Impact of maximal overexpression of a non-toxic protein on yeast cell physiology
- Graduate School of Environmental, Life, Natural Science and Technology, Okayama University, Japan
- National Institute for Basic Biology, Japan
- Graduate University for Advanced Studies (SOKENDAI), Japan
- Faculty of Environmental, Life, Natural Science and Technology, Okayama University, Japan
Figures
Figure 1
Schematic diagrams illustrating the constraints on protein expression levels.
(A) Protein expression levels were determined by demand and constraints (created by the authors, inspired by the work by Keren et al., 2016). The existence of this evolutionary principle is revealed by the relationship between fitness (growth rate) and expression level when the expression level is altered, and in general, the native expression level provides the highest level of fitness for the organism (Bruggeman et al., 2020). The existence of constraints is revealed by a decrease in fitness upon overexpression (red arrow). Constraints determine the expression limit of the protein, that is the expression level at which growth inhibition occurs (dotted lines), but there can be multiple constraints for a single protein. The constraint that exists at the highest expression limit is protein burden. (B) Four major mechanisms that constrain protein expression levels. The figure outlines the fate of proteins and shows what adverse effects occur upon overexpression (red arrows). The resource overload that occurs within the synthesis process (transcription and translation) is specifically referred to as protein burden. This diagram is a more concise redrawing of the author’s earlier one (Moriya, 2015). That asterisk means differentially localized proteins. (C) A barrel model for resource overload (modified from the author’s earlier one) (Kintaka et al., 2020). The size of the barrels represents the capacity of each process, and the arrows represent the fate of the proteins processed there. The expression limit of a protein is defined by the lowest-capacity process that processes the protein. Among these processes, synthesis, which processes all proteins, is considered to have the largest capacity. Thus, proteins processed only by synthesis would have the highest expression limits, and their overexpression would overload synthesis (i.e. cause protein burden). Previous studies by the authors, conducted in this context, estimated that protein burden occurs at more than 15% of total protein (Eguchi et al., 2018). (D) Difference in burden due to gene structure (codon optimization). The amount of transcription required to achieve the same protein expression limit depends on the degree of codon optimization. This may change whether transcription or translation results in a higher burden. (E) An ideal framework for protein burden studies. See text for details.
Figure 2 with 10 supplements
Evaluation of expression constraint (or neutrality) of fluorescent proteins.
(A) Experimental setup of the analysis. Target proteins were expressed under the control of the TDH3 promoter (TDH3pro) using the multicopy plasmid pTOW40836. The cells were pre-cultured under –Ura conditions, and then cultured in –LeuUra conditions. (B) Growth curves of the vector control and cells overexpressing FPs and their mutants in synthetic medium (–LeuUra). The solid or dotted lines show the average calculated from three biological replicates. Growth curves with the standard deviations (SD) of replicates are shown in Figure 2—figure supplement 2. (C) MGR of cells overexpressing FPs and their mutants (percent over the vector control). (D) Gel images of SDS-PAGE-separated proteins extracted from cells overexpressing FPs. All proteins were separated after staining with a fluorescent dye. (E) Protein level of the target protein (percent over the total protein). The amount was calculated from the intensity of the target bands separated by SDS-PAGE of D. See Figure 2—figure supplement 1B for the method of FP and total protein quantification. Note that EGFP-YG and mCherry may not be accurately measured due to dimerization and cleavage of the protein, respectively. (F) Relationship between MGR and the protein level. MGR data are the same as in C, and the protein level data are the same as in E. The neutrality indexes (NIs), calculated from the products of MGR and protein levels, are indicated by the lines. If the investigated proteins have the same NI, they are located on the same dotted line segment. (G) The neutrality index for the FPs and mutants. The neutrality index is the product of %MGR (/Vector) and %protein level (/total protein). The bars and error bars in C, E, and G show the means and SDs calculated from three biological replicates. The raw data is shown with dot plots.
-
Figure 2—source data 1
Original files for SDS-PAGE analysis displayed in Figure 2D, Figure 2—figure supplement 5C, Figure 2—figure supplement 7G, Figure 2—figure supplement 8B, and Figure 2—figure supplement 10D and H.
- https://cdn.elifesciences.org/articles/99572/elife-99572-fig2-data1-v1.zip
Figure 2—figure supplement 1
Methods used for overexpression and protein expression quantification.
(A) The genetic tug-of-war (gTOW) method. See Materials and methods for details. (B) Protein quantification method. All proteins present in the cells were labeled with a fluorescent dye (Ezlabel FluoroNeo) and separated by SDS-PAGE. The protein level of the target protein (Protein level) was calculated by subtracting the band at the same position of the vector control (Orange) from the band of the target protein on the gel (Purple), which was estimated from the molecular weight, and dividing the result by the total protein (Green). Other protein (Other protein level) was calculated by subtracting Protein level (%) from the value obtained by normalizing the total protein (Green) of the overexpression strain by the total protein (Red) of the vector control.
Figure 2—figure supplement 2
Comparison of growth of fluorescent protein overexpressing strains.
Growth curves of the cells with the vector (pTOW40836) and the cells overexpressing fluorescent proteins and their non-fluorescent YG mutants in synthetic medium (–LeuUra). The solid or dotted lines show the average calculated from three biological replicates. Shaded zones indicate their standard deviations. (A) EGFP and EGFP-YG, (B) sfGFP and sfGFP-YG, (C) moxGFP (mox) and mox-YG, (D) mCherry (mChe) and mChe-YG.
Figure 2—figure supplement 3
Neutrality indexes of constrained proteins.
(A) MGRs of cells overexpressing indicated proteins. (B) Protein levels of the indicated target proteins (percent over the total proteins). (C) The neutrality index for the indicated proteins. MTS3–EGFP: EGFP targeted to mitochondria; cultured in SC–LeuUra; expressed by the PYK1 promoter. NES–EGFP: EGFP with nuclear export signal; cultured in SC–Ura; expressed by the HXT7 promoter. ss–moxGFP: moxGFP targeted to the endoplasmic reticulum; cultured in SC–Ura; expressed by the PYK1 promoter. EGFP_K: the EGFP result of Kintaka et al., 2016; cultured in SC–LeuUra; expressed by the PYK1 promoter. EGFP_F: the EGFP result of this paper. In A and B, the data was obtained from Kintaka et al., 2016, except mox-YG and EGFP_F (same as Figure 2 in this paper). The bars and error bars show the means and SDs calculated from three biological replicates.
Figure 2—figure supplement 4
Base and amino acid sequences of moxGFP and sfGFP.
Amino acids relevant to the text are shown in red.
Figure 2—figure supplement 5
Comparative evaluation of mCherry (mCherry-Kafri) used in previous studies and this study.
(A) Growth curves of cells overexpressing WT and YG mutants of mCherry used in Kafri et al., 2016 in synthetic medium (–LeuUra). The solid or dotted lines show the average calculated from three biological replicates. (B) Ratio of MGR of cells overexpressing FPs and their mutants over the vector control. (C) Gel images of SDS-PAGE-separated proteins extracted from cells overexpressing FPs. All proteins were separated after staining with a fluorescent dye. (D) Protein level of the target protein (percent over the total protein). The amount was calculated from the intensity of the target bands separated by SDS-PAGE of D. Note that mChe may not be accurately measured due to molecular cleavage of the protein. (E) Relationship between MGR and the protein level. MGR data are the same as in B, and the protein level data are the same as in D. The neutrality indexes (NIs), calculated from the products of MGR and %protein levels, are indicated by the lines. If the investigated proteins have the same NI, they are located on the same dotted line segment. (F) The neutrality index for the FPs and mutants. The neutrality index is the product of %MGR (/Vector) and %protein level (/total protein). The bars and error bars in B, D, and F show the means and SDs calculated from three biological replicates. The raw data is shown with dot plots.
Figure 2—figure supplement 6
Overexpression of mox-YG does not cause cell enlargement or burden on transcription.
(A) Representative microscopic images of cells overexpressing indicated target proteins or moxFS (a frameshift mutant of mox). (B) Violin plots showing the cell size quantified from microscopic images. The number of cells used for the quantification is shown. (C) Growth curves of the vector control and cells overexpressing moxFS and mox-YG in synthetic medium (–LeuUra). The solid or dotted lines show the average calculated from three biological replicates. (D) MGR of cells overexpressing moxFS and mox-YG (percent over the vector control). The bars and error bars show the means and SDs of the MGR calculated from three biological replicates. The raw data is shown with dot plots. The p-value of Welch’s t-test is shown. n.s: not significant.
Figure 2—figure supplement 7
Phototoxicity is not the constraint of mox expression.
(A) Growth curves of the vector control and cells overexpressing mox and mox-YG grown under room light or in the dark (Dark) in synthetic medium (–LeuUra). The solid or dotted lines show the average calculated from three biological replicates. (B) Protein level of mox and mox-YG (percent over the total protein) under room light or in the dark (Dark) in synthetic medium (–LeuUra). (C) Experimental setup for the cultivation of cells under strong light. Strong light was irradiated using a halogen lighting source (Megalight 100, HOYA-SCHOTT). Among the three cultures of cells overexpressing mox and mox-YG, culture #3 was closest to the light, followed by #2 and #1 in decreasing order. Cells were cultured in SC–LeuUra medium. Note that the light does not affect the OD660 measurement itself in this setup. (D) Growth curves of the cells overexpressing mox and mox-YG grown under the strong light. Growth curves of cells at the positions (#1, #2, and #3) in C are shown. (E) Color of the culture of cells overexpressing mox cultivated at the positions in C. The photo was taken after 40 hr cultivation. (F) Fluorescence microscopy images of the cells cultivated under strong light. The cells were cultivated at the position in C for 40 hr. (G) Gel images of SDS-PAGE-separated proteins extracted from cells overexpressing mox and mox-YG cultured under the light. Cells were cultured at the position in C to OD660=1 and analyzed. All proteins were separated after staining with a fluorescent dye. (H) Protein level of mox and mox-YG level in G (percent over the total protein).
Figure 2—figure supplement 8
Effect of Tyr and oxidative stress on the expression limits of mox and mox-YG.
(A) Growth curves of cells with the vector (Vector) and overexpressing mox, mox-YG, and mox-YG with one Tyr added to the C-terminal (mox-YG +Y) (n=1 for each). (B) Gel images of SDS-PAGE-separated proteins extracted from cells overexpressing FPs. All proteins were separated after staining with a fluorescent dye. (C–E) Quantification of MGR (C), the protein level (D), and the neutrality index (E) of cells overexpressing mox (FP), mox-YG (Y66G), and mox-YG +Y (Y66G+Y). The MGR was calculated from the growth curve in A. The protein level was calculated from the band in B. The neutrality index was calculated as the product of %MGR in C and the %protein level in D. The results for n=1 are shown. (F, G) Growth curves of the vector control (Vector) and cells overexpressing mox and mox-YG in synthetic medium (F) and medium with 2 mM H2O2 (G). Solid or dotted lines indicate mean values calculated from three biological replicates. (H) Passing point when the time for Vector, mox, and mox-YG overexpressing cell cultures to reach OD660=1 (the intersection of the dotted line in F and G with the respective growth curves).
Figure 2—figure supplement 9
Overexpressed mox-YG does not show any specific localization.
Fluorescence microscopy images of the cells with the vector (Vector) and overexpressing mox and mox-YG in a strain expressing a GFP-binding protein (GBP) fused to mScarlet-I under the control of ACT1 promoter.
Figure 2—figure supplement 10
Mutational analysis of mox.
(A, B) Curves representing time series data of cell growth (gray, OD595) and GFP fluorescence (green) overexpressing mox and mox-T203I mutant in the synthetic medium (–LeuUra). Solid lines are means calculated from eight biological replicates. (C) Bar graph comparing the maximum value of GFP fluorescence obtained from the GFP fluorescence curves shown in A and B. GFP fluorescence values for the vector control and mox-YG overexpressing cells were also shown as controls. Average values, SD, and p-values of Welch’s t-test were calculated from eight biological replicates. (D) Gel images of SDS-PAGE-separated proteins extracted from cells overexpressing modified GFP. All proteins were separated after staining with a fluorescent dye. (E) MGR of cells overexpressing modified moxGFP and their mutants (percent over the vector control). (F) Protein levels of the mox variants (percent over the total protein). The amount was calculated from the intensity of the target bands separated by SDS-PAGE of D. (G) The neutrality index for the modified GFP. The neutrality index was calculated as the product of the %MGR in E and the %protein level in F. (H) Gel images of SDS-PAGE-separated proteins extracted from cells overexpressing mox-T65S mutant and mox of WT. All proteins were separated after staining with a fluorescent dye. (I) Protein levels of mox-T65S mutant and mox (percent over the total protein). The amount was calculated from the intensity of the target bands separated by SDS-PAGE of H. The bars and error bars in E, F, G, and I show the means and SDs calculated from three biological replicates, except the T203I mutant (n=2). The raw data is shown with dot plots.
Figure 3 with 3 supplements
Transcriptional response of mox and mox-YG overexpression.
(A) Comparison of transcriptional responses of mox and mox-YG overexpression. Genes that showed common or different transcriptional responses in mox and mox-YG overexpression are shown in indicated colors. Genes that showed characteristic responses are also shown. FDR: false discovery rate. r: Pearson correlation coefficient. (B) Gene groups that showed significant transcriptional changes. Among the KEGG orthology level 3 categories, gene groups in the category that were significantly up-regulated or down-regulated (FDR <0.05) in mox or mox-YG overexpression are shown in the violin plots. Genes with significant expression changes (FDR <0.05) within the same category are shown by swarm plots. Asterisks indicate significant differences (FDR <0.05) between mox and mox-YG comparisons in gene groups belonging to the same category. Comparisons for all categories are shown in Figure 3—figure supplement 1C. (C) Expression changes in representative amino acid, ammonium, and glucose transporters. (D) Verification of promoter activity by the reporter assay. Constructs used for promoter analysis with transcription reporters and quantitative results of RFP fluorescence values (arbitrary unit) for each promoter. ‘moxFS’ means the frameshift mutant of mox-YG is overexpressed. Bars and error bars indicate the mean and SD of maximum fluorescence values for RFP calculated from four biological replicates. Raw data are shown as dot plots. The p-values were calculated by performing Welch’s t-test and applying Bonferroni correction. ‘n.s.’ means p>0.05. Detailed constructs and time series data for promoters other than those shown here are in Figure 3—figure supplement 2.
Figure 3—figure supplement 1
Comparison of the transcriptional response of mox and mox-YG overexpressing cells.
(A, B) Transcriptome changes in mox (A) and mox-YG (B) overexpressing cells. Significantly altered ORFs (FDR <0.05) compared to the vector control are shown in red. The number of ORFs that were significantly increased and decreased is shown. (C) Violin plots showing transcriptome results for each category of KEGG orthology level 3. Categories that were significantly up or down-regulated (FDR <0.05) are indicated by red violin plots. Genes that showed significant expression changes (FDR <0.05) within the same category are indicated by swarm plots. Asterisks indicate significant differences (FDR <0.05) between mox and mox-YG comparisons for groups of genes in the same category.
Figure 3—figure supplement 2
Verification of promoter activity by the reporter assay.
(A) The constructs used for promoter analysis by the transcriptional reporter included a sequence of RFP (mScarlet-I) behind each promoter, a terminator for TDH3, and a sequence incorporating spHIS5MX as a selection marker, which was integrated into the genomic FCY1 locus. ‘moxFS’ means the frameshift mutant of mox-YG is overexpressed. (B) Curves representing time series data of cell growth (gray, OD595) and mScarlet-I fluorescence (red, arbitrary unit) overexpressing mox-YG and moxFS in SC–LeuUra medium for each promoter. Solid lines are averages calculated from four biological replicates. (C) Quantitative results of mScarlet-I fluorescence values for each promoter. Bars and error bars indicate the mean and SD of maximum fluorescence values (arbitrary unit) for mScarlet-I calculated from four biological replicates. Raw data are shown as dot plots. The p-values were calculated by performing Welch’s t-test and applying the Bonferroni correction. ‘n.s.’ means p>0.05.
Figure 3—figure supplement 3
Depletion of leucine in the gTOW experiment does not induce the GAP1 promoter.
(A) Reporter assay of the GAP1 promoter in media with different concentrations of leucine. Curves representing time series data of cell growth (gray, OD595) and mScarlet-I fluorescence (red, arbitrary unit) overexpressing mox-YG. Solid lines are averages calculated from four biological replicates. (B) Quantification of the maximum growth rate (MGR) and maximum RFP fluorescence derived from the results in A. Bar graphs indicate the mean maximum RFP fluorescence, and error bars represent the SD. Line graphs indicate the MGR, with error bars representing SD. Means and SDs were calculated from four biological replicates. (C) Scatter plots of maximum fluorescence values and MGRs created using the values in B. Note that GAP1 induction was observed only in mox-YG overexpression, even under conditions where the MGR was reduced to around three due to leucine depletion (the dotted line).
Figure 4 with 9 supplements
Overexpression of mox-YG causes a proteome response like that of TORC1 inactivation.
(A) Ratio of the total protein level over the vector control. The colored area indicates the amount of overexpressed protein. The amount was calculated from the intensity of the target bands separated by SDS-PAGE. Bars and error bars indicate the mean and SD of protein levels calculated from three biological replicates. The p-values were calculated by performing Welch’s t-test and applying Bonferroni correction. ‘n.s.’ means p>0.05. (B) Visualization of the proteome of the vector control and mox-YG overexpressing cells using Proteomaps (Liebermeister et al., 2014). Each polygon represents the mass fraction of the protein within the proteome. Similar colors indicate similar or closely related pathways and proteins. (C) Violin plots showing groups of genes in the KEGG orthology level 3 category whose expression was increased or decreased by mox-YG overexpression. Gene groups with significantly altered expression (FDR <0.05) in mox-YG overexpression are shown in red. Genes with significant expression changes (FDR <0.05) within the same category are shown by swarm plots. ‘+’ and ‘–’ indicate the categories with significantly increased or decreased expression, respectively, when separated into Rapamycin-responsive (Rap) and Rapamycin-non-responsive (Non-Rap) gene populations. Comparisons for all categories are shown in Figure 4—figure supplement 6A, B. Published data (Gowans et al., 2018) was used for comparison with the rapamycin response genes. (D) Fluorescence microscopy image showing the localization of Rip1-mScarlet-I. The vector control and mox-YG overexpressing cells were observed in the log phase. Stationary phase cells, bright-field images, quantitative results, and statistical analyses are shown in Figure 4—figure supplement 8. (E) Oxygen consumption rate in vector control and mox-YG overexpressing cells (arbitrary units, AU). Antimycin A was added as a control for respiratory inhibition. Measurements were conducted with three biological replicates. Bars and error bars indicate the mean and SD from three biological replicates. Raw data are shown as dot plots. The p-values were calculated by performing Welch’s t-test and applying Bonferroni correction. ‘n.s.’ indicates p>0.05. The measurement data are shown in Figure 4—figure supplement 9.
Figure 4—figure supplement 1
Change in total protein levels upon overexpression of target proteins.
Ratio of total protein content of cells overexpressing FPs over the vector control. Gray bars and error bars indicate expression levels and SDs for proteins other than FPs; non-gray bars and error bars indicate expression levels and SDs for each overexpressed protein. The mean and SD are calculated from three biological replicates. The p-values were calculated by performing Welch’s t-test and applying Bonferroni correction. ‘n.s.’ means p>0.05.
Figure 4—figure supplement 2
Evaluation of expression constraint of fluorescent proteins under nutrient-rich medium.
(A) Experimental setup of the analysis. Target proteins were expressed under the control of the TDH3 promoter (TDH3pro) using the multicopy plasmid pTOW-AUR1d. This plasmid uses the aureobasidin resistance gene AUR1d, which has a short promoter region, replacing the leu2–89 used in the plasmid shown in Figure 2A. (B) Growth curves of the vector control and cells overexpressing FPs in YPD included 500 ng/mL aureobasidin A. The solid or dotted lines show the average calculated from three biological replicates. Shaded zones indicate their standard deviations. (C) Gel images of SDS–PAGE-separated proteins extracted from cells overexpressing FPs. All proteins were separated after staining with a fluorescent dye. (D) Ratio of total protein content of cells overexpressing FPs over the vector control in YPD added aureobasidin A and SC–LeuUra. Gray bars and error bars indicate expression levels and SDs for proteins other than non-gray bars and error bars, which indicate expression levels and SDs for each overexpressed protein. The mean and SD are calculated from three biological replicates. The p-values were calculated by performing Welch’s t-test.
-
Figure 4—figure supplement 2—source data 1
Original files for SDS-PAGE analysis displayed in Figure 4—figure supplement 2C.
- https://cdn.elifesciences.org/articles/99572/elife-99572-fig4-figsupp2-data1-v1.zip
Figure 4—figure supplement 3
Comparison of normalized or not-normalized proteome results.
(A) Bar graph showing the sum of signals for each gene detected by proteome analysis. Black or light gray bars indicate the sum of signals other than mox-YG, and green-shaded bars indicate mox-YG signals. The error bar indicates the SD calculated from three biological replicates. (B) Volcano plot of proteome results excluding proteins not detected in either condition. (C) Volcano plot of B’s results normalized so that the sum of mox-YG signals equals the sum of the vector control signals. Significantly changed proteins (FDR <0.05) are shown in red. The number of genes whose expression decreased or increased during mox-YG overexpression compared to the vector control is indicated in the upper left or upper right of the graph. (D) Comparison of proteome and transcriptome changes in cells overexpressing mox-YG. The transcriptome data used are the same as those in Figure 3—figure supplement 1B, and the proteome data are the same as those in B. The Pearson correlation coefficient (r) is shown.
Figure 4—figure supplement 4
Violin plots showing groups of proteins whose expression was changed by mox-YG overexpression.
Protein groups with significantly altered expression (FDR <0.05) upon mox-YG overexpression over the vector control are shown in red violin plots. Proteins with significant expression changes (FDR <0.05) within the same category are shown by swarm plots.
Figure 4—figure supplement 5
Cells overexpressing mox-YG exhibit proteomic changes that overlap with those observed in rapamycin-treated cells.
(A) Volcano plots showing genes whose expression levels were altered by rapamycin treatment in the proteome results of mox-YG overexpressing cells. (B) Venn diagram representing the overlap of the proteome during mox-YG overexpression and rapamycin treatment. The number of genes in each area is shown. Published data (Gowans et al., 2018) was used for comparison with the rapamycin response genes.
Figure 4—figure supplement 6
Comparison of groups of proteins whose expression levels are changed by mox-YG overexpression and rapamycin treatment.
(A, B) Violin plots showing protein expression changes upon mox-YG overexpression for each KEGG ontology level 3 category. Plots with red borders represent categories that changed significantly (FDR <0.05). Proteins with significantly (FDR <0.05) altered expression within a category are shown in the swarm plot. The left side of the violin plot shows the analysis with all the data. The right side of the plot shows the analysis with only rapamycin-responsive protein (A) and rapamycin-non-responsive protein (B). (C) Bar graph showing the results for proteins in the ‘Oxidative phosphorylation’ category. Proteins whose expression is also increased during rapamycin treatment (Rap-up) are marked.
Figure 4—figure supplement 7
Assessment of TORC1 pathway activity in mox-YG overexpressing cells.
(A, B) Growth curves of the vector control (A) or mox-YG overexpressing (B) cells under different rapamycin concentrations. The solid lines show the average calculated from four biological replicates. (C, D) Max growth rate of the vector control (C) or mox-YG overexpressing (D) cells under different rapamycin concentrations. The bars and error bars show the means and SDs of the MGR calculated from four biological replicates. The p-values were calculated by performing Welch’s t-test. (E) Line graph showing the change in MGR with increasing rapamycin concentration, using 0 ng/mL of rapamycin concentration as reference. Rapamycin concentrations with significant differences (p<0.05) between the vector control and mox-YG are marked with * above the mox-YG marker. The p–values were calculated by performing Welch’s t-test. In the vector control, the addition of 100 ng/mL rapamycin caused significant growth inhibition, whereas in mox-YG overexpressing cells, the inhibitory effect was limited. This highlights a decreased sensitivity to rapamycin in mox-YG overexpressing cells. (F) Detection of Atg13 phosphorylation in the vector control and mox-YG overexpressing cells cultured in SC–LeuUra medium to the indicated optical density (OD660). Total protein was visualized by ponceau S staining (left), and Atg13 was detected by western blotting using an anti-Atg13 antibody (right). Atg13 phosphorylated by TORC1 appears as a broad band (indicated by a line).
-
Figure 4—figure supplement 7—source data 1
Original files for SDS-PAGE analysis displayed in Figure 4—figure supplement 7F.
- https://cdn.elifesciences.org/articles/99572/elife-99572-fig4-figsupp7-data1-v1.zip
Figure 4—figure supplement 8
Observation of mitochondria in mox-YG overexpressing cells.
(A) Fluorescence microscopy image showing the localization of Rip1-mScarlet-I. The vector control and mox-YG overexpressing cells were observed in the log phase and stationary phase. The upper panel is a bright-field (BF) image, and the lower panel is a merged image of the BF and fluorescence images. (B) Violin plots showing the quantified fluorescence values of Rip1-mScarlet-I from fluorescence microscopy images taken in the log phase and stationary phase. The number (n) of observed cells is shown. The p-values were calculated by Welch’s t-test.
Figure 4—figure supplement 9
Time-course analysis of oxygen consumption in mox-YG overexpressing cells.
(A, B) Line graphs showing changes in the fluorescence of an oxygen-sensitive probe, measured in synthetic medium (A) and in medium containing 50 µM antimycin A (B). Solid lines represent the mean values from three biological replicates; Error bars indicate standard deviations.
Figure 5 with 6 supplements
mox-YG overexpression causes abnormal nucleolus formation.
(A) 3D structure of the ribosome. PDB model 6GQV (Pellegrino et al., 2018) is used for the base model and colored using ChimeraX software (Meng et al., 2023). Ribosomal proteins with increased expression upon mox-YG overexpression are shown with the named structures containing them. See also Figure 5—figure supplement 1 for the quantitative data. (B) Electron microscope images of the vector control and mox-YG overexpressing cells. The arrow in the image points to the nucleolus structure. N: nucleus. Images of other observed cells are shown in Figure 5—figure supplement 3. (C, D) Model diagrams showing the hypothetical situation of the wild type (C) and mox-YG overexpressing cells (D). In WT cells, enough ribosomal proteins (RPs) are produced, resulting in RP-assembled rRNAs and the formation of nucleolus with normal morphology. On the other hand, in mox-YG overexpressing cells, the amount of RP is reduced due to translation competition, increasing misassembled rRNA. As a result, degradation of rRNA by exosomes may be accelerated, resulting in abnormal nucleolus morphology. (E) Growth curves of WT and mtr4-1 mutant cells with the vector control or upon overexpression of mox-YG at 30 °C. The solid or dotted lines show the average calculated from three biological replicates. Growth curves with SDs of replicates are shown in Figure 5—figure supplement 5A. (F) Ratio of total protein levels of WT and mtr4-1 strains with the vector or upon mox-YG overexpression, calculated the total protein level of WT cells with the vector as 100%. Gray bars indicate expression levels of proteins other than mox-YG; green shaded bars indicate mox-YG expression levels. Error bars were SDs calculated from three biological replicates. The p-values were calculated by performing Welch’s t-test. ‘n.s.’ means p>0.05. (G) Fluorescence microscopy image of nucleolus-localized protein Nsr1-mScarlet-I of the WT and mtr4-1 mutant cells with the vector or mox-YG overexpression. Bright field and merged images, and quantification of the nucleolus size are shown in Figure 5—figure supplement 5D and E. (H) Growth curves of the cells with the vector or under mox-YG overexpression cultivated at 30 °C or 38 °C. The solid or dotted lines show the average calculated from three biological replicates. Growth curves with SDs of replicates are shown in Figure 5—figure supplement 6A. (I, J) Final OD of the cell culture with or without 1 M sorbitol at 30 °C (I) or 38 °C (J). The bars and error bars show the means and SDs calculated from three biological replicates. The red dotted line indicates the final OD estimated from the product of (mox-YG without sorbitol) / (Vector without sorbitol) and (Vector with sorbitol) / (Vector without sorbitol). Growth curves with SDs of replicates are shown in Figure 5—figure supplement 6C, D.
Figure 5—figure supplement 1
Expression changes of ribosomal proteins upon mox-YG overexpression.
Bar graphs show the changes in the expression of ribosomal proteins in the proteome analysis of Figure 4. Significantly changed proteins are boxed in red. Structure names containing increased proteins are shown. Note that when the amino acid sequences of paralogs are identical, they cannot be distinguished by proteomic analysis, and the protein abundance of both members of the paralog pair is represented under the name of only one.
Figure 5—figure supplement 2
Microscopic analysis of the cells under mox-YG overexpression.
(A) Electron microscopic images of the cells with the vector or under mox-YG overexpression. The white rectangular area in each left image is magnified to show the cytoplasmic density (shown in each right image). (B) Fluorescence microscopy image showing the size of nucleolus with Nsr1-EGFP. Log phase cells (OD660=1.0) with the vector or under mox-YG overexpression were observed. (C, D) Quantification of the size of Nsr1-GFP fluorescent region (C) and fluorescence value of Nsr1-GFP (D) in the cells with the vector or mox-YG overexpression. The number (n) of observed cells is shown. The p-values were calculated by Welch’s t-test.
Figure 5—figure supplement 3
Electron microscopic images of the cells with the vector (A) or under mox-YG overexpression (B).
Figure 5—figure supplement 4
Model diagrams showing the hypothetical situation of the cells.
(A) In the wild type cells, enough ribosomal proteins (RPs) are produced, resulting in RP-assembled rRNAs and the formation of nucleolus with normal morphology. (B) In mox-YG overexpressing cells, the amount of RP is reduced due to translation competition, increasing misassembled rRNA. As a result, degradation of rRNA by exosomes may be accelerated, resulting in abnormal nucleolus morphology and reduction of ribosomes. (C) In exosome-deficient cells like the mtr4-1 cells, errors in rRNA processing occur due to the reduction of degradation by exosomes, resulting in the reduction of ribosomes and growth defects. (D) In mox-YG overexpressing, exosome-deficient cells, degradation of misassembled rRNA is reduced, and nucleolus formation and ribosome biosynthesis are partially recovered.
Figure 5—figure supplement 5
Positive genetic interaction between exosome mutation (mtr4-1) and mox-YG overexpression.
(A) Growth curves of the wild type (WT) and mtr4-1 mutant cells with the vector or under overexpression of mox-YG in SC–LeuUra medium at 30 °C. The solid or dotted lines show the average calculated from three biological replicates. Shaded zones indicate their Sds. (B) MGR of the wild type (WT) and mtr4-1 mutant cells with the vector or under overexpression of mox-YG (percent over the vector control). The bars and error bars show the means and SDs calculated from three biological replicates. The raw data is shown with dot plots. The p-value of Welch’s t-test is shown. n.s.: p>0.05. (C) Gel images of SDS-PAGE-separated proteins extracted from the wild type (WT) and mtr4-1 mutant cells with the vector or under overexpression of mox-YG. All proteins were separated after staining with a fluorescent dye. (D) Observation of nucleolus. The construct to observe nucleolus (Nsr1-mScarlet-I fusion gene) was integrated into the genomic FCY1 locus. Fluorescence microscopy image of nucleolus-localized protein Nsr1-mScarlet-I of the WT and mtr4-1 mutant cells with the vector or mox-YG overexpression. (E) Quantification of the size of Nsr1-mScarlet-I fluorescent region in WT and mtr4-1 cells with the vector or mox-YG overexpression. The number (n) of observed cells is shown. The p-values were calculated by Welch’s t-test.
-
Figure 5—figure supplement 5—source data 1
Original files for SDS-PAGE analysis displayed in Figure 5—figure supplement 5C.
- https://cdn.elifesciences.org/articles/99572/elife-99572-fig5-figsupp5-data1-v1.zip
Figure 5—figure supplement 6
Comparison of growth of glycolytic enzymes overexpressing strains.
(A, C, D) Growth curves of cells with the vector or under mox-YG overexpression in SC–LeuUra medium at the indicated temperature. In the indicated culture, sorbitol (1 M) is added. The solid or dotted lines show the average calculated from three biological replicates. Shaded zones indicate their standard deviations. (B) Bright-field microscopic images of cells with the vector or under mox-YG overexpression cultured at the indicated temperature. (E) Fluorescence microscopy image showing the size of the Nsr1-mScarlet-I nucleolus, observed in the vector control or mox-YG over-expressing cells (OD660=1.0) when cultured at 38 °C or in sorbitol-enriched medium. (F) Quantification results of the Nsr1-mScarlet-I regions observed in the eight conditions indicated in E. Number of cells observed (n) is shown. The p-value was calculated by the Mann-Whitney U-test.
Figure 6 with 7 supplements
The Gpm1 mutant shows a similar NI to mox-YG, yet yields distinct phenotypes upon overexpression.
(A) The neutrality index for Gpm1, Tdh3, and their CCmuts. Data on growth rates and protein expression levels used for the neutrality index calculation are presented in Figure 6—figure supplement 1. (B) Top images: representative microscopic images of cells overexpressing Gpm1 or Gpm1–CCmut. Bottom graph: Distribution of cell axis ratios upon overexpression of Gpm1 and Gpm1–CCmut, compared with the vector control. The p-values were calculated by the Mann–Whitney U-test. Statistical analysis of cell size and comparison with mox-YG overexpressing cells are shown in Figure 6—figure supplement 3. (C) Promoter activity reporter assay. Constructs used for promoter analysis with transcription reporters and quantitative results of RFP fluorescence values (arbitrary unit) for each promoter. Time series data are in Figure 6—figure supplement 4. (D) Oxygen consumption rate in vector control, mox-YG, and Gpm1-CCmut overexpressing cells (arbitrary units, AU). Antimycin A was added as a control for respiratory inhibition. The measurement data are shown in Figure 6—figure supplement 6. (E) Fluorescence microscopy images of nucleolus with Nsr1–mScarlet-I. Log phase cells (OD660=1.0) with the control vector or under Gpm1 or Gpm1–CCmut overexpression were observed. Statistical analysis of nucleolar size is shown in Figure 6—figure supplement 7. The bars and error bars in A, C and D show the means and SDs calculated from three biological replicates. The raw data is shown with dot plots. The p-values were calculated by performing Welch’s t-test and applying Bonferroni correction. ‘n.s.’ means p>0.05.
Figure 6—figure supplement 1
Evaluation of the neutrality of Tdh3 and Gpm1.
(A, B) Growth curves of cells with the vector (Vector) and overexpressing Gpm1 and Tdp3 and their catalytic center mutants (CCmut) in synthetic medium (–LeuUra). The solid or dotted lines show the average calculated from three biological replicates. Shaded zones indicate their SD. (C) MGR of cells overexpressing indicated proteins (percent over the vector control). (D) Gel images of SDS-PAGE-separated proteins extracted from cells overexpressing indicated proteins. All proteins were separated after staining with a fluorescent dye. (E) Protein levels of the target protein (percent over the total protein). The amount was calculated from the intensity of the target bands separated by SDS-PAGE of D. (F) Ratio of total protein content of cells overexpressing glycolytic enzymes over the vector control. Gray bars and error bars indicate expression levels and SDs for proteins other than glycolytic enzymes; non-gray bars and error bars indicate expression levels and SDs for each overexpressed protein. The bars and error bars in C, E, and F show the means and SDs calculated from three biological replicates. The raw data is shown with dot plots.
-
Figure 6—figure supplement 1—source data 1
Original files for SDS-PAGE analysis displayed in Figure 6—figure supplement 1D.
- https://cdn.elifesciences.org/articles/99572/elife-99572-fig6-figsupp1-data1-v1.zip
Figure 6—figure supplement 2
Nucleotide and amino acid sequences of Gpm1 and Tdh3.
The amino acid substitutions introduced to eliminate enzyme activity are shown in red. The H182A mutation in Gpm1 was referred to the study by White and Fothergill-Gilmore, 1992, and the C150S mutation in Tdh3 was referred to the study by Peralta et al., 2015.
Figure 6—figure supplement 3
Overexpression of Gpm1 and its CC-mutant induces abnormal cell morphology.
(A) Representative microscopic images of cells overexpressing Gpm1 or Gpm1–CCmut. (B) Violin plots showing cell size quantified from microscopic images. The number of cells used for the quantification is shown. The p-values were calculated by the Mann–Whitney U-test. (C) Distribution of cell axis ratios upon overexpression of mox-YG, Gpm1, and Gpm1–CCmut, compared with the vector control. The p-values were calculated by the Mann–Whitney U-test. ‘n.s.’ means p>0.05.
Figure 6—figure supplement 4
Transcriptional response under mox-YG and Gpm1 CC-mutant overexpression.
(A) Curves representing time series data of cell growth (gray, OD595) and mScarlet-I fluorescence (red, arbitrary unit) overexpressing mox-YG and Gpm1–CCmut in SC–LeuUra +50 mg/mL leucine medium for each promoter. Solid lines are averages calculated from four biological replicates. (B) Quantitative results of mScarlet-I fluorescence values for each promoter. Bars and error bars indicate the mean and SD of maximum fluorescence values (arbitrary unit) for mScarlet-I calculated from four biological replicates. Raw data are shown as dot plots. The p-values were calculated by performing Welch’s t-test and applying the Bonferroni correction. ‘n.s.’ means p>0.05.
Figure 6—figure supplement 5
Microscopic observation of mitochondria in cells overexpressing Gpm1 or Gpm1–Ccmut.
(A) Fluorescence microscopy image showing the size of nucleolus with Rip1–mScarlet-I. Log phase cells (OD660=1.0) with the vector or under Gpm1 or Gpm1–CCmut overexpression were observed. (B) Quantification of the fluorescence value of Rip1–mScarlet-I in the cells with the vector or Gpm1 or Gpm1–CCmut overexpression. The number of cells used for the quantification is shown. The p-values were calculated by Mann–Whitney U-test.
Figure 6—figure supplement 6
Time-course analysis of oxygen consumption in Gpm1–CCmut overexpressing cells.
(A, B) Line graphs showing changes in the fluorescence of an oxygen-sensitive probe, measured in synthetic medium (A) and in medium containing 50 µM antimycin A (B). Solid lines represent the mean values from three biological replicates; error bars indicate standard deviations.
Figure 6—figure supplement 7
Microscopic observation of nucleoli in cells overexpressing Gpm1 or Gpm1–Ccmut.
(A) Fluorescence microscopy images showing the size of nucleolus with Nsr1–mScarlet-I. Log phase cells (OD660=1.0) with the vector or under Gpm1 or Gpm1–CCmut overexpression were observed. (B, C) Quantification of the size of Nsr1–mScarlet-I fluorescent region (B) and fluorescence value of Nsr1–mScarlet-I (C) in the cells with the vector or Gpm1 or Gpm1–CCmut overexpression. The number of cells used for the quantification is shown. The p-values were calculated by Mann–Whitney U-test.
Author response image 1
Tables
Appendix 1—key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background (Saccharomyces cerevisiae) | BY4741 MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0 | PMID:9483801 | ||
| Strain (ACT1pro_mScarlet-I) | fcy1::ACT1pro_mScarlet-I_TDH3ter_HIS3MX6 | this paper | ||
| Strain (TDH3pro_mScarlet-I) | fcy1::TDH3pro_mScarlet-I_TDH3ter_HIS3MX6 | this paper | ||
| Strain (YAP5pro_mScarlet-I) | fcy1::YAP5pro_mScarlet-I_TDH3ter_HIS3MX6 | this paper | ||
| Strain (PHO84pro_mScarlet-I) | fcy1::PHO84pro_mScarlet-I_TDH3ter_HIS3MX6 | this paper | ||
| Strain (ZPS1pro_mScarlet-I) | fcy1::ZPS1pro_mScarlet-I_TDH3ter_HIS3MX6 | this paper | ||
| Strain (ADE17pro_mScarlet-I) | fcy1::ADE17pro_mScarlet-I_TDH3ter_HIS3MX6 | this paper | ||
| Strain (CTR1pro_mScarlet-I) | fcy1::CTR1pro_mScarlet-I_TDH3ter_HIS3MX6 | this paper | ||
| Strain (FIT2pro_mScarlet-I) | fcy1::FIT2pro_mScarlet-I_TDH3ter_HIS3MX6 | this paper | ||
| Strain (HXT7pro_mScarlet-I) | fcy1::HXT7pro_mScarlet-I_TDH3ter_HIS3MX6 | this paper | ||
| Strain (CUP1pro_mScarlet-I) | fcy1::CUP1pro_mScarlet-I_TDH3ter_HIS3MX6 | this paper | ||
| Strain (OM14pro_mScarlet-I) | fcy1::OM14pro_mScarlet-I_TDH3ter_HIS3MX6 | this paper | ||
| Strain (OM45pro_mScarlet-I) | fcy1::OM45pro_mScarlet-I_TDH3ter_HIS3MX6 | this paper | ||
| Strain (AGP1pro_mScarlet-I) | fcy1::AGP1pro_mScarlet-I_TDH3ter_HIS3MX6 | this paper | ||
| Strain (GAP1pro_mScarlet-I) | fcy1::GAP1pro_mScarlet-I_TDH3ter_HIS3MX6 | this paper | ||
| Strain (HXT1pro_mScarlet-I) | fcy1::HXT1pro_mScarlet-I_TDH3ter_HIS3MX6 | this paper | ||
| Strain (RIP1pro_RIP1_mScarlet-I) | fcy1::RIP1pro_RIP1_mScarlet-I_TDH3ter_HIS3MX6 | this paper | ||
| Strain (NSR1pro_NSR1_GFP) | fcy1::NSR1pro_NSR1_GFP_TDH3ter_HIS3MX6 | this paper | ||
| Strain (NSR1pro_NSR1_mScarlet-I) | fcy1::NSR1pro_NSR1_mScarlet-I_TDH3ter_HIS3MX6 | this paper | ||
| Strain (ACT1pro_GBP_mScarlet-I) | fcy1::ACT1pro_GBP_mScarlet-I_TDH3ter_HIS3MX6 | this paper | ||
| Strain, strain background (Saccharomyces cerevisiae) | mtr4-1 MATa his3mtr4-1::KanR; his3Δ1 leu2Δ0 ura3Δ0 met15Δ0 | PMID:27708008 | ||
| Strain (mtr4 ts mut, NSR1pro_NSR1_mScarlet-I) | mtr4-1 MATa his3mtr4-1::KanR; his3Δ1 leu2Δ0 ura3Δ0 met15Δ0 fcy1:: NSR1pro_NSR1_mScarlet-I_TDH3ter_HIS3MX6 | this paper | ||
| Gene (S. cerevisiae) | GPM1 | PMID:30095406 | SGD:YKL152C | |
| Gene (S. cerevisiae) | TDH3 | PMID:30095406 | SGD: YGR192C | |
| Genetic reagent (S. cerevisiae) | GPM1-H182A | PMID:1386023 | catalytic center mutant of GPM1 | |
| Genetic reagent (S. cerevisiae) | TDH3-C150S | PMID:25580853 | catalytic center mutant of TDH3 | |
| Genetic reagent (S. cerevisiae) | EGFP | PMID:9043107 | ||
| Genetic reagent (S. cerevisiae) | EGFP-Y66G | PMID:27538565 | non-fluorescent yEGFP mutant | |
| Genetic reagent (S. cerevisiae) | sfGFP | PMID:16369541 | ||
| Genetic reagent (S. cerevisiae) | sfGFP-Y66G | this paper | non-fluorescent sfGFP mutant | |
| Genetic reagent (S. cerevisiae) | moxGFP | PMID:26158227 | ||
| Genetic reagent (S. cerevisiae) | moxGFP-Y66G | this paper | non-fluorescent moxGFP mutant | |
| Genetic reagent (S. cerevisiae) | moxGFP-Y66G+Y | this paper | Mutant with Y added to the end of the moxGFP-Y66G sequence | |
| Genetic reagent (S. cerevisiae) | moxGFP-T203I | this paper | Mutant with weaker fluorescence than moxGFP | |
| Genetic reagent (S. cerevisiae) | moxGFP-T65S | this paper | Mutant with weaker fluorescence than moxGFP | |
| Genetic reagent (S. cerevisiae) | mCherry | PMID:15558047 | ||
| Genetic reagent (S. cerevisiae) | mCherry-Y72G | this paper | non-fluorescent mCherry mutant | |
| Genetic reagent (S. cerevisiae) | mCherry-Kafri | PMID:26725116 | ||
| Genetic reagent (S. cerevisiae) | mCherry-Kafri-Y72G | this paper | non-fluorescent mCherry-Kafri mutant | |
| Genetic reagent (S. cerevisiae) | mScarlet-I | PMID:27869816 | ||
| Genetic reagent (S. cerevisiae) | GFP binding protein (GBP) | PMID:17060912 | ||
| Gene (S. cerevisiae) | ACT1 | SGD: YFL039C | ||
| Gene (S. cerevisiae) | YAP5 | SGD: YIR018W | ||
| Gene (S. cerevisiae) | PHO84 | SGD: YML123C | ||
| Gene (S. cerevisiae) | ZPS1 | SGD: YOL154W | ||
| Gene (S. cerevisiae) | ADE17 | SGD: YMR120C | ||
| Gene (S. cerevisiae) | CTR1 | SGD: YPR124W | ||
| Gene (S. cerevisiae) | FIT2 | SGD: YOR382W | ||
| Gene (S. cerevisiae) | HXT7 | SGD: YDR342C | ||
| Gene (S. cerevisiae) | CUP1 | SGD: YHR094C | ||
| Gene (S. cerevisiae) | OM14 | SGD: YBR230C | ||
| Gene (S. cerevisiae) | OM45 | SGD: YIL136W | ||
| Gene (S. cerevisiae) | AGP1 | SGD: YCL025C | ||
| Gene (S. cerevisiae) | GAP1 | SGD: YKR039W | ||
| Gene (S. cerevisiae) | HXT1 | SGD: YHR094C | ||
| Gene (S. cerevisiae) | RIP1 | SGD: YEL024W | ||
| Gene (S. cerevisiae) | NSR1 | SGD: YGR159C | ||
| Gene (S. cerevisiae) | ATG13 | SGD: YPR185W | ||
| Recombinant DNA reagent | pTOW40836 | PMID:22722869 | 2µOri, URA3, leu2d, AmpR, ColE1Ori | |
| Recombinant DNA reagent | pTOW-t-EGFP | PMID:27538565 | TDH3 promoter yEGFP; background pTOW40836 | |
| Recombinant DNA reagent | pTOW-t-EGFP-Y66G | PMID:27538565 | TDH3 promoter yEGFP-Y66G; background pTOW40836 | |
| Recombinant DNA reagent | pTOW-t-sfGFP | PMID:30095406 | TDH3 promoter sfGFP; background pTOW40836 | |
| Recombinant DNA reagent | pTOW-t-sfGFP-Y66G | this paper | TDH3 promoter sfGFP-Y66G; background pTOW40836 | |
| Recombinant DNA reagent | pTOW-t-mox | PMID:30095406 | TDH3 promoter moxGFP; background pTOW40836 | |
| Recombinant DNA reagent | pTOW-t-mox-Y66G | this paper | TDH3 promoter moxGFP-Y66G; background pTOW40836 | |
| Recombinant DNA reagent | pTOW-t-moxFS | this paper | TDH3 promoter moxFS; background pTOW40836 | |
| Recombinant DNA reagent | pTOW-t-moxGFP-T203I | this paper | TDH3 promoter moxGFP-T203I; background pTOW40836 | |
| Recombinant DNA reagent | pTOW-t- moxGFP-T65S | this paper | TDH3 promoter moxGFP-T65S; background pTOW40836 | |
| Recombinant DNA reagent | pTOW-t-mCherry | this paper | TDH3 promoter mCherry; background pTOW40836 | |
| Recombinant DNA reagent | pTOW-t-mCherry-Y72G | this paper | TDH3 promoter mCherry-Y72G; background pTOW40836 | |
| Recombinant DNA reagent | pTOW-t-mCherry-Kafri | this paper | TDH3 promoter mCherry-Kafri; background pTOW40836 | |
| Recombinant DNA reagent | pTOW-t-mCherry-Kafri-Y72G | this paper | TDH3 promoter mCherry-Kafri-Y72G; background pTOW40836 | |
| Recombinant DNA reagent | pTOW-t-GPM1 | PMID:30095406 | TDH3 promoter GPM1; background pTOW40836 | |
| Recombinant DNA reagent | pTOW-t-TDH3 | PMID:30095406 | TDH3 promoter TDH3; background pTOW40836 | |
| Recombinant DNA reagent | pTOW-t-GPM1-H182A | PMID:30095406 | TDH3 promoter GPM1-H182A; background pTOW40836 | |
| Recombinant DNA reagent | pTOW-t-TDH3-C150S | PMID:30095406 | TDH3 promoter TDH3-C150S; background pTOW40836 | |
| Recombinant DNA reagent | pTOW4083-AUR1d | this paper | 2µOri, URA3, aur1d, AmpR, ColE1Ori | |
| Recombinant DNA reagent | pTOW4083-AUR1d-mox | this paper | TDH3 promoter moxGFP; background pTOW40836-AUR1d | |
| Recombinant DNA reagent | pTOW4083-AUR1d-moxY66G | this paper | TDH3 promoter moxGFP-Y66G; background pTOW40836-AUR1d | |
| Recombinant DNA reagent | pTOW4083-AUR1d-mCherry | this paper | TDH3 promoter mCherry; background pTOW40836-AUR1d | |
| Recombinant DNA reagent | pTOW4083-AUR1mCherry-Y72G | this paper | TDH3 promoter mCherry-Y72G; background pTOW40836-AUR1d | |
| Recombinant DNA reagent | pRS423ks | PMID:23275495 | 2µOri, HIS3, AmpR, ColE1Ori | |
| Recombinant DNA reagent | pRS423ks-ATG13 | this paper | ATG13promoter ATG13; background pRS423ks | |
| Sequence-based reagent | AUR1d | this paper | agaggaaagaataacgcaaaaccacccttttcactaagatgctttatgagctgatcggacttgttcgcataaccaactccaatgcgccaaagttggaagcaaaagaattgtcttccacaatcgggaaactgattattcaaaacagaggtgtggtgagggacattgtacccatgggcataaggtatcttcctaaaataatgaagaaagaccaggaaaaacattttcgagcatatcactttttaatgctgtttgattcatcagctgcggtacagtctgaaattctaagaactttaaagaaagatccccgtgtcataagatcatccatcgttaaagttgatttagataagcagctggatagagcctcatcgttacaccgttctttggggaagaagtctattttagaattagtgaatgaagattatcaatccatttaggtatagcgcacaggttttgactggggacgctacaaacacatgtaaatacatacatatctttcatacacatataataaacaaagcaggaagagcattctaaaagcctcacttaacatagacaccattaaaagccacccatttatttcaaaaatttataaaattctaaagataatcagtggtatgtgattaaataaactacatgtatattatgctaaacgacaatcctgactaagaaaaagaaagaaaaagatatatatttatatgtatctacataagaccaaccgtatccgtaattgcagataaaatactcaTTAAGCCCTCTTTACACCTAGTGACGTTATAGACGTGGCGGACGAACGAGAAACAGAAGTAGATCCATCAAATAACGAAGGGCTTACACTGGGTTCATCAGTCATATTAAGATCAAAGTCAAGTTCCAAGTTGGACAAAGGGACACTTTCGATATCGTTTGAATCTGCAGCCAATGGATCACTCTTTGATATATCGTATTTCTCAATTGAAGTGTATGACCATCTGCAAAAAAGAGATGTATCTACAATTGGTAAATGTGTGTACTTTGTGTACTGGAAAATAACGTATGACAGCACAGAACCTGCCATAAGGTCTACAAAATAATGGTGTGTCAGATACATAGTTGACCACCATAACCAGCAAACATAAGCAATAAACAAGGGCTTCAATTTTGGAAAACAATAACAGAAAAACAGGGCTTCCATAGTAGCACACCCGGAATGCAGTGAAGGAAAAGCACCGAAAATGACGGAGGAATTTGAAAAACATGTAGTATACATATTAATACCGAGTAGCTTATCAATTCTAGCTAATCCACCAGGCGAGCCATGCATATCATAGTTGGCTGATTGCAATCCATAGAGAATTTTATACCATGGGGGAGCGGCTGGAAAGACATTTTGCATGATAACACCAAACAGGTTCATATAACCAAATGCAAAAGCATAACCTTGCAAAACAGTTGGTGGACCAAATACGAATAAGATGGCAGCAACGACAAATGGGGCCCCATAATGAAATAGTCCGTACGGTAACCATGCTAAAATGTCCAAAAAGGAATTCGTCGATGTTGCAAGAATATCACTTAAATTGTCGCCGTATAAAATTGTTTCCACCGCTGGTAACACTTTGACAGTAATAGGAGGCCTGCGGTCATCTGGAAAGTACGATGAAGTGAAATACAGCGCCACCCATGTTAGGATGGGCAAGGCATTGAAGAAAAACTGTGACGTAGCTGGAATGATGAATAAAGTGCCCAAGAAACAATAAAAAAGGATCTTGAAGATCCAAGGTGCGGGATTAGTAATGAACACAAACAGCATGATGGATCCCAAGAAGATGTAATGCACCCAGTCGCTTAAAGCGGGTTTGTATTTTTGCACCTTCAACAACGTTTGATGGGGATCTAAACTTGTTTCTAAATCGGCTACATGGCAGTTTGGAGGTCTCTCTGATAGAAACCATCTCGAAAAAGGGTTTGCCATacgcaaaggaatgattaaaagctttttaaaatatgaaaaccgcaacctgtaggatataaaataaagtacttttggagaaaattcaaagat | |
| Sequence-based reagent | EGFP | PMID:9043107 | ATGTCTAAAGGTGAAGAATTATTCACTGGTGTTGTCCCAATTTTGGTTGAATTAGATGGTGATGTTAATGGTCACAAATTTTCTGTCTCCGGTGAAGGTGAAGGTGATGCcACTTACGGTAAATTGACCTTAAAATTTATTTGTACTACTGGTAAATTGCCAGTTCCATGGCCAACCTTAGTCACTACTTTAACTTATGGTGTTCAATGTTTTTCTAGATACCCAGATCATATGAAACAACATGACTTTTTCAAGTCTGCCATGCCAGAAGGTTATGTTCAAGAAAGAACTATTTTTTTCAAAGATGACGGTAACTACAAGACCAGAGCTGAAGTCAAGTTTGAAGGTGATACCTTAGTTAATAGAATCGAATTAAAAGGTATTGATTTTAAAGAAGATGGTAACATTTTAGGTCACAAATTGGAATACAACTATAACTCTCACAATGTTTACATCATGGCTGACAAACAAAAGAATGGTATCAAAGTTAACTTCAAAATTAGACACAACATTGAAGATGGTTCTGTTCAATTAGCTGACCATTATCAACAAAATACTCCAATTGGTGATGGTCCAGTCTTGTTACCAGACAACCATTACTTATCCACTCAATCTGCCTTATCCAAAGATCCAAACGAAAAGAGAGACCACATGGTCTTGTTAGAATTTGTTACTGCTGCTGGTATTACCCATGGTATGGATGAATTGTACAAATAA | |
| Sequence-based reagent | EGFP-Y66G | this paper | ATGTCTAAAGGTGAAGAATTATTCACTGGTGTTGTCCCAATTTTGGTTGAATTAGATGGTGATGTTAATGGTCACAAATTTTCTGTCTCCGGTGAAGGTGAAGGTGATGCTACTTACGGTAAATTGACCTTAAAATTTATTTGTACTACTGGTAAATTGCCAGTTCCATGGCCAACCTTAGTCACTACTTTAACTggTGGTGTTCAATGTTTTTCTAGATACCCAGATCATATGAAACAACATGACTTTTTCAAGTCTGCCATGCCAGAAGGTTATGTTCAAGAAAGAACTTTTTTTCAAAGATGACGGTAACTACAAGACCAGAGCTGAAGTCAAGTTTGAAGGTGATACCTTAGTTAATAGAATCGAATTAAAAGGTATTGATTTTAAAGAAGATGGTAACATTTTAGGTCACAAATTGGAATACAACTATAACTCTCACAATGTTTACATCATGGCTGACAAACAAAAGAATGGTATCAAAGTTAACTTCAAAATTAGACACAACATTGAAGATGGTTCTGTTCAATTAGCTGACCATTATCAACAAAATACTCCAATTGGTGATGGTCCAGTCTTGTTACCAGACAACCATTACTTATCCACTCAATCTGCCTTATCCAAAGATCCAAACGAAAAGAGAGACCACATGGTCTTGTTAGAATTTGTTACTGCTGCTGGTATTACCCATGGTATGGATGAATTGTACAAATAA | |
| Sequence-based reagent | sfGFP | PMID:16369541 | ATGTCCAAGGGTGAAGAGCTATTTACTGGGGTTGTACCCATTTTGGTAGAACTGGACGGAGATGTAAACGGACATAAATTCTCTGTTAGAGGTGAGGGCGAAGGCGATGCCACCAATGGTAAATTGACTCTGAAGTTTATATGCACTACGGGTAAATTACCTGTTCCTTGGCCAACCCTAGTAACAACTTTGACATATGGTGTTCAATGTTTCTCAAGATACCCAGACCATATGAAAAGGCATGATTTCTTTAAAAGTGCTATGCCAGAAGGCTACGTGCAAGAGAGAACTATCTCCTTTAAGGATGACGGTACGTATAAAACACGAGCAGAAGTGAAATTCGAAGGGGATACACTAGTTAATCGCATCGAATTAAAGGGTATAGACTTTAAGGAAGATGGTAATATTCTCGGCCATAAACTTGAGTATAATTTCAACTCGCATAATGTGTACATTACAGCTGACAAACAAAAGAACGGAATTAAAGCGAATTTTAAAATCAGGCACAACGTCGAAGATGGGTCTGTTCAACTTGCCGATCATTATCAGCAAAACACCCCTATTGGTGATGGTCCAGTCTTGTTACCCGATAATCACTACTTAAGCACACAGTCTAGATTGTCAAAAGATCCGAATGAAAAGCGTGATCACATGGTTTTATTGGAATTTGTCACCGCTGCAGGAATAACTCACGGAATGGACGAGCTTTATAAGTAA | |
| Sequence-based reagent | sfGFP-Y66G | this paper | ATGTCCAAGGGTGAAGAGCTATTTACTGGGGTTGTACCCATTTTGGTAGAACTGGACGGAGATGTAAACGGACATAAATTCTCTGTTAGAGGTGAGGGCGAAGGCGATGCCACCAATGGTAAATTGACTCTGAAGTTTATATGCACTACGGGTAAATTACCTGTTCCTTGGCCAACCCTAGTAACAACTTTGACAggTGGTGTTCAATGTTTCTCAAGATACCCAGACCATATGAAAAGGCATGATTTCTTTAAAAGTGCTATGCCAGAAGGCTACGTGCAAGAGAGAACTATCTCCTTTAAGGATGACGGTACGTATAAAACACGAGCAGAAGTGAAATTCGAAGGGGATACACTAGTTAATCGCATCGAATTAAAGGGTATAGACTTTAAGGAAGATGGTAATATTCTCGGCCATAAACTTGAGTATAATTTCAACTCGCATAATGTGTACATTACAGCTGACAAACAAAAGAACGGAATTAAAGCGAATTTTAAAATCAGGCACAACGTCGAAGATGGGTCTGTTCAACTTGCCGATCATTATCAGCAAAACACCCCTATTGGTGATGGTCCAGTCTTGTTACCCGATAATCACTACTTAAGCACACAGTCTAGATTGTCAAAAGATCCGAATGAAAAGCGTGATCACATGGTTTTATTGGAATTTGTCACCGCTGCAGGAATAACTCACGGAATGGACGAGCTTTATAAGTAA | |
| Sequence-based reagent | moxGFP | PMID:30095406 | ATGTCTAAAGGTGAAGAATTATTCACTGGTGTTGTCCCAATTTTGGTTGAATTAGATGGTGATGTTAATGGTCACAAATTTTCTGTCcgtGGTGAAGGTGAAGGTGATGCTACTaAtGGTAAATTGACCTTAAAATTTATTTcTACTACTGGTAAATTGCCAGTTCCATGGCCAACCTTAGTCACTACTTTAACTTATGGTGTTCAATcTTTTTCTAGATACCCAGATCATATGAAACgtCATGACTTTTTCAAGTCTGCCATGCCAGAAGGTTATGTTCAAGAAAGAACTATTTcTTTCAAAGATGACGGTActTACAAGACCAGAGCTGAAGTCAAGTTTGAAGGTGATACCTTAGTTAATAGAATCGAATTAAAAGGTATTGATTTTAAAGAAGATGGTAACATTTTAGGTCACAAATTGGAATACAACTtcAACTCTCACAATGTTTACATCActGCTGACAAACAAAAGAATGGTATCAAAGcTAACTTCAAAATTAGACACAACgtTGAAGATGGTTCTGTTCAATTAGCTGACCATTATCAACAAAATACTCCAATTGGTGATGGTCCAGTCTTGTTACCAGACAACCATTACTTATCCACTCAATCTcgtTTATCCAAAGATCCAAACGAAAAGAGAGACCACATGGTCTTGTTAGAATTTGTTACTGCTGCTGGTATTACCCATGGTATGGATGAATTGTACAAATAA | |
| Sequence-based reagent | mox-Y66G | this paper | ATGTCTAAAGGTGAAGAATTATTCACTGGTGTTGTCCCAATTTTGGTTGAATTAGATGGTGATGTTAATGGTCACAAATTTTCTGTCcgtGGTGAAGGTGAAGGTGATGCTACTaAtGGTAAATTGACCTTAAAATTTATTTcTACTACTGGTAAATTGCCAGTTCCATGGCCAACCTTAGTCACTACTTTAACTggTGGTGTTCAATcTTTTTCTAGATACCCAGATCATATGAAACgtCATGACTTTTTCAAGTCTGCCATGCCAGAAGGTTATGTTCAAGAAAGAACTATTTcTTTCAAAGATGACGGTActTACAAGACCAGAGCTGAAGTCAAGTTTGAAGGTGATACCTTAGTTAATAGAATCGAATTAAAAGGTATTGATTTTAAAGAAGATGGTAACATTTTAGGTCACAAATTGGAATACAACTtcAACTCTCACAATGTTTACATCActGCTGACAAACAAAAGAATGGTATCAAAGcTAACTTCAAAATTAGACACAACgtTGAAGATGGTTCTGTTCAATTAGCTGACCATTATCAACAAAATACTCCAATTGGTGATGGTCCAGTCTTGTTACCAGACAACCATTACTTATCCACTCAATCTcgtTTATCCAAAGATCCAAACGAAAAGAGAGACCACATGGTCTTGTTAGAATTTGTTACTGCTGCTGGTATTACCCATGGTATGGATGAATTGTACAAATAA | |
| Sequence-based reagent (synthetic gene) | mCherry(yeast codon-optimized) | this paper | ATGGTTTCTAAAGGTGAAGAAGATAATATGGCTATTATTAAAGAATTTATGAGATTTAAAGTTCATATGGAAGGTTCAGTTAATGGTCATGAATTTGAAATTGAAGGTGAAGGTGAAGGTAGACCATATGAAGGTACTCAAACTGCTAAATTGAAAGTTACTAAAGGTGGTCCATTACCATTTGCTTGGGATATTTTGTCACCACAATTTATGTATGGTTCAAAAGCTTATGTTAAACATCCAGCTGATATTCCAGATTATTTAAAATTGTCATTTCCAGAAGGTTTTAAATGGGAAAGAGTTATGAATTTTGAAGATGGTGGTGTTGTTACTGTTACTCAAGATTCATCATTACAAGATGGTGAATTTATTTATAAAGTTAAATTGAGAGGTACTAATTTTCCATCAGATGGTCCAGTTATGCAAAAAAAAACTATGGGTTGGGAAGCTTCATCAGAAAGAATGTATCCAGAAGATGGTGCTTTAAAAGGTGAAATTAAACAAAGATTGAAATTAAAAGATGGTGGTCATTATGATGCTGAAGTTAAAACTACTTATAAAGCTAAAAAACCAGTTCAATTACCAGGTGCTTATAATGTTAATATTAAATTGGATATTACTTCACATAATGAAGATTATACTATTGTTGAACAATATGAAAGAGCTGAAGGTAGACATTCAACTGGTGGTATGGATGAATTGTACAAATAA | |
| Sequence-based reagent | mCherry-Y72G | this paper | gaataaacacacataaacaaacaaaATGGTGAGCAAGGGCGAGGAGGATAACATGGCCATCATCAAGGAGTTCATGCGCTTCAAGGTGCACATGGAGGGCTCCGTGAACGGCCACGAGTTCGAGATCGAGGGCGAGGGCGAGGGCCGCCCCTACGAGGGCACCCAGACCGCCAAGCTGAAGGTGACCAAGGGTGGCCCCCTGCCCTTCGCCTGGGACATCCTGTCCCCTCAGTTCATGggCGGCTCCAAGGCCTACGTGAAGCACCCCGCCGACATCCCCGACTACTTGAAGCTGTCCTTCCCCGAGGGCTTCAAGTGGGAGCGCGTGATGAACTTCGAGGACGGCGGCGTGGTGACCGTGACCCAGGACTCCTCCCTGCAGGACGGCGAGTTCATCTACAAGGTGAAGCTGCGCGGCACCAACTTCCCCTCCGACGGCCCCGTAATGCAGAAGAAGACCATGGGCTGGGAGGCCTCCTCCGAGCGGATGTACCCCGAGGACGGCGCCCTGAAGGGCGAGATCAAGCAGAGGCTGAAGCTGAAGGACGGCGGCCACTACGACGCTGAGGTCAAGACCACCTACAAGGCCAAGAAGCCCGTGCAGCTGCCCGGCGCCTACAACGTCAACATCAAGTTGGACATCACCTCCCACAACGAGGACTACACCATCGTGGAACAGTACGAACGCGCCGAGGGCCGCCACTCCACCGGCGGCATGGACGAGCTGTACAAGTAGgtgaatttactttaaatcttgcatt | |
| Sequence-based reagent (synthetic gene) | mCherry-Kafri | PMID:26725116 | ATGGTGAGCAAGGGCGAGGAGGATAACATGGCCATCATCAAGGAGTTCATGCGCTTCAAGGTGCACATGGAGGGCTCCGTGAACGGCCACGAGTTCGAGATCGAGGGCGAGGGCGAGGGCCGCCCCTACGAGGGCACCCAGACCGCCAAGCTGAAGGTGACCAAGGGTGGCCCCCTGCCCTTCGCCTGGGACATCCTGTCCCCTCAGTTCATGTACGGCTCCAAGGCCTACGTGAAGCACCCCGCCGACATCCCCGACTACTTGAAGCTGTCCTTCCCCGAGGGCTTCAAGTGGGAGCGCGTGATGAACTTCGAGGACGGCGGCGTGGTGACCGTGACCCAGGACTCCTCCCTGCAGGACGGCGAGTTCATCTACAAGGTGAAGCTGCGCGGCACCAACTTCCCCTCCGACGGCCCCGTAATGCAGAAGAAGACCATGGGCTGGGAGGCCTCCTCCGAGCGGATGTACCCCGAGGACGGCGCCCTGAAGGGCGAGATCAAGCAGAGGCTGAAGCTGAAGGACGGCGGCCACTACGACGCTGAGGTCAAGACCACCTACAAGGCCAAGAAGCCCGTGCAGCTGCCCGGCGCCTACAACGTCAACATCAAGTTGGACATCACCTCCCACAACGAGGACTACACCATCGTGGAACAGTACGAACGCGCCGAGGGCCGCCACTCCACCGGCGGCATGGACGAGCTGTACAAGTAG | |
| Sequence-based reagent | mCherry-Kafri-Y72G | this paper | ATGGTGAGCAAGGGCGAGGAGGATAACATGGCCATCATCAAGGAGTTCATGCGCTTCAAGGTGCACATGGAGGGCTCCGTGAACGGCCACGAGTTCGAGATCGAGGGCGAGGGCGAGGGCCGCCCCTACGAGGGCACCCAGACCGCCAAGCTGAAGGTGACCAAGGGTGGCCCCCTGCCCTTCGCCTGGGACATCCTGTCCCCTCAGTTCATGggCGGCTCCAAGGCCTACGTGAAGCACCCCGCCGACATCCCCGACTACTTGAAGCTGTCCTTCCCCGAGGGCTTCAAGTGGGAGCGCGTGATGAACTTCGAGGACGGCGGCGTGGTGACCGTGACCCAGGACTCCTCCCTGCAGGACGGCGAGTTCATCTACAAGGTGAAGCTGCGCGGCACCAACTTCCCCTCCGACGGCCCCGTAATGCAGAAGAAGACCATGGGCTGGGAGGCCTCCTCCGAGCGGATGTACCCCGAGGACGGCGCCCTGAAGGGCGAGATCAAGCAGAGGCTGAAGCTGAAGGACGGCGGCCACTACGACGCTGAGGTCAAGACCACCTACAAGGCCAAGAAGCCCGTGCAGCTGCCCGGCGCCTACAACGTCAACATCAAGTTGGACATCACCTCCCACAACGAGGACTACACCATCGTGGAACAGTACGAACGCGCCGAGGGCCGCCACTCCACCGGCGGCATGGACGAGCTGTACAAGTAG | |
| Sequence-based reagent | moxFS | this paper | ATGcgcaTCTAAAGGTGAAGAATTATTCACTGGTGTTGTCCCAATTTTGGTTGAATTAGATGGTGATGTTAATGGTCACAAATTTTCTGTCcgtGGTGAAGGTGAAGGTGATGCTACTaAtGGTAAATTGACCTTAAAATTTATTTcTACTACTGGTAAATTGCCAGTTCCATGGCCAACCTTAGTCACTACTTTAACTTATGGTGTTCAATcTTTTTCTAGATACCCAGATCATATGAAACgtCATGACTTTTTCAAGTCTGCCATGCCAGAAGGTTATGTTCAAGAAAGAACTATTTcTTTCAAAGATGACGGTActTACAAGACCAGAGCTGAAGTCAAGTTTGAAGGTGATACCTTAGTTAATAGAATCGAATTAAAAGGTATTGATTTTAAAGAAGATGGTAACATTTTAGGTCACAAATTGGAATACAACTtcAACTCTCACAATGTTTACATCActGCTGACAAACAAAAGAATGGTATCAAAGcTAACTTCAAAATTAGACACAACgtTGAAGATGGTTCTGTTCAATTAGCTGACCATTATCAACAAAATACTCCAATTGGTGATGGTCCAGTCTTGTTACCAGACAACCATTACTTATCCACTCAATCTcgtTTATCCAAAGATCCAAACGAAAAGAGAGACCACATGGTCTTGTTAGAATTTGTTACTGCTGCTGGTATTACCCATGGTATGGATGAATTGTACAAATAA | |
| Sequence-based reagent | mox-Y66G+Y | this paper | ATGTCTAAAGGTGAAGAATTATTCACTGGTGTTGTCCCAATTTTGGTTGAATTAGATGGTGATGTTAATGGTCACAAATTTTCTGTCcgtGGTGAAGGTGAAGGTGATGCTACTaAtGGTAAATTGACCTTAAAATTTATTTcTACTACTGGTAAATTGCCAGTTCCATGGCCAACCTTAGTCACTACTTTAACTggTGGTGTTCAATcTTTTTCTAGATACCCAGATCATATGAAACgtCATGACTTTTTCAAGTCTGCCATGCCAGAAGGTTATGTTCAAGAAAGAACTATTTcTTTCAAAGATGACGGTActTACAAGACCAGAGCTGAAGTCAAGTTTGAAGGTGATACCTTAGTTAATAGAATCGAATTAAAAGGTATTGATTTTAAAGAAGATGGTAACATTTTAGGTCACAAATTGGAATACAACTtcAACTCTCACAATGTTTACATCActGCTGACAAACAAAAGAATGGTATCAAAGcTAACTTCAAAATTAGACACAACgtTGAAGATGGTTCTGTTCAATTAGCTGACCATTATCAACAAAATACTCCAATTGGTGATGGTCCAGTCTTGTTACCAGACAACCATTACTTATCCACTCAATCTcgtTTATCCAAAGATCCAAACGAAAAGAGAGACCACATGGTCTTGTTAGAATTTGTTACTGCTGCTGGTATTACCCATGGTATGGATGAATTGTACAAATATTAA | |
| Sequence-based reagent | GFP-binding protein | PMID:17060912 | GCTCAAGTTCAATTGGTTGAATCTGGTGGTGCTTTGGTTCAACCAGGTGGTTCTTTGAGATTGTCTTGTGCTGCTTCTGGTTTCCCAGTTAACAGATACTCTATGAGATGGTACAGACAAGCTCCAGGTAAGGAAAGAGAATGGGTTGCTGGTATGTCTTCTGCTGGTGACAGATCTTCTTACGAAGACTCTGTTAAGGGTAGATTCACTATTTCTAGAGACGACGCTAGAAACACTGTTTACTTGCAAATGAACTCTTTGAAGCCAGAAGACACTGCTGTTTACTACTGTAACGTTAACGTTGGTTTCGAATACTGGGGTCAAGGTACTCAAGTTACTGTTTCTTCTAAGTAA | |
| Sequence-based reagent | mox-T203I | this paper | ATGTCTAAAGGTGAAGAATTATTCACTGGTGTTGTCCCAATTTTGGTTGAATTAGATGGTGATGTTAATGGTCACAAATTTTCTGTCcgtGGTGAAGGTGAAGGTGATGCTACTaAtGGTAAATTGACCTTAAAATTTATTTcTACTACTGGTAAATTGCCAGTTCCATGGCCAACCTTAGTCACTACTTTAACTTATGGTGTTCAATcTTTTTCTAGATACCCAGATCATATGAAACgtCATGACTTTTTCAAGTCTGCCATGCCAGAAGGTTATGTTCAAGAAAGAACTATTTcTTTCAAAGATGACGGTActTACAAGACCAGAGCTGAAGTCAAGTTTGAAGGTGATACCTTAGTTAATAGAATCGAATTAAAAGGTATTGATTTTAAAGAAGATGGTAACATTTTAGGTCACAAATTGGAATACAACTtcAACTCTCACAATGTTTACATCActGCTGACAAACAAAAGAATGGTATCAAAGcTAACTTCAAAATTAGACACAACgtTGAAGATGGTTCTGTTCAATTAGCTGACCATTATCAACAAAATACTCCAATTGGTGAGGTCCAGTCTTGTTACCAGACAACCATTACTTATCCAtTCAATCTcgtTTATCCAAAGATCCAAACGAAAAGAGAGACCACATGGTCTTGTTAGAATTTGTTACTGCTGCTGGTATTACCCATGGTATGGATGAATTGTACAAATAA | |
| Sequence-based reagent | mox-T65S | this paper | ATGTCTAAAGGTGAAGAATTATTCACTGGTGTTGTCCCAATTTTGGTTGAATTAGATGGTGATGTTAATGGTCACAAATTTTCTGTCcgtGGTGAAGGTGAAGGTGATGCTACTaAtGGTAAATTGACCTTAAAATTTATTTcTACTACTGGTAAATTGCCAGTTCCATGGCCAACCTTAGTCACTACTTTATCTTATGGTGTTCAATcTTTTTCTAGATACCCAGATCATATGAAACgtCATGACTTTTTCAAGTCTGCCATGCCAGAAGGTTATGTTCAAGAAAGAACTATTTcTTTCAAAGATGACGGTActTACAAGACCAGAGCTGAAGTCAAGTTTGAAGGTGATACCTTAGTTAATAGAATCGAATTAAAAGGTATTGATTTTAAAGAAGATGGTAACATTTTAGGTCACAAATTGGAATACAACTtcAACTCTCACAATGTTTACATCActGCTGACAAACAAAAGAATGGTATCAAAGcTAACTTCAAAATTAGACACAACgtTGAAGATGGTTCTGTTCAATTAGCTGACCATTATCAACAAAATACTCCAATTGGTGATGGTCCAGTCTTGTTACCAGACAACCATTACTTATCCACTCAATCTcgtTTATCCAAAGATCCAAACGAAAAGAGAGACCACATGGTCTTGTTAGAATTTGTTACTGCTGCTGGTATTACCCATGGTATGGATGAATTGTACAAATAA | |
| Sequence-based reagent | mScarlet-I | this paper | ATGGTTTCTAAGGGTGAAGCTGTTATTAAGGAATTCATGAGATTCAAGGTTCACATGGAAGGTTCTATGAACGGTCACGAATTCGAAATTGAAGGTGAAGGTGAAGGTAGACCATACGAAGGTACTCAAACTGCTAAGTTGAAGGTTACTAAGGGTGGTCCATTGCCATTCTCTTGGGACATTTTGTCTCCACAATTCATGTACGGTTCTAGAGCTTTCAtTAAGCACCCAGCTGACATTCCAGACTACTACAAGCAATCTTTCCCAGAAGGTTTCAAGTGGGAAAGAGTTATGAACTTCGAAGACGGTGGTGCTGTTACTGTTACTCAAGACACTTCTTTGGAAGACGGTACTTTGATTTACAAGGTTAAGTTGAGAGGTACTAACTTCCCACCAGACGGTCCAGTTATGCAAAAGAAGACTATGGGTTGGGAAGCTTCTACTGAAAGATTGTACCCAGAAGACGGTGTTTTGAAGGGTGACATTAAGCACGCTTTGAGATTGAAGGACGGTGGTAGATACTTGGCTGACTTCAAGACTACTTACAAGGCTAAGAAGCCAGTTCAAATGCCAGGTGCTTACAACGTTGACAGAAAGTTGGACATTACTTCTCACAACGAAGACTACACTGTTGTTGAACAATACGAAAGATCTGAAGGTAGACACTCTACTGGTGGTATGGACGAATTGTACAAGTAA | |
| Sequence-based reagent | GPM1 | PMID:30095406 | ATGCCAAAGTTAGTTTTAGTTAGACACGGTCAATCCGAATGGAACGAAAAGAACTTATTCACCGGTTGGGTTGATGTTAAATTGTCTGCCAAGGGTCAACAAGAAGCCGCTAGAGCCGGTGAATTGTTGAAGGAAAAGAAGGTCTACCCAGACGTCTTGTACACTTCCAAGTTGTCCAGAGCTATCCAAACTGCTAACATTGCTTTGGAAAAGGCTGACAGATTATGGATTCCAGTCAACAGATCCTGGAGATTGAACGAAAGACATTACGGTGACTTACAAGGTAAGGACAAGGCTGAAACTTTGAAGAAGTTCGGTGAAGAAAAATTCAACACCTACAGAAGATCCTTCGATGTTCCACCTCCCCCAATCGACGCTTCTTCTCCATTCTCTCAAAAGGGTGATGAAAGATACAAGTACGTTGACCCAAATGTCTTGCCAGAAACTGAATCTTTGGCTTTGGTCATTGACAGATTGTTGCCATACTGGCAAGATGTCATTGCCAAGGACTTGTTGAGTGGTAAGACCGTCATGATCGCCGCTCACGGTAACTCCTTGAGAGGTTTGGTTAAGCACTTGGAAGGTATCTCTGATGCTGACATTGCTAAGTTGAACATCCCAACTGGTATTCCATTGGTCTTCGAATTGGACGAAAACTTGAAGCCATCTAAGCCATCTTACTACTTGGACCCAGAAGCTGCCGCTGCTGGTGCCGCTGCTGTTGCCAACCAAGGTAAGAAATAA | |
| Sequence-based reagent | TDH3 | PMID:30095406 | ATGGTTAGAGTTGCTATTAACGGTTTCGGTAGAATCGGTAGATTGGTCATGAGAATTGCTTTGTCTAGACCAAACGTCGAAGTTGTTGCTTTGAACGACCCATTCATCACCAACGACTACGCTGCTTACATGTTCAAGTACGACTCCACTCACGGTAGATACGCTGGTGAAGTTTCCCACGATGACAAGCACATCATTGTCGATGGTAAGAAGATTGCTACTTACCAAGAAAGAGACCCAGCTAACTTGCCATGGGGTTCTTCCAACGTTGACATCGCCATTGACTCCACTGGTGTTTTCAAGGAATTAGACACTGCTCAAAAGCACATTGACGCTGGTGCCAAGAAGGTTGTTATCACTGCTCCATCTTCCACCGCCCCAATGTTCGTCATGGGTGTTAACGAAGAAAAATACACTTCTGACTTGAAGATTGTTTCCAACGCTTCTTGTACCACCAACTGTTTGGCTCCATTGGCCAAGGTTATCAACGATGCTTTCGGTATTGAAGAAGGTTTGATGACCACTGTCCACTCTTTGACTGCTACTCAAAAGACTGTTGACGGTCCATCCCACAAGGACTGGAGAGGTGGTAGAACCGCTTCCGGTAACATCATCCCATCCTCCACCGGTGCTGCTAAGGCTGTCGGTAAGGTCTTGCCAGAATTGCAAGGTAAGTTGAagGGTATGGCTTTCAGAGTCCCAACCGTCGATGTCTCCGTTGTTGACTTGACTGTCAAGTTGAACAAGGAAACCACCTACGATGAAATCAAGAAGGTTGTTAAGGCTGCCGCTGAAGGTAAGTTGAAGGGTGTTTTGGGTTACACCGAAGACGCTGTTGTCTCCTCTGACTTCTTGGGTGACTCTCACTCTTCCATCTTCGATGCTTCCGCTGGTATCCAATTGTCTCCAAAGTTCGTCAAGTTGGTCTCCTGGTACGACAACGAATACGGTTACTCTACCAGAGTTGTCGACTTGGTTGAACACGTTGCCAAGGCTTAA | |
| Sequence-based reagent | GPM1–CCmut | PMID:1386023 | ATGCCAAAGTTAGTTTTAGTTAGACACGGTCAATCCGAATGGAACGAAAAGAACTTATTCACCGGTTGGGTTGATGTTAAATTGTCTGCCAAGGGTCAACAAGAAGCCGCTAGAGCCGGTGAATTGTTGAAGGAAAAGAAGGTCTACCCAGACGTCTTGTACACTTCCAAGTTGTCCAGAGCTATCCAAACTGCTAACATTGCTTTGGAAAAGGCTGACAGATTATGGATTCCAGTCAACAGATCCTGGAGATTGAACGAAAGACATTACGGTGACTTACAAGGTAAGGACAAGGCTGAAACTTTGAAGAAGTTCGGTGAAGAAAAATTCAACACCTACAGAAGATCCTTCGATGTTCCACCTCCCCCAATCGACGCTTCTTCTCCATTCTCTCAAAAGGGTGATGAAAGATACAAGTACGTTGACCCAAATGTCTTGCCAGAAACTGAATCTTTGGCTTTGGTCATTGACAGATTGTTGCCATACTGGCAAGATGTCATTGCCAAGGACTTGTTGAGTGGTAAGACCGTCATGATCGCCGCTgcCGGTAACTCCTTGAGAGGTTTGGTTAAGCACTTGGAAGGTATCTCTGATGCTGACATTGCTAAGTTGAACATCCCAACTGGTATTCCATTGGTCTTCGAATTGGACGAAAACTTGAAGCCATCTAAGCCATCTTACTACTTGGACCCAGAAGCTGCCGCTGCTGGTGCCGCTGCTGTTGCCAACCAAGGTAAGAAATAA | |
| Sequence-based reagent | TDH3-CCmut | PMID:25580853 | ATGGTTAGAGTTGCTATTAACGGTTTCGGTAGAATCGGTAGATTGGTCATGAGAATTGCTTTGTCTAGACCAAACGTCGAAGTTGTTGCTTTGAACGACCCATTCATCACCAACGACTACGCTGCTTACATGTTCAAGTACGACTCCACTCACGGTAGATACGCTGGTGAAGTTTCCCACGATGACAAGCACATCATTGTCGATGGTAAGAAGATTGCTACTTACCAAGAAAGAGACCCAGCTAACTTGCCATGGGGTTCTTCCAACGTTGACATCGCCATTGACTCCACTGGTGTTTTCAAGGAATTAGACACTGCTCAAAAGCACATTGACGCTGGTGCCAAGAAGGTTGTTATCACTGCTCCATCTTCCACCGCCCCAATGTTCGTCATGGGTGTTAACGAAGAAAAATACACTTCTGACTTGAAGATTGTTTCCAACGCTTCTTcTACCACCAACTGTTTGGCTCCATTGGCCAAGGTTATCAACGATGCTTTCGGTATTGAAGAAGGTTTGATGACCACTGTCCACTCTTTGACTGCTACTCAAAAGACTGTTGACGGTCCATCCCACAAGGACTGGAGAGGTGGTAGAACCGCTTCCGGTAACATCATCCCATCCTCCACCGGTGCTGCTAAGGCTGTCGGTAAGGTCTTGCCAGAATTGCAAGGTAAGTTGACCGGTATGGCTTTCAGAGTCCCAACCGTCGATGTCTCCGTTGTTGACTTGACTGTCAAGTTGAACAAGGAAACCACCTACGATGAAATCAAGAAGGTTGTTAAGGCTGCCGCTGAAGGTAAGTTGAAGGGTGTTTTGGGTTACACCGAAGACGCTGTTGTCTCCTCTGACTTCTTGGGTGACTCTCACTCTTCCATCTTCGATGCTTCCGCTGGTATCCAATTGTCTCCAAAGTTCGTCAAGTTGGTCTCCTGGTACGACAACGAATACGGTTACTCTACCAGAGTTGTCGACTTGGTTGAACACGTTGCCAAGGCTTAA | |
| Commercial assay, kit | Qubit RNA BR assay kit | ThermoFisher Scientific | Q10210 | RNA Quantification |
| Commercial assay, kit | EzLabel FluoroNeo | ATTO | WSE-7010 | Protein labeling |
| Commercial assay, kit | NuPAGE LDS sample buffer | ThermoFisher Scientific | NP0007 | Protein extraction |
| Commercial assay, kit | NuPAGE Bis-Tris Mini Protein Gels, 4–12%, 1.0 mm | ThermoFisher Scientific | NP0322BOX | |
| Commercial assay, kit | NuPAGE MOPS SDS Running Buffer(20 X) | ThermoFisher Scientific | NP0001 | |
| Commercial assay, kit | Qubit RNA BR assay kit | ThermoFisher Scientific | Q10210 | Quantification of RNA quantity |
| Commercial assay, kit | Extracellular OCR Plate Assay Kit | DOJINDO | E297 | Mesurement of oxygen consumption |
| Commercial assay, kit | Immobilon -P membrane, PVDF, 0.45 µm, 26 x 26 cm sheet | Millipore | #IPVH304F0 | |
| Chemical compound, drug | Hydrogen peroxide 30% | Santoku chemical industries | ||
| Chemical compound, drug | D(-)-sorbitol | Wako | ||
| Chemical compound, drug | Aureobasidin A | TAKARA | ||
| Chemical compound, drug | Rapamycin | Wako | ||
| Chemical compound, drug | Glycerol | nacalai tesque | ||
| Chemical compound, drug | Antimycin A | Abcam | ||
| Chemical compound, drug | Chemiluminescent substrates | Millipore | #WBLUF0100 | |
| Antibody | α-Atg13 | PMID:10995454 | 1:3000 | |
| Antibody | peroxidase-conjugated goat anti-rabbit secondary antibodies | Jackson ImmunoResearch | #111–035–003 | 1:10000 |
| Software, algorithm | FastP (0.20.0) | PMID:30423086 | ||
| Software, algorithm | Hisat2 (2.2.0) | PMID:31375807 | ||
| Software, algorithm | Samtools (1.11) | PMID:19505943 | ||
| Software, algorithm | Stringtie (2.1.2) | PMID:25690850 | ||
| Software, algorithm | EdgeR (3.28.1) | PMID:19910308 | ||
| Software, algorithm | YeastSpotter | PMID:31095270 | ||
| Software, algorithm | Cellprofiler (4.2.6) | PMID:17269487 | ||
| Software, algorithm | Image Quant TL | GE Healthcare | version 4.0.7 | |
| Software, algorithm | LASX | Leica | ||
| Software, algorithm | Proteomaps | PMID:24889604 | http://bionic-vis.biologie.uni-greifswald.de/ | |
| Other | LAS-4000 | GE Healthcare | ||
| Other | DMI6000B | Leica | ||
| Other | MultiNA | Shimazu | #TVS062CA | |
| Other | COMPACT ROCKING INCUBATOR | ADVANTEC | ||
| Other | Infinite F200PRO | TECAN | ||
| Other | MegaLight 100 | SCHOTT | ||
| Other | Mini Gel Tank | ThermoFisher Scientific | #A25977 | |
| Other | Light–Capture II | ATTO | ||
| Sequence-based reagent (primer) | Y66G_f | this paper | CCTTAGTCACTACTTTAACTggTGGTGTTCAATcTTTTTCTA | |
| Sequence-based reagent (primer) | Y66G_r | this paper | TAGAAAAAgATTGAACACCAccAGTTAAAGTAGTGACTAAGG | |
| Sequence-based reagent (primer) | mCherry_Y72G_f | this paper | TTTTGTCACCACAATTTATGggTGGTTCAAAAGCTTATGTTA | |
| Sequence-based reagent (primer) | mCherry_Y72G_r | this paper | TAACATAAGCTTTTGAACCAccCATAAATTGTGGTGACAAAA | |
| Sequence-based reagent (primer) | mCherry-Kafri_Y72G_f | this paper | CTGTCCCCTCAGTTCATGggCGGCTCCAAGGCCTACGTGAAG | |
| Sequence-based reagent (primer) | mCherry-Kafri_Y72G_r | this paper | CTTCACGTAGGCCTTGGAGCCGccCATGAACTGAGGGGACAG | |
| Sequence-based reagent (primer) | moxGFP+Y_f | this paper | GTATGGATGAATTGTACAAATATTAAgtgaatttactttaaat | |
| Sequence-based reagent (primer) | moxGFP+Y_r | this paper | atttaaagtaaattcacTTAATATTTGTACAATTCATCCATAC | |
| Sequence-based reagent (primer) | T65S_f | this paper | TTAGTCACTACTTTATcTTATGGTGTTCAATcT | |
| Sequence-based reagent (primer) | T65S_r | this paper | AgATTGAACACCATAAgATAAAGTAGTGACTAA | |
| Sequence-based reagent (primer) | ACT1pro_f | this paper | TGATGAGAGCCAGCTTAAAGAGTTAAAAATTTCATAGCTAaacaccggtgggggctgctg | |
| Sequence-based reagent (primer) | ACT1pro_r | this paper | ACAGCTTCACCCTTAGAAACCATtgttaattcagtaaattttcgatct | |
| Sequence-based reagent (primer) | TDH3pro_f | this paper | TGATGAGAGCCAGCTTAAAGAGTTAAAAATTTCATAGCTAgtaagggagttagaatcattttg | |
| Sequence-based reagent (primer) | TDH3pro_r | this paper | GTATGGACGAATTGTACAAGTAAgtgaatttactttaaatcttgcatt | |
| Sequence-based reagent (primer) | YAP5pro_f | this paper | TAACAGCTTCACCCTTAGAAACCATgactgtgataatatgctagttacac | |
| Sequence-based reagent (primer) | YAP5pro_r | this paper | TAACAGCTTCACCCTTAGAAACCATgactgtgataatatgctagttacac | |
| Sequence-based reagent (primer) | PHO84pro_f | this paper | TGATGAGAGCCAGCTTAAAGAGTTAAAAATTTCATAGCTAcacttcgtttttttaccgtttagta | |
| Sequence-based reagent (primer) | PHO84pro_r | this paper | TAACAGCTTCACCCTTAGAAACCATttggattgtattcgtggagttttgt | |
| Sequence-based reagent (primer) | ZPS1pro_f | this paper | TGATGAGAGCCAGCTTAAAGAGTTAAAAATTTCATAGCTActtcttgctagtatatatgacatac | |
| Sequence-based reagent (primer) | ZPS1pro_r | this paper | TAACAGCTTCACCCTTAGAAACCATaatgtttagtagttgtgtgtggatt | |
| Sequence-based reagent (primer) | ADE17pro_f | this paper | TGATGAGAGCCAGCTTAAAGAGTTAAAAATTTCATAGCTAtcgttatggaggtatagaaaatgaa | |
| Sequence-based reagent (primer) | ADE17pro_r | this paper | TAACAGCTTCACCCTTAGAAACCATatttgatggtgatatgtgctttgat | |
| Sequence-based reagent (primer) | CTR1pro_f | this paper | TGATGAGAGCCAGCTTAAAGAGTTAAAAATTTCATAGCTAtttttccgcaaggccgcattttgaa | |
| Sequence-based reagent (primer) | CTR1pro_r | this paper | TAACAGCTTCACCCTTAGAAACCATtttgaatgtcaaatataatacactt | |
| Sequence-based reagent (primer) | FIT2pro_f | this paper | TGATGAGAGCCAGCTTAAAGAGTTAAAAATTTCATAGCTAtaccgaaatgacgaaatatactg | |
| Sequence-based reagent (primer) | FIT2pro_r | this paper | TAACAGCTTCACCCTTAGAAACCATtattattgttttgtgatggctttat | |
| Sequence-based reagent (primer) | HXT7pro_f | this paper | TGATGAGAGCCAGCTTAAAGAGTTAAAAATTTCATAGCTAaatagtactctcatcgctaagat | |
| Sequence-based reagent (primer) | HXT7pro_r | this paper | TAACAGCTTCACCCTTAGAAACCATtttttgattaaaattaaaaaaactttttgtttttgtg | |
| Sequence-based reagent (primer) | CUP1pro_f | this paper | TGATGAGAGCCAGCTTAAAGAGTTAAAAATTTCATAGCTAgtcttttgctggcatttcttctaga | |
| Sequence-based reagent (primer) | CUP1pro_r | this paper | TAACAGCTTCACCCTTAGAAACCATgctgaatattttatgtgatgattga | |
| Sequence-based reagent (primer) | OM14pro_f | this paper | TGATGAGAGCCAGCTTAAAGAGTTAAAAATTTCATAGCTAtaactggtataattcgtttctcatg | |
| Sequence-based reagent (primer) | OM14pro_r | this paper | TAACAGCTTCACCCTTAGAAACCATattatgagatgctggaggtagatgt | |
| Sequence-based reagent (primer) | OM45pro_f | this paper | TGATGAGAGCCAGCTTAAAGAGTTAAAAATTTCATAGCTAtaaagataacaaattatcagacatg | |
| Sequence-based reagent (primer) | OM45pro_r | this paper | TAACAGCTTCACCCTTAGAAACCATccttatctgcttgttttattaaatg | |
| Sequence-based reagent (primer) | AGP1pro_f | this paper | TGATGAGAGCCAGCTTAAAGAGTTAAAAATTTCATAGCTAtatcctagagcccaatgttccatga | |
| Sequence-based reagent (primer) | AGP1pro_r | this paper | TAACAGCTTCACCCTTAGAAACCATtgtgcgaagctatctttgtctatat | |
| Sequence-based reagent (primer) | GAP1pro_f | this paper | TGATGAGAGCCAGCTTAAAGAGTTAAAAATTTCATAGCTAcattgatagataaatcaacacagaa | |
| Sequence-based reagent (primer) | GAP1pro_r | this paper | TAACAGCTTCACCCTTAGAAACCATtttttatttcttttttttgtttcttataaatgttgctgtc | |
| Sequence-based reagent (primer) | HXT1pro_f | this paper | TGATGAGAGCCAGCTTAAAGAGTTAAAAATTTCATAGCTAgccacaatgaaacttcaattcatat | |
| Sequence-based reagent (primer) | HXT1pro_r | this paper | TAACAGCTTCACCCTTAGAAACCATgattttacgtatatcaactagttga | |
| Sequence-based reagent (primer) | RIP1pro_f | this paper | TGATGAGAGCCAGCTTAAAGAGTTAAAAATTTCATAGCTAgtcatgtatttctttccgctttagg | |
| Sequence-based reagent (primer) | RIP1_r | this paper | TAACAGCTTCACCCTTAGAAACCATaccaacaatgaccttatcaccatc | |
| Sequence-based reagent (primer) | NSR1pro_f | this paper | TGATGAGAGCCAGCTTAAAGAGTTAAAAATTTCATAGCTAttccaaactggttcattgaaatagg | |
| Sequence-based reagent (primer) | NSR1_r | this paper | TAACAGCTTCACCCTTAGAAACCATatcaaatgttttctttgaac | |
| Sequence-based reagent (primer) | mScarlet-I_f | this paper | ATGGTTTCTAAGGGTGAAGC | |
| Sequence-based reagent (primer) | HIS3MX6_r | this paper | TATATAAAATTAAATACGTAAATACAGCGTGCTGCGTGCTagctcgtttaaactggatgg | |
| Sequence-based reagent (primer) | ATG13pro_f | this paper | cggccgctctagaactagtGGATCCGATGCCTACGAAGATGATTC | |
| Sequence-based reagent (primer) | ATG13ter_r | this paper | attgggtaccgggccccccCTCGAGACGCAGTCAGCGGGTGACAA |
Additional files
-
MDAR checklist
- https://cdn.elifesciences.org/articles/99572/elife-99572-mdarchecklist1-v1.docx
-
Source data 1
Processed RNA-seq data.
- https://cdn.elifesciences.org/articles/99572/elife-99572-data1-v1.csv
-
Source data 2
Raw intensity data of proteome analysis.
- https://cdn.elifesciences.org/articles/99572/elife-99572-data2-v1.csv
Download links
A two-part list of links to download the article, or parts of the article, in various formats.
Downloads (link to download the article as PDF)
Open citations (links to open the citations from this article in various online reference manager services)
Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)
Impact of maximal overexpression of a non-toxic protein on yeast cell physiology
eLife 13:RP99572.
https://doi.org/10.7554/eLife.99572.3
