTTCAACACC |
| Sequence-based reagent | actb_R | Made by GeneWiz | PCR primers | ATGTCACGCACGATTTCC |
| Commercial assay or kit | AGM SingleQuots Supplements | Lonza | Cat#: CC-4123 | |
| Commercial assay or kit | MTT assay kit | Roche | Cat#: 11465007001 | |
| Commercial assay or kit | Seahorse Cell Mito Stress Test kit | Agilent | Cat#: 103010-100 | |
| Commercial assay or kit | NativePAGE Running Buffer Kit | Invitrogen | Cat#: BN2007 | |
| Commercial assay or kit | NativePAGE Sample Prep Kit | Invitrogen | Cat#: BN2008 | |
| Commercial assay or kit | TUNEL assay | ApexBio | Cat#: K1134 | |
| Commercial assay or kit | Annexin V-FITC/PI apoptosis assay | BioLegend | Cat#: 640914 | |
| Commercial assay or kit | Seahorse XF DMEM medium | Agilent | Cat#: 103575-100 | |
| Commercial assay or kit | Mitochondrial Transition Pore Assay | Invitrogen | Cat#: I35103 | |
| Chemical compound, drug | DMEM | ATCC | Cat#: 302002 | |
| Chemical compound, drug | FBS | Biowest | Cat#: S1620-100 | |
| Chemical compound, drug | Penicillin/streptomycin | Gibco | Cat#: 15140122 | |
| Chemical compound, drug | G418 | Gibco | Cat#: 10131027 | |
| Chemical compound, drug | 0.25% trypsin solution | ATCC | Cat#: SM2003C | |
| Chemical compound, drug | ABM Basal Medium | Lonza | Cat#: CC-3187 | |
| Chemical compound, drug | Accutase | Corning | Cat#: 25058CI | |
| Chemical compound, drug | Neural basal-A Medium | Gibco | Cat#: 10888022 | |
| Chemical compound, drug | B27 | Gibco | Cat#: 17504044 | |
| Chemical compound, drug | N2 | Gibco | Cat#: 17502048 | |
| Chemical compound, drug | EGF and FGF | Shenandoah Biotech | Cat#: PB-500-017 | |
| Chemical compound, drug | Antibiotic-Antimycotic | Gibco | Cat#: 15240062 | |
| Chemical compound, drug | L-Glutamine | Gibco | Cat#: 250300810 | |
| Chemical compound, drug | Geltrex | Thermo Fisher | Cat#: A1413202 | |
| Chemical compound, drug | X-tremeGENE | Sigma | Cat#: 6366244001 | |
| Chemical compound, drug | Anisomycin | Fisher Scientific | Cat#: AAJ62964MF | |
| Chemical compound, drug | Cycloheximide | Fisher Scientific | Cat#: AC357420010 | |
| Chemical compound, drug | Temozolomide | Millipore Sigma | Cat#: 50-060-90001 | |
| Chemical compound, drug | Formaldehyde | Thermo Fisher | Cat#: BP531-500 | |
| Chemical compound, drug | Triton X-100 | Thermo Fisher | Cat#: T9284 | |
| Chemical compound, drug | Lipofectamine 3000 | Invitrogen | Cat#: L3000015 | |
| Chemical compound, drug | Normal goat serum | Jackson Immuno | Cat#: 005-000-121 | |
| Chemical compound, drug | DAPI | Thermo Fisher | Cat#: 57-481-0 | |
| Chemical compound, drug | Fluoromount-G Anti-Fade | Southern Biotech | Cat#: 0100-35 | |
| Chemical compound, drug | Puromycin | ARCOS organics | Cat#: 227420100 | |
| Chemical compound, drug | Protease inhibitor | Bimake | Cat#: B14002 | |
| Chemical compound, drug | Bradford | BioVision | Cat#: K813-5000-1 | |
| Chemical compound, drug | Mannitol | Fisher Scientific | Cat#: AA3334236 | |
| Chemical compound, drug | Sucrose | Fisher Scientific | Cat#: AA36508A1 | |
| Chemical compound, drug | HEPES | Fisher Scientific | Cat#: 15630106 | |
| Chemical compound, drug | Western Lightning Plus-ECL | PerkinElmer Inc | Cat#: NEL104001EA | |
| Chemical compound, drug | 4–12% Tris-Glycine gel | Invitrogen | Cat#: WXP41220BOX | |
| Chemical compound, drug | PVDF membrane | Millipore | Cat#: ISEQ00010 | |
| Chemical compound, drug | EGTA | Fisher Scientific | Cat#: 28-071G | |
| Chemical compound, drug | Digitonin | Thermo Fisher | Cat#: BN2006 | |
| Chemical compound, drug | G-250 | GoldBio | Cat#: C-460-5 | |
| Chemical compound, drug | 3–12% Bis-Tris Native gel | Invitrogen | Cat#: BN1001BOX | |
| Chemical compound, drug | Acetic acid | Thermo Fisher | Cat#: 9526-33 | |
| Chemical compound, drug | TMRM | Invitrogen | Cat#: I34361 | |
| Chemical compound, drug | JC-10 | AdipoGen | Cat#: 50-114-6552 | |
| Chemical compound, drug | Succinate | Thermo Fisher | Cat#: 041983.A7 | |
| Chemical compound, drug | Hank’s Balanced Salt Solution | Thermo Fisher | Cat#: 14025092 | |
| Chemical compound, drug | Calcium Green-5N | Invitrogen | Cat#: C3737 | |
| Chemical compound, drug | Cyclosporine A | Thermo Fisher | Cat#: AC457970010 | |
| Chemical compound, drug | Ethanol | Thermo Fisher | Cat#: R40135 | |
| Chemical compound, drug | Crystal violet | Sigma | Cat#: V5265 | |
| Chemical compound, drug | Proteinase K | Invitrogen | Cat#: 25530049 | |
| Chemical Compound, drug | Caspase-3/7 detection reagents | Invitrogen | Cat#: C10432 | |
| Chemical compound, drug | ATP-red dye | Millipore | Cat#: SCT045 | |
| Chemical compound, drug | MitoTracker-Green | Invitrogen | Cat#: M7514 | |
| Chemical compound, drug | Protein A/G magnetic beads | Pierce | Cat#: 88802 | |
| Chemical compound, drug | M.O.M. blocking reagent | Vector Laboratories | Cat#: BMK-2202 | |
| Software, algorithm | SPSS | SPSS | RRID:SCR_002865 | |
| Software, algorithm | GraphPad Prism 9.4.1 | GraphPad | RRID:SCR_002798 | https://www.graphpad.com/scientific-software/prism/ |
| Software, algorithm | ImageJ 1.53t | NIH | RRID:SCR_003070 | https://imagej.nih.gov/ij/download.html |
| Software, algorithm | ZEN (blue edition) | ZEISS | RRID:SCR_013672 | https://www.zeiss.com/microscopy/us/products/microscope-software.html |
| Software, algorithm | Gen5 | Agilent Technologies (BioTek) | RRID:SCR_017317 | https://www.biotek.com/products/software-robotics-software/gen5-microplate-reader-and-imager-software/ |
| Software, algorithm | Endnote 20 | Clarivate | RRID:SCR_014001 | https://endnote.com/downloads |
Additional files
Download links
A two-part list of links to download the article, or parts of the article, in various formats.
Downloads (link to download the article as PDF)
Open citations (links to open the citations from this article in various online reference manager services)
Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)
Mitochondrial protein carboxyl-terminal alanine-threonine tailing promotes human glioblastoma growth by regulating mitochondrial function
eLife 13:RP99438.
https://doi.org/10.7554/eLife.99438.4
