Table 4. | Lipid-mediated regulation of SKN-1/Nrf in response to germ cell absence

Open accessCopyright infoDownload PDFDownload figuresRelated content

Lipid-mediated regulation of SKN-1/Nrf in response to germ cell absence

Table 4.

Affiliation details

Joslin Diabetes Center, United States; Harvard Medical School, United States; Boston University, United States
Table 4.

qRT-PCR primers used in this study

DOI: http://dx.doi.org/10.7554/eLife.07836.021

GeneSequenceAnnotationPrimer pair
gst-4K08F4.7Glutathione S-transferaseFWD: CCCATTTTACAAGTCGATGG
REV: CTTCCTCTGCAGTTTTTCCA
F20D6.11F20D6.11Flavin-adenine dinucleotide (FAD)-binding oxidoreductaseFWD: GGAAATTCTCGGTAGAATCGAA
REV: ACGATCACGAACTTCGAACA
nit-1ZK1058.6NitrilaseFWD: AATCCTCCGACTATCCCTTG
REV: AGCGAATCGTTTCTTTTGTG
rpn-6.1F57B9.1019S non-ATPase subunitFWD: AATATTGGAAAAGCACCTGAAATGT
REV: TTTGATGTGGAAGTGAAGTCATTGT
lipl-3R11G11.14Lysosomal triglyceride lipaseFWD: ATGGGCAGGCAAATCCACCA
REV: AGTTGTTCTGCGCAATTATA
*cdc-42R07G3.1Housekeeping geneFWD: CTGCTGGACAGGAAGATTACG
REV: CTCGGACATTCTCGAATGAAG
*Y45F10D.4Y45F10D.4Housekeeping geneFWD: GTCGCTTCAAATCAGTTCAG
CREV: GTTCTTGTCAAGTGATCCGACA
  • Select primer sequences were obtained from previous publications (Robida-Stubbs et al., 2012; Vilchez et al., 2012; O'Rourke and Ruvkun, 2013).