Abstract
Diabetes is a known risk factor for tuberculosis (TB), but clinical evidences suggest that TB itself can induce hyperglycaemia and insulin resistance, though the underlying mycobacterial factors are not known. Herein, we implicate PPE2, a secretory PE/PPE family protein of Mycobacterium tuberculosis (Mtb), as a key modulator of adipose tissue physiology that contributes to the development of insulin resistance. In mice, PPE2 caused fat loss, adipocyte hypertrophy, immune cell infiltration, impaired glucose tolerance, reduced expression of PPAR-γ, C/EBP-α, adiponectin and higher insulin resistance. Transcriptomic analysis revealed PPE2 altered expression of genes associated with chemokine/cytokine, ribosomal biogenesis and lipase signaling. PPE2 induced lipolysis by activating cAMP–PKA–HSL axis, increased circulating free fatty acids, a feature also observed in TB patient sera. Interestingly, PPE2-immunization mitigated these effects, suggesting its potential as a subunit vaccine. Overall, this study identifies PPE2 as a key link between Mtb-infection, adipose tissue dysfunction and insulin resistance.
Introduction
Mycobacterium tuberculosis (Mtb) remains one of the deadliest bacterial pathogens, causing approximately 1.5 million deaths annually. Each year, over 10 million people are infected, but about 5-10% of them develop clinical symptoms of active tuberculosis (TB) disease (World Health Organization, 2023). In the majority of cases, the bacilli enter a dormant phase during which individuals test positive on immunologic tests but do not exhibit clinical symptoms, a condition referred as latent tuberculosis (Lin and Flynn, 2010). Latent tuberculosis can reactivate into active tuberculosis when the immune system becomes compromised due to factors such as undernutrition, smoking, HIV co-infection, use of immunosuppressive drugs and diabetes (Ai et al., 2016). It has been found that people with diabetes are 1.5-2.4 times higher risk of developing TB (Franco et al., 2024) and diabetes is responsible for 10.6% of the total TB deaths (Kyu et al., 2018). The co-occurrence of tuberculosis and diabetes (TB-DM) complicates TB treatment and drastically worsens disease outcomes. Several studies have reported that TB can exacerbate the development and severity of diabetes-associated complications (Magee et al., 2018; Mugusi et al., 1990). The TB-DM co-occurrence is a growing global health concern with an established bidirectional relationship between the two conditions (Khattak et al., 2024; Gautam et al., 2021). Diabetes is a well-known risk factor for tuberculosis with an estimated global prevalence of 15.3% among TB patients, varying by country of origin, age, sex, region, level of country income and development (Noubiap et al., 2019). The prevalence of diabetes in Nigeria (15%), Tanzania (11%), and Ethiopia (10%) (Alebel et al., 2019) is notable while in India it is as high as 25.3% (Viswanathan et al., 2012), which has the second largest number of diabetic patients in the world (International Diabetes Federation, 2025).
Several clinical studies indicate that TB patients are prone to develop insulin resistance and hyperglycemia. In a Nigerian study, it has been found that about 37% of the patients with active pulmonary TB had impaired glucose tolerance, which could be reversed during anti-tuberculosis treatment (Oluboyo and Erasmus, 1990). More recently many studies have shown that TB patients with no known history of diabetes can develop hyperglycemia (Magee et al., 2018; Lin et al., 2017). Though transient hyperglycemia is commonly observed in many TB patients, 8-87% of TB patients are newly diagnosed with dysglycemia without a prior history (Mave et al., 2017; Magee et al., 2018).
Development of hyperglycemia, glucose intolerance and insulin resistance can generally be attributed to metabolic changes, induction of pro-inflammatory conditions in the host, and dysregulation of adipose tissue functions (Guilherme et al., 2008). Interestingly, Mtb is known to persist in the adipose tissue and to regulate pulmonary pathology and has been implicated in tuberculosis and changes in adipose tissue behavior (Erol, 2008; Neyrolles et al., 2006; Beigier-bompadre et al., 2017). Mtb persistence in adipose tissue is known to cause adipocyte hypertrophy, lipolysis, changes in physiology and infiltration of immune cells in adipose tissue (Beigier-bompadre et al., 2017; Bisht et al., 2023a). Monocyte chemoattractant protein-1 (MCP-1) expression was found to be higher in mycobacterium-infected visceral adipose, which has been linked to increased immune cell infiltration, insulin resistance and hepatic steatosis (Kanda et al., 2006). Adipose tissue-resident Mtb is known to alter its physiology which may cause a shift in the metabolism of fatty acids (Neyrolles et al., 2006; Beigier-bompadre et al., 2017; Erol, 2008).
Though direct interaction between Mtb and host adipose tissue exists, the nature and outcome of such interaction are not well understood. Therefore, we speculated that certain Mtb factors/proteins, which are either exposed on the cell wall or secreted into the host circulation or directly released into the adipose tissue milieu by resident Mtb, are likely to be involved in modulating adipose tissue physiology and functions. In this study, we investigated the role of a secretory mycobacterial protein, PPE2, in the modulation of adipose tissue physiology and functions. PPE2 belongs to the PE/PPE family and possesses a nuclear localization signal sequence and a leucine zipper DNA-binding motif, and is secreted during Mtb infection in mice (Bhat et al., 2013; Bhat et al, 2017; Abraham et al., 2014; Bisht et al., 2023b). PPE2 appears to be a pleiotropic protein and plays an important role in mycobacterial virulence (Srivastava et al., 2019; Pal et al., 2021). It inhibits nitric oxide (NO) production by binding to the GATA-1-like elements in the iNOS promoter, inhibits the production of reactive oxygen species (ROS) by destabilizing NADPH-oxidase complex, as well as inhibits myelopoiesis to reduce the production of myeloid cells like leukocytes, mast cells, platelets and red blood cells (RBCs) (Bhat et al., 2017; Srivastava et al., 2019; Pal et al., 2021; Pal and Mukhopadhyay, 2021).
To the best of our knowledge, for the first time, our study provides evidence that PPE2 can modulate gene expression and adipose tissue functions leading to glucose intolerance and hyperglycemia. Using recombinantly purified protein, a surrogate non-pathogenic mycobacterium expressing PPE2 and a ppe2-null mutant of a clinical M. tuberculosis strain (CDC1551), we have shown that PPE2 interferes with adipogenesis by inhibiting adipogenic transcription factors, inhibiting adipokines and promoting adipocyte hypertrophy and lipolysis, which can lead to the development of impaired glucose intolerance and insulin resistance.
Results
1. Recombinant PPE2 protein (rPPE2) inhibits differentiation of adipocytes
Mycobacterium tuberculosis has been previously reported to inhibit adipogenic transcription factors like PPAR-γ and adipocyte secreted proteins like adiponectin, in the adipose tissue of infected mice (Ayyappan et al., 2019). PPE2 has been identified to be a secretory protein (Bhat et al., 2013; Pal et al., 2022), and its presence has been demonstrated in the bloodstream of mice infected with M. smegmatis and M. tuberculosis (Bisht et al., 2023b). Therefore, it is speculated that PPE2 may exert a systemic effect on the regulation of adipose tissue functions and thereby may contribute to diabetes-related complications. Therefore, to investigate the impact of PPE2 on adipogenesis, differentiation of 3T3-L1 pre-adipocyte was carried out in the presence of recombinantly purified PPE2 protein (rPPE2). Accordingly, 3T3-L1 cells were treated with a differentiation cocktail medium (Sadowski et al., 1992), in the absence or presence of various concentrations of rPPE2 and triglyceride accumulation was measured using Oil Red O staining at day 10 post-treatment. In the presence of rPPE2, the intensity of Oil Red O staining was found to be decreased in a concentration-dependent manner (Figure 1A, B), suggesting that PPE2 inhibits adipocyte differentiation. Significant inhibition was observed at rPPE2 concentration of 3 µg/ml, which was used for subsequent experiments. No cytotoxic effect of rPPE2 was observed when the 3T3-L1 preadipocytes were treated for 48 hours (Figure S1), suggesting that the observed inhibition of adipogenesis was due to physiological effect of rPPE2. To further confirm the specificity of inhibition, 3 µg/ml and 5 µg/ml of anti-PPE2 antibody (in house raised in Balb/c mice (Bisht et al., 2023b)) was used to neutralize the effect of rPPE2 during differentiation. It was found that, in the presence of anti-PPE2 Ab, the inhibitory effect of rPPE2 on adipogenesis was neutralised in a concentration-dependent manner (Figure 1C).

Recombinantly purified PPE2 protein of M. tuberculosis (rPPE2) inhibits differentiation of 3T3-L1 cells into adipocytes.
(A) 3T3-L1 cells were treated with different concentrations of rPPE2 and induced to differentiate using DMI cocktail (dexamethasone, insulin and IBMX). At day 10 post-induction of differentiation, the accumulated triglycerides in adipocytes were stained with Oil Red O and image of differentiated adipocytes were taken. (B) For quantitative measurement of lipid accumulation, lipid-bound Oil Red O stain was extracted with isopropanol and absorbance of the extracted solution was measured at 490 nm using isopropanol as blank. (C) Differentiation of rPPE2-treated 3T3-L1 cells in the absence (Medium-Isotype control) or presence of anti-PPE2 Ab. (D) 3T3-L1 cells were differentiated in the absence or presence of 3 µg/ml rPPE2 and changes in the expressions of PPAR-γ, C/EBP-α and FAS genes at various days post-differentiation were measured by qPCR. GAPDH transcript level was used as an internal control. The results shown are mean ± SEM of 3 different experiments. ns = non-significant.
Next, the effect of PPE2 on adipocyte differentiation was examined in the context of mycobacterial infection. Accordingly, 3T3-L1 pre-adipocytes were infected with either M. smegmatis harbouring vector control (Msmeg-pVV) or M. smegmatis expressing PPE2 (Msmeg-PPE2), followed by induction of differentiation and Oil Red O staining. Cells infected with Msmeg-PPE2 exhibited a significant reduction in adipocyte differentiation compared to those infected with Msmeg-pVV (Figure S2), indicating that PPE2 could inhibit adipocyte differentiation when present in the context of bacilli. However, infection with Msmeg-pVV also caused a noticeable reduction in adipogenesis compared to uninfected control cells, indicating that other factors intrinsic to M. smegmatis or infection-triggered signaling may also contribute to the inhibition of adipogenesis. Next, we examined the effect of PPE2 on critical adipogenic factors like PPAR-γ and C/EBP-α and fatty acid synthase (FAS) during differentiation of 3T3-L1 cells. In the presence of rPPE2, there was a marked decrease in the expression of PPAR-γ, C/EBP-α and FAS during differentiation (Figure 1D). These findings suggest that PPE2 inhibits 3T3-L1 differentiation by downregulating key adipogenic genes involved in adipocyte differentiation, highlighting its potential role in modulating adipose tissue physiology and function.
2. PPE2 protein alters adipose tissue physiology during mice infection
Mtb can persist within adipose tissue and alter its physiology, potentially leading to a shift in the metabolism of fatty acids (Neyrolles et al., 2006, Beigier-Bompadre et al., 2017, Erol, 2008). While Mtb is known to cause inhibition of adipogenesis and promote lipolysis in adipose tissue (Ayyappan et al., 2019), the mechanisms responsible for this effect remained unclear. Since we found that PPE2 inhibits adipogenesis in 3T3-L1 cells, we investigated its impact on adipose tissue physiology and function during infection in mice. Balb/c mice of 9-11 weeks old were infected with either Msmeg-pVV or Msmeg-PPE2 and sacrificed on day 2 and day 7 post-infection. The two major fat depots, the perigonadal (PG) and the visceral (VS) fat tissues, were analysed to assess fat mass, tissue pathology, gene expression pattern and bacterial survival. Mice infected with Msmeg-PPE2 showed significant loss of adipose tissue mass (Figure S3) compared to both the uninfected control and Msmeg-pVV infected groups, indicating that PPE2 inhibits adipogenesis in both perigonadal and visceral fat depots (Figure 2A, B). Notably, loss of adipose tissue was also observed in Msmeg-pVV-infected mice, implying that either increased energy demands to combat infection or some intrinsic factors from M. smegmatis may also contribute to adipose tissue atrophy.


Infection of mice with M. smegmatis expressing PPE2 protein of M. tuberculosis alters adipose tissue physiology.
(A, B) Balb/c mice were infected with 100 million of either Msmeg-pVV or Msmeg-PPE2 bacilli and sacrificed at 2nd and 7th day post-infection (dpi) to measure the weight of perigonadal (A) and visceral (B) fat tissue. (C, D, E, F) Expression levels of PPAR-γ, C/EBP-α and adiponectin in perigonadal tissue and in visceral tissue were quantified by qPCR at day 2 (C and E) and day 7 (D and F) post-infection (dpi). GAPDH transcript level was used as an internal control. (G and H) Histological analyses of perigonadal (G) and visceral (H) adipose tissue sections were performed at day 2 and day 7 post-infection by staining with hematoxylin and eosin (H&E) and photographs of representative sections are presented at 40X magnification (scale bar = 100 µm). Black arrows indicate adipocyte hypertrophy (enlarged adipocyte) and the red arrows point to the infiltrated immune cells into the adipose tissue. (I and J) Adipocyte cell area for perigonadal (I) and visceral (J) fat tissue was measured using ImageJ software. (K and L) Bacterial load in perigonadal (K) and visceral (L) fat tissue was measured at day 2 and day 7 post-infection. For (M and N) For glucose tolerance test at day 7 post-infection, mice were fasted overnight followed by intraperitoneal injection of glucose (2 mg/kg body weight) and blood glucose levels were monitored for 120 minutes (M) and the Area under the curve (AUC) was calculated (N). The results shown are mean ± SEM of 4 mice.
Next, we examined the expression patterns of PPAR-γ, C/EBP-α, as well as adiponectin in these infected mice. PPAR-γ is a key transcription factor involved in regulating adipocyte differentiation, lipid metabolism and insulin sensitivity (Maréchal et al., 2018), while C/EBP-α is also required for adipogenesis as well as normal adipocyte function, while adiponectin is known to play important roles in variety of physiological functions including lipid metabolism, energy homeostasis, inflammation, and insulin sensitivity (Khoramipour et al., 2021). Infection with Msmeg-PPE2 resulted in a marked decrease in the expression of PPAR-γ, C/EBP-α and adiponectin in both PG and VS adipose tissues compared to mice infected with Msmeg-pVV at both 2nd and 7th day post-infection (dpi) (Figure 2C-F). These findings suggest that PPE2 during mycobacterial infection leads to altered gene expression, which potentially contributes to the modulation of the physiology and function of adipose tissue.
Adipose tissue is composed of various cell types including preadipocytes, adipocytes, endothelial cells, blood cells, fibroblasts, macrophages and several types of other immune cells (Saetang and Sangkhathat, 2018; Richard et al., 2020). During mycobacterial infection, immune cells infiltrate into adipose tissue and play a role in regulation of inflammation (Beigier-Bompadre et al., 2017). Histological analyses of adipose tissues stained with H&E revealed that mice infected with Msmeg-PPE2 exhibited increased immune cell infiltration and adipocyte hypertrophy by 7th dpi (Figure 2G and H). Higher infiltration of immune cells as well as adipose tissue hypertrophy was found to be more pronounced at 7th dpi in both the fat depots. Notably, at 7th dpi, an increased cell surface area was observed in perigonadal and visceral fat tissues of Msmeg-PPE2-infected mice in comparison to uninfected or Msmeg-pVV-infected mice (Figure 2I and J). These findings collectively indicate that Msmeg-PPE2 infection leads to enhanced immune cell infiltration and adipose tissue hypertrophy, influencing the cellular composition and morphology of adipocytes.
We also assessed mycobacterial survival within perigonadal and visceral fat tissues. Adipose tissues from mice infected with Msmeg-PPE2 had a significantly higher colony forming unit (CFU) count as compared to those infected with Msmeg-pVV at both 2nd and 7th dpi (Figure 2K and L). This suggests that PPE2 contributes to enhanced survival of mycobacteria within PG and VS adipose tissues.
These data suggest that PPE2 can significantly influence the adipose tissue at the morphological and molecular levels. Since adipose tissue plays a crucial role in regulating immune metabolism and glucose homeostasis, an intraperitoneal glucose tolerance test (IPGTT) was performed in mice at 7th dpi. After overnight fast, all mice received an intraperitoneal injection of dextrose (2 g/kg body mass), and blood glucose levels were monitored over 120 minutes. Interestingly, mice infected with Msmeg-PPE2 exhibited increased glucose intolerance in comparison to both uninfected and Msmeg-pVV-infected mice at 7th dpi (Figure 2M). Analyses of the area under the curve (AUC) indicate that Msmeg-PPE2-infected mice had higher glucose intolerance compared to other groups (Figure 2N). These findings indicate that PPE2 may impair glucose homeostasis through its effects on adipose tissue physiology.
3. Administration of recombinantly purified PPE2 protein causes metabolic perturbations in mice
In the previous section, it was found that PPE2, when presented in the context of bacterium can modulate adipose tissue physiology in mice. To further confirm that the observed changes can be directly attributed to the PPE2 protein, mice were injected intraperitoneally with 3 mg/kg of either recombinantly purified PPE2 protein (rPPE2) or bovine serum albumin (BSA) as a control on alternate days for a total duration of 12 days and sacrificed on day 14. The morphological changes along with histopathology and gene expression pattern were analysed to assess the direct impact of PPE2 on adipose tissue physiology. As expected, on morphological examination of PG and VS fat depots, significant reduction in both size and mass was observed in rPPE2-administered mice compared to those administered with BSA (Figure 3A, B, C). Furthermore, rPPE2-administration led to significant decrease in the expressions of PPAR-γ, C/EBP-α and adiponectin in the PG fat tissue in comparison to those treated with BSA (Figure 3D). These data indicate that PPE2 can specifically affect the expression of key genes involved in adipogenesis and immune-metabolic functions.

Administration of rPPE2 protein leads to adipose tissue loss and impaired glucose tolerance in mice.
Balb/c mice were intraperitoneally administered with 3 mg/kg of either BSA or recombinant PPE2 protein (rPPE2) on alternate days for 12 days and mice were sacrificed at day 14 post-treatment. (A) Representative photographic images of perigonadal and visceral fat tissues are shown. (B and C) Weight of the total perigonadal fat mass (B) and visceral fat mass (C) are recorded. (D) Transcript levels of PPAR-γ, C/EBP-α and adiponectin genes are quantified in perigonadal fat tissue using qPCR where GAPDH transcript level was used as internal control. (E) Histopathology analyses of perigonadal and visceral fat tissue (representative photographs of hematoxylin and eosin (H&E)-stained sections) is shown at 40X magnification (scale bar = 100 µm). Black arrows indicate adipocyte hypertrophy (enlarged adipocyte) and the red arrows indicate infiltrated immune cells into the adipose tissue. (F and G) Mice were starved overnight and glucose tolerance test was performed for 120 minutes at day 14 post-treatment (F) and the mean Area under the curve (AUC) was calculated (G). The results shown are mean ± SEM of 4 mice.
Histopathological studies of PG and VS fat tissues in rPPE2-treated mice revealed pronounced adipocyte hypertrophy and increased infiltration of immune cells into the adipose tissue marked by intense staining of the nucleus of the infiltrated cells (Figure 3E).
To assess the impact of rPPE2 on glucose homeostasis, an IPGT test was performed. The results indicate a distinctive metabolic effect, with rPPE2-treated mice displaying a lower rate of glucose clearance as compared to the control mice treated with BSA (Figure 3F and G). This observation indicates that PPE2 is a potential mycobacterial factor for development of hyperglycaemia during tuberculosis.
4. Immunization of mice with rPPE2 ameliorates PPE2-induced adipose tissue pathophysiology and functions
Since PPE2 is a secretory protein and detectable in the circulation of Mycobacterium-infected mice (Bisht et al., 2023b) and capable of promoting glucose intolerance, we next sought to determine whether neutralization of circulating PPE2 could ameliorate PPE2-induced glucose intolerance during mycobacterial infection. Accordingly, mice were immunized with rPPE2 protein using Freund’s incomplete adjuvant, followed by three booster doses at 15-day intervals. All the immunized mice showed a higher titre of anti-PPE2 antibody in the sera (Figure S4). Subsequently, these mice were infected with either Msmeg-pVV or Msmeg-PPE2, while mice injected with PBS served as unimmunized control group. As expected, loss of PG and VS fat tissues was effectively prevented in Msmeg-PPE2 infected mice which were previously immunized with rPPE2 on 7th dpi (Figure 4A, B and C). This is reflected in significant improvement in the total body fat of the Msmeg-PPE2-infected mice which were immunized previously. In contrast, unimmunized mice showed significant loss of total body fat content (Figure 4D). Histopathological examination of both PG and VS adipose tissues showed marked improvement in the pathology in mice immunized with rPPE2 when compared to unimmunized mice (Figure 4E). Moreover, reduced infiltration of cells was observed in PPE2-immunized mice compared to unimmunized mice infected with Msmeg-PPE2 (Figure 4E). The rPPE2-immunized mice also exhibited significantly improved glucose tolerance as revealed by IPGT test (Figure 4F and G). In summary, rPPE2-immunized mice showed marked improvement in adipose tissue content, total body fat content, tissue pathology and glucose tolerance when challenged with infection, underscoring the role of PPE2 in modulating adipose tissue physiology and function.

Pre-immunization with rPPE2 protects the mice from detrimental effects of PPE2 on adipose tissue.
Mice were immunized with 3 doses of recombinant PPE2 protein with Freund’s incomplete adjuvant at 15 days interval. Next, non-immunized and rPPE2-immunized mice were infected with Msmeg-pVV or Msmeg-PPE2 and a change in fat content was observed after day 7. (A) Photographs of perigonadal and visceral fat tissues are shown. Weight of perigonadal (B) and visceral (C) fat tissues of various groups is recorded. (D) Percentage change in total body fat as determined by Dual-energy X-ray Absorptiometry (DEXA) is shown. (E) At day 7, sections of perigonadal and visceral fat tissues were prepared and stained with hematoxylin and eosin and photographs of the representative sections were visualized at 40X magnification (scale bar = 100 µm). (F) A glucose tolerance test was performed on 7th dpi and (G) Area under the curve (AUC) of glucose concentration is shown. The results shown are mean ± SEM of 4 mice.
5. PPE2 alters adipose tissue physiology and induces glucose intolerance in mice during infection with M. tuberculosis
The role of adipose tissue in regulating pulmonary pathology, inflammation and M. tuberculosis load in murine TB model is now well established (Ayyappan et al., 2019). Disruptions in the metabolic equilibrium within the adipose tissue and/or dysfunction of adipocytes during Mtb infection can contribute to the development of insulin resistance (Oswal et al., 2022). In several clinical studies, stress-induced hyperglycemia has been reported in tuberculosis patients which tend to normalize with proper management (Magee et al., 2018). Moreover, increased prevalence of impaired glucose tolerance and diabetes appears to be common among the TB patients (Oluboyo and Erasmus, 1990; Jeon et al., 2010; Mugusi et al., 1990; Raghuraman et al., 2014). However, the exact etiological mechanisms responsible for the development of glucose intolerance and insulin resistance in TB patients are not yet clearly understood.
In the previous sections, we demonstrated that the PPE2 protein of M. tuberculosis can significantly remodel the adipose tissue and can cause significant impaired glucose tolerance in mice. To further confirm its pathophysiological effects, we used a ppe2-null mutant of a clinical Mtb strain CDC1551 (CDC1551-ΔPPE2) and compared its effect with the wild-type strain (CDC1551) and a complemented strain where the genomic deletion of ppe2 was complemented with a functional copy of the ppe2 gene (CDC1551-ΔPPE2::PPE2). Accordingly, 9-10 weeks Balb/c mice were aerosol-infected either with CDC1551 (wild-type) or CDC1551-ΔPPE2 (ppe2KO) or CDC1551-ΔPPE2::PPE2 and the infected mice were sacrificed after 30-and 60-dpi. Expectedly, a significant loss of adipose tissue mass was observed in both PG (Figure 5A and B) and VS (Figure 5C and D) fat depot in mice infected with the wild-type CDC1551 and the ppe2-complemented strains as compared to uninfected controls and mice infected with ppe2-null mutants (Figure 5A-D, Figure S5), suggesting impairment of normal adipogenesis. Histological analyses revealed enhanced infiltration of immune cells into both PG and VS adipose tissues of the mice infected with wild-type Mtb as well as ppe2-complemented strain as compared to uninfected or ppe2KO strain-infected mice at both time points (Figure 5E). While adipocyte hypertrophy was notably conspicuous in the fat tissues of both the wild-type and ppe2-complmented infected mice, ppe2KO-infected mice also exhibited some degree of hypertrophy in adipocytes as compared to those of uninfected controls (Figure 5F-I).


PPE2 alters adipose tissue physiology during M. tuberculosis infection in mice.
Balb/c mice were infected through aerosol route either with M. tuberculosis clinical strain CDC1551 (wild-type) or CDC1551-ΔPPE2 (ppe2KO) or CDC1551-ΔPPE2::PPE2 (complemented) strains and were sacrificed at day 30 (A and C) and day 60 (B and D) post-infection (dpi). Perigonadal (PG) and visceral (VS) fat tissues were harvested and weight of PG fat tissue (A and B) and VS fat tissue (C and D) was measured. (E) Also, representative photographs of hematoxylin and eosin (H&E)-stained sections of PG at both day 30 and day 60 post-infection were visualized at 40X magnification (scale bar = 100 µM). Black arrow shows adipocyte hypertrophy (enlarged adipocyte) and red arrow represent infiltrated immune cells into the adipose tissue. (F-I) Graphs showing cell area of adipocytes in PG (F and H) and VS (G and I) fat tissues at 30 dpi (F and G) and 60 dpi (H and I) respectively. (J-M) Number of infiltrated CD3+ T-cells were counted using ImageJ software and plotted as cells per field of view for PG (J and L) and VS (K and M) adipose tissue sampled at 30 dpi (J and K) and 60 dpi (L and M) respectively. (N and O) Changes of expression of PPAR-γ and CD36 in perigonadal tissue at day 30 (Ni, Nii) and day 60 (Oi, Oii) post-infection were measured by qPCR and GAPDH transcript level was used as an internal control. (P) Number of bacilli in PG fat tissue at 30 (Pi) and 60 (Pii) dpi respectively. (Q and R) IPGTT performed on mice along with corresponding AUC data obtained at day 30 (Qi, Qii) and day 60 (Ri, Rii) post-infection respectively. (S) Fasting blood glucose levels of mice at 60 dpi and (T) HOMA-IR scores in each mice group were calculated at day 60 post-infection. The results shown are mean ± SEM of 5 mice.
Since increased infiltration of immune cells like macrophages, T-cells (Wu et al., 2007) into the adipose tissue, have been implicated in adipocyte dysfunction and development of insulin resistance (Apovian et al., 2008; Guilherme et al., 2008) and Mtb is known to promote infiltration of these cells (Beigier-Bompadre et al., 2017), we next examined the degree of T-cell infiltration in the adipose tissue in these infected mice using immunofluorescence microscopy (Figure S6). Significantly increased CD3+ T-cell infiltration was observed in PG and VS adipose tissues of the mice infected with wild-type and ppe2-complemented Mtb strains as compared to those observed in ppe2-KO strain-infected mice at both 30 and 60 dpi (Figure 5J-M).
We also examined the changes in the expression of key genes associated with the maintenance and regulation of adipose tissue, such as PPAR-γ and CD36 (a scavenger receptor that is regulated by PPAR-γ and is involved in the uptake of long-chain fatty acids and other lipids) (Maréchal et al., 2018; Chen et al., 2022) in the perigonadal fat tissue of these infected mice. It was found that expression of both PPAR-γ and CD36 was significantly downregulated in mice infected with wild-type and ppe2-complemented strains, in comparison to mice infected with ppe2KO or uninfected control (Figure 5N and O). These results reiterate our earlier observations and underscore that PPE2 interferes with adipogenesis by suppressing the expression of adipogenic genes like PPAR-γ.
Since, adipose tissue was previously speculated to be as an important dormancy niche for Mtb (Neyrolles et al., 2006; Ayyappan et al., 2019), we assessed PPE2’s impact on the survival of Mtb in adipose tissue particularly in perigonadal adipose tissue, for being a major reservoir of fat in mice. It was found that mice infected with wild-type as well as ppe2-complementated strains exhibited significantly higher bacterial load compared to ppe2KO strain-infected mice (Figure 5P). These data suggest that PPE2 promotes persistence of Mtb in adipose tissue.
We also assessed the impact of PPE2 on the rate of glucose clearance using IPGTT assay and degree of insulin resistance using homeostatic model assessment of insulin resistance (HOMA-IR) (Matthews et al. 1985), where the conversion factor was adapted from Knopp et al. (2019). As expected, mice infected with the wild-type and ppe2-complemented strains exhibited markedly higher glucose intolerance compared to uninfected control mice and those infected with the ppe2KO strain at both 30 and 60 dpi, as indicated by blood glucose levels and AUC at 30-minute intervals (Figure 5Q and R). At day 60 post infection, groups infected with wild-type Mtb and ppe2KO strain complemented with a functional ppe2 gene, showed higher fasting blood glucose and HOMA-IR compared to the groups uninfected or infected with ppe2KO strain (Figure 5S and T). Therefore, these data indicate that mycobacterial infection can influence glucose homeostasis leading to the development of early hyperglycaemia which can later lead to development of insulin resistance and PPE2 is one of the potential etiological factors responsible for such metabolic perturbations.
6. PPE2 modulates the transcriptome of perigonadal adipose tissue
Results obtained from the experiments carried out in the earlier sections indicate that PPE2 can inhibit adipogenesis by modulating expressing of key adipogenic genes required for adipogenesis. To further assess its impact on the global gene expression profile in the adipose tissue, we performed RNA-seq in perigonadal adipose tissue collected from uninfected, wild-type and ppe2KO-infected mice at 60 dpi. Compared to the uninfected, 3569 and 2441 genes were found to be differentially expressed in wild-type and ppe2KO-infected mice adipose tissue, respectively, while 1261 genes were differentially expressed in ppe2KO and wild-type adipose tissue (Figure 6A). However, with ±1.3 log2 fold change cut-off, we observed 807 and 661 genes differentially expressed in wild-type and ppe2KO adipose tissue, respectively, and 191 genes between ppe2KO and wild-type adipose tissues (Figure 6B and C). In significantly modulated DEGs among ppe2KO and wild-type infected mice, 96 genes overlapped with mice infected with wild-type Mtb, and 76 were unique DEGs in ppe2KO and wild-type infected mice adipose tissues. To identify key signaling pathways influenced by PPE2 in adipose tissue, we performed gene set enrichment analysis (GSEA) using gene ontology, KEGG, and REACTOME pathway databases (Subramanian et al., 2005) using the DEGs between wild-type-and ppe2KO-infected mice (Figure 6D and E). As expected, gene sets associated with tissue-specific immune responses (chemokine and cytokine signaling) were highly upregulated in mice infected with wild-type Mtb (Figure 6F and Figure S7), while gene sets related to oxidative phosphorylation were found to be downregulated in these mice (Figure 6F). Phospholipase C activity was found to be highly enriched in the adipose tissue of wild-type CDC1551 compared to uninfected and ppe2KO-infected mice, as represented by the genes TXK, CD86, GPR55, Angiotensin, and LPAR1 (Figure 6G). Both gene ontology and Reactome pathway analyses showed enrichment of genes related to cytosolic ribosomal protein synthesis and ribosomal biogenesis in the adipose tissue of wild-type Mtb-infected mice compared to that of ppe2KO-infected mice (Figure 6D, E and Figure 6H). Genes related to cytoplasmic translation of both small and large ribosomal subunits were found to be enriched in the adipose tissue of CDC155-infected mice. In addition, KEGG pathways analysis revealed enrichment of pathways related to prion disease, Alzheimer, Parkinson’s disease and other neurodegenerative pathways suggesting an increase in the unfolded proteins in the endoplasmic reticulum (ER). ER stress is known to trigger inflammation and lipolysis in adipocytes leading to development of dyslipidemia and insulin resistance (Khan and Wang, 2014; Foley et al., 2021; Deng et al., 2012). To validate the occurrence of ER stress, we performed real-time PCR analysis to assess the expression of ER stress markers like ATF4, a transcription factor that regulates stress response and GRP78, a chaperone which facilitates protein folding during unfolded protein response (UPR). It was found that the expression of both ATF4 and GRP78 was significantly upregulated in the perigonadal adipose tissue of wild-type Mtb-infected mice as compared to uninfected and ppe2KO mice groups, confirming induction of ER stress in the adipose tissue (Figure 6I and J).


PPE2 modulates the adipose tissue transcriptome during infection.
Perigonadal fat tissues were harvested from mice (n = 3) infected with wild-type, ppe2KO and complemented strains at 60 dpi and subjected to RNA sequencing using Illumina platform. (A) Venn diagram showing all the differentially expressed genes (DEGs) in all subsets (B) Venn diagram showing significant DEGs after applying ±1.3-fold change cutoff. (C) Volcano plot showing significant DEGs in ppe2KO versus wild-type-infected mice in PG adipose tissue. (D) Gene set enrichment analysis (GSEA) for gene ontology analysis (E) KEGG pathway analysis in ppe2KO versus CDC1551 adipose tissues. (F) Heat map of DEGs for chemokine, metabolic pathways, cytokines and TB susceptibility genes in PG adipose tissues. (G) Heat map showing differentially expressed ribosomal biogenesis genes (H) Heat map showing differential expression of phospholipase C activity genes. (I) Perigonadal fat tissue were harvested from mice either left uninfected or infected with various strains of M. tuberculosis at day 60 post-infection and used for cDNA synthesis. Transcript levels of ATF4 and GRP78 as measured by qPCR with β-actin as an internal control. The results shown are mean ± SEM of 4 mice.
8. PPE2 induce lipolysis during Mtb infection in adipocyte cell lines and in vivo
Since, ER stress in adipose tissue is known to trigger lipolysis through activation of cAMP/PKA pathway (Song et al., 2017; Deng et al., 2012), we next examined whether PPE2 can trigger lipolysis in mature 3T3-L1 adipocytes in vitro by measuring free glycerol released in the medium due to hydrolysis of triglycerides (Schweiger et al., 2014). Treatment of mature 3T3-L1 adipocytes with rPPE2 protein for 24 hours resulted in a dose-dependent increase of free glycerol in the medium (Figure 7A). Infiltration of immune cells and hypertrophy are known to stimulate production of pro-inflammatory cytokines such as TNF-α, which in turn is also known to trigger lipolysis (Samad et al., 1999). To determine whether PPE2-induced lipolysis occurs independently of TNF-α production, we treated mature 3T3-L1 adipocytes with a TNF-α inhibitor in the presence of rPPE2. While the inhibitor was able to effectively suppress TNF-α-induced free glycerol release, it did not significantly affect lipolysis induced by rPPE2 (Figure 7B). Since insulin possess antilipolytic properties (Arner et al., 1981), we next examined whether PPE2 can override antilipolytic effect of insulin and it was found that insulin failed to suppress rPPE2-induced lipolysis in 3T3-L1 adipocytes (Figure S8). Therefore, we speculated that PPE2 interferes with insulin’s ability to activate phosphodiesterase activity in adipocytes. To confirm this, we analysed the expression of phosphodiesterase 3B (PDE3B), a critical enzyme that converts cyclic adenosine monophosphate (cAMP) into 5’AMP and serves as a primary mediator of insulin’s antilipolytic effects (Kitamura et al., 1999; DiPilato et al., 2015). Semi-quantitative PCR analysis revealed that PPE2 treatment could significantly downregulate PDE3B expression in mature adipocytes (Figure 7C). Reduction in PDE3B is associated with elevated cAMP levels, which activate cAMP-dependent protein kinase (PKA) and activated PKA phosphorylates hormone-sensitive lipase (HSL), a key enzyme involved in lipolysis (Degerman et al., 1998). To confirm the involvement of this pathway, we assessed HSL phosphorylation levels in rPPE2-treated adipocytes at 6-and 24-hour post-treatment. The results showed a significant increase in HSL phosphorylation, indicating enhanced enzymatic activity (Figure 7D). Furthermore, pretreatment with H89-dihydrochloride, a PKA-specific inhibitor, significantly reduced free glycerol release in rPPE2-treated adipocytes (Figure 7E). Collectively, these data suggest that PPE2 promotes lipolysis in adipocytes by reducing PDE3B expression, and activating PKA-HSL pathway through elevated cAMP levels.

PPE2 induces lipolysis in adipocytes by targeting the cAMP-PKA-HSL signaling axis.
(A) 3T3-L1 cells were differentiated into mature adipocytes and then treated with various concentration of rPPE2 and after 24 hours medium was removed from cells and amount of glycerol released was quantified. (B) 3T3-L1 mature adipocytes were incubated with 3 µg/ml rPPE2 or TNF-α cytokine in the absence or presence of TNF-α inhibitor and the free glycerol released was quantified. (C) Mature 3T3-L1 adipocytes were treated with 3 µg/ml of rPPE2 and after 24 hours, cells were harvested for semi-quantitative reverse transcriptase PCR analysis (Ci) and densitometric quantification was carried out using ImageJ software (Cii). (D) In a separate experiment, rPPE2-treated 3T3-L1 mature adipocytes were harvested after 6 hours and 24 hours, and the levels of phosphorylated hormone-sensitive lipase (p-HSL) and total HSL were assessed by Western blotting using anti-p-HSL Ab and anti-HSL Ab respectively (Di). Densitometric quantification of the Western blots was carried out using ImageJ software (Dii). (E) Glycerol release was quantified in rPPE2-treated (3 µg/ml) mature 3T3-L1 adipocytes at 24 hours post-treatment in the absence or presence of H89, a PKA-specific inhibitor. (A-E) All the data represent mean ± SEM of 3 independent experiments. (F) Levels of non-esterified free fatty acid (NEFA) measured in sera of mice either left uninfected or infected with various strains of M. tuberculosis at day 60 post-infection. The results shown are mean ± SEM of 5 mice. (G) NEFA levels in the plasma of healthy controls and TB patients.
Since PPE2 was found to promote lipolysis, we next measured serum non-esterified free fatty acids (NEFA) levels in these mice. It was found that the mice infected with wild-type Mtb and ppe2-complemented ppe2KO strains had higher NEFA content compared to those infected with ppe2KO strain and uninfected control mice at 60 dpi (Figure 7F). From these data, it appears that PPE2 contributes to sustain lipolytic activity and elevated NEFA levels in circulation during mycobacterial infection. To further validate this hypothesis, we measured the plasma NEFA content of TB patients (n = 51) and compared it those of healthy controls (n = 14). The TB patients were found to have significantly higher NEFA content compared to heathy controls (Figure 7G), suggesting presence of dyslipidaemia, an established risk factor for development of insulin resistance.
Discussion
Association of tuberculosis with diabetes has been suspected for almost a century ago (Root, 1934). It is now well established that diabetic patients are at increased risk of developing tuberculosis. It has been reported that diabetic patients are at 3-fold increased risk of developing tuberculosis compared to those with normoglycemia (Jeon and Murray, 2008). TB-patients with diabetic conditions were found to have higher treatment failures as well as mortality compared to non-diabetic TB-patients (Dooley et al., 2009; Viswanathan et al., 2014). On the other hand, many TB patients with no family history of diabetes were found to develop insulin resistance (Magee et al., 2018; Lin et al., 2017). It has been found that about 8-87% of TB patients are newly diagnosed with diabetes without prior conditions (Mave et al., 2017; Magee et al., 2018). However, the exact etiological connections from Mtb that trigger development of diabetes are not well understood.
Although the adipose tissue was once thought to function as a passive fat storage site, it is now recognized as a dynamic endocrine organ that also plays a crucial role in regulating glucose homeostasis and lipid metabolism (Coelho et al., 2013). Dysregulation of adipose tissue functions and inflammatory conditions under certain pathophysiological disorders like obesity are known to promote insulin resistance and subsequently to type 2 diabetes. Interestingly, it has been shown that in active TB patients, Mtb can persist in the host adipose tissue (Kashyap et al., 2012; Neyrolles et al., 2006; Agarwal et al., 2014) and this persistence can modulate adipose tissue behavior (Erol, 2008; Neyrolles et al 2006; Beigier-Bompadre et al., 2017). Mycobacterial persistence in adipose tissue is known to cause adipocyte hypertrophy, lipolysis, change in physiology and infiltration of immune cells (Beigier-bompadre et al., 2017; Martinez et al., 2019; Bisht et al., 2023a). Therefore, occurrence of hyperglycemia, insulin resistance and metabolic alterations during tuberculosis suggests possible involvement of etiologic factors/proteins from Mtb in the development of pre-diabetic/diabetic conditions.
Earlier, we found that PPE2, a member of the PE/PPE family, unique to pathogenic Mycobacteria sp. is secreted into the circulation (Bisht et al., 2023b) which can translocate to the nucleus, have pleiotropic functions and as a virulent factor promotes survival of Mtb inside the host (Bisht et al., 2023b; Pal et al., 2021). Therefore, it can have a systemic effect on the host and access various tissues including the adipose tissue during Mtb infection. Moreover, adipose tissue is now recognized as a significant reservoir for Mtb (Ayyappan et al., 2019; Neyrolles et al., 2006; Agarwal et al., 2014), it is possible that mycobacterial secreted proteins can directly modulate adipocyte physiology and functions. Given its role in mycobacterial survival and a pleiotropic protein, we speculated that PPE2 is one of the potential etiological factors from Mtb which can interfere with adipocyte functions including those governing lipid metabolism, insulin sensitivity, and inflammatory responses, ultimately contributing to metabolic dysregulation during infection.
To test our hypothesis, we first examined whether PPE2 inhibits differentiation of adipocytes in vitro using 3T3-L1 fibroblast cell line, since impaired adipogenesis is linked to insulin resistance and reduced abdominal fat content in mice with high-fat diets (Gustafson et al., 2015; Ji et al., 2014). It was found that recombinantly purified PPE2 protein could significantly inhibit adipogenesis by suppressing expression of adipogenic transcription factors PPAR-γ and C/EBP-α (Figure 1). PPAR-γ is regarded as the “master regulator” of adipogenesis (Farmer, 2006; Park et al., 2016) and together with C/EBP-α, it regulates early adipogenesis events, fatty acid transport and insulin signalling/sensitization (Wu et al., 2020; LeBlanc et al., 2016; Gerstner et al., 2024). When a surrogate non-pathogenic bacterium M. smegmatis expressing Mtb PPE2 was used to infect mice, significant reduction in the adipose tissue mass was observed (Figure 2A, 2B, Figure S3) which was also accompanied by marked decrease in expression of PPAR-γ and C/EBP-α (Figure 2C, 2D, 2E, 2F). Similar results were also obtained when the mice were administered with recombinant PPE2 protein (Figure 3A, 3B, 3C) which could be reversed by immunizing mice with rPPE2 (Figure 4A, 4B, 4C, 4D). In addition, downstream targets of PPAR-γ, such as fatty acid synthase (FAS) and adiponectin, were similarly downregulated upon exposure to PPE2 both in vivo and in vitro. These data suggest a broad suppression of the PPAR-γ signaling axis implicating its possible involvement in tuberculosis-induced metabolic perturbations (Oswal et al., 2022). PPAR-γ and C/EBP-α also regulate the expression of several makers associated with mature adipocytes such as adiponectin, fatty acid-binding protein 4 (FABP4), glucose transporter type 4 (GLUT4) etc. (Gustafson et al., 2015). Among the several isoforms of glucose transporters, GLUT4 is primarily responsible for insulin-stimulated glucose uptake in major tissues involved in glucose homeostasis such as adipocytes, muscles, heart and brain (Navale and Paranjape, 2016). Thus PPE2-mediated inhibition of inhibition of adipogenesis and repression of PPAR-γ axis, thereby contributes to limiting GLUT4-expressing mature adipocytes and thereby impair insulin responsiveness and promote glucose intolerance as observed in mice infected with Msmeg-PPE2 or wild-type Mtb or mice administered with rPPE2 (Figures 2M, 5Q-R and 3F).
Profound weight loss or wasting is a significant clinical feature associated with TB patients which greatly influences disease severity and prognosis. It has been found that TB patients undergo significant changes in the whole-body compositions with substantial depletion of fat mass which could due to combination of several factors like less energy intake due to loss of appetite, altered metabolism due to inflammatory responses (Paton and Ng, 2006). The decrease in body fat is also correlated with TB-associated complications and has been linked to exacerbated pulmonary pathology (Ayyappan et al., 2019). In this study, both recombinant protein treatment and mice infection models showed significant loss in the adipose tissue mass in both PG and VS fat depots in the presence of PPE2 (Figures 2, 3 and 5). In contrast, mice immunized with rPPE2 protein did not show severe fat loss in both tissues (Figure 4). Dual-energy X-ray absorptiometry (DEXA) analysis also confirmed that total body fat loss was resisted in PPE2-immunized mice (Figure 4D). Although food intake was not quantitatively assessed, we speculate that neutralization of PPE2 by immunization played a key role in preserving the adipose tissue. Fat loss during TB is likely driven by chronic inflammation in the adipose tissue and production of TNF-α, IL-2, IL-1β and IFN-γ during mycobacterial infection (Kim et al., 2011; Beigier-Bompadre et al., 2017) some of which were also found to be upregulated in the adipose tissue transcriptome of the mice infected with wild-type Mtb strain (Figure 6).
Adipocyte dysfunction is often characterized by adipocyte hypertrophy, increased oxidative stress, chronic low-grade inflammation and reduced ability to generate new adipocytes from its precursor pre-adipocytes (Klöting and Blüher, 2014; Reyes-Farias et al., 2021). Under normal physiological conditions, the major roles of adipose tissue include insulin-stimulated glucose uptake and storage of excess energy in the form of triglyceride, in addition to its endocrine functions like secretion of hormones like leptin, resistin and various other cytokines (Scheja and Heeren, 2019). When adipogenesis is impaired, it often leads to development of insulin resistance (Hammarstedt et al., 2018). This is because the differentiating preadipocytes buffer excess circulating free fatty acids by uptaking and converting them into triglycerides. However, when adipogenesis is restricted, the buffering capacity is hindered, the excess free fatty acids are ectopically deposited in other tissues like muscle and liver, the major sites for insulin-stimulated glucose homeostasis and also get deposited in kidney and heart (Hocking et al., 2013; Morigny et al., 2016), leading to development of insulin resistance in peripheral tissues. Adipocyte hypertrophy often leads to immune cell infiltration into the adipose tissue, leading to induction of oxidative stress, NLRP3 inflammasome activation and subsequent production of pro-inflammatory cytokines which further trigger the development of local and systemic inflammation and insulin resistance (Kursawe et al., 2016; Susca et al., 2024). We found that PPE2 can promote immune cell infiltration in adipocytes, including T-cells. Immune cell infiltration into the adipose tissue is widely implicated as an important link in the development of insulin resistance during obesity by causing adipose tissue dysfunction (Guzik et al., 2017). Infiltration of Mtb-specific T-cells and NK cells into perigonadal adipose tissue was found to be associated with distinct gene expression profiles and elevated interferon-gamma signaling, indicating localized tissue inflammation (Beigier-Bompadre et al., 2017). Infiltration of immune cells is known to promote lipolysis, leading to elevated circulating free fatty acids, and thereby contributing to peripheral insulin resistance (Beigier-Bompadre et al., 2017; Guilherme et al., 2008). We found that PPE2 also inhibit the expression of adiponectin in mice adipose tissue, either when administered as a pure protein or infected with M. smegmatis expressing PPE2. Adiponectin, a hormone secreted by the adipose tissue, plays a crucial role in various physiological functions including lipid metabolism, energy homeostasis, inflammation and insulin sensitivity (Khoramipour et al., 2021). Adiponectin is known to inhibit inflammation in various tissues including adipose tissue and found to be protective against diabetes (Ouchi and Walsh, 2007; Siitonen et al., 2011; Lindsay et al., 2002; Ziemke and Mantzoros, 2010). Adiponectin also enhances glucose tolerance in a diabetic rat model where a single dose of adiponectin resulted in significant reduction in the blood glucose levels (Tishinsky et al., 2012). Adiponectin also improves insulin sensitivity through several direct and indirect mechanisms like decreasing triglyceride content of the adipose tissue, activation of AMPK cascade to stimulate beta-oxidation of fatty acids and PPAR-α phosphorylation (Katira and Tan, 2016). Therefore, inhibition of adiponectin expression by PPE2 appears to be another mechanism by which it can promote glucose intolerance and subsequent insulin resistance.
A role of PPE2 in modulation of adipose tissue physiology was further confirmed by using a ppe2-null mutant (ppe2KO) of a clinical strain of M. tuberculosis (CDC1551). The observed suppression of expression of adipogenic genes like PPAR-γ and CD36 gene in the adipose tissue of mice infected with wild-type M. tuberculosis (CDC1551) was rescued in mice infected with ppe2KO. Functional complementation of ppe2KO, with ppe2 gene reverted this phenotype is similar to that of mice infected with wild-type strain. Also, these mice showed exacerbated adipose tissue pathology compared to the ppe2-null mutant which had almost normal adipose tissue histology similar to the uninfected control mice. In addition to impaired glucose tolerance, mice infected with wild-type as well as ppe2KO complemented with ppe2 gene showed pronounced insulin resistance at day 60 dpi as determined HOMA-IR.
To the best of our knowledge for the first time our data indicate that Mtb PPE2 is one of the etiological factors which is involved in triggering adipocyte dysfunction, hyperglycemia as well as insulin resistance observed in TB patients. PPE2 appears to exert its effects through multiple mechanisms which are possibly interconnected. PPE2 interferes with adipogenesis by inhibiting PPAR-γ and C/EBP-α, promotes adipocyte hypertrophy, inhibits expression of adiponectin and promotes infiltration of immune cells and lipolysis which are orchestrated together to induce glucose intolerance and eventually insulin resistance. In addition, PPE2 was also found to modulate expression of a large number of genes in the adipose tissue of infected mice belonging to several classes of genes performing wide ranges of physiological functions which include tissue specific immune responses, phospholipase C activity, ribosomal biogenesis, as well as proteins involved in neurodegenerative disorders. The ability of PPE2 to modulate such large number of genes is not so surprising, as earlier we have shown that PPE2 mimics several features of a eukaryotic transcription factor. PPE2 was found to possess a functional nuclear localization signal (NLS) and a DNA-binding domain, allowing it to translocate to the nucleus and bind to GATA-1 like elements (Bhat et al., 2017; Pal et al., 2021). In addition, PPE2 was also found to contain a SRC homology 3 motif (SH3) (Srivastava et al., 2019), a protein-protein interaction domain, characteristic of several kinases involved in cellular signaling (Kurochkina and Guha, 2013). Therefore, PPE2 acting as a eukaryotic transcription factor is likely to have a profound influence on the transcriptome as well as the protein-protein interactome of the adipose tissue.
Although we did not explore the exact molecular mechanisms by which PPE2 modulate the expressions of adipogenic transcription factors and adiponectin, we delineated the possible mechanisms by which PPE2 promote lipolysis which can trigger development of insulin resistance by promoting adipose tissue inflammation (Morigny et al., 2016). PPE2 was found to trigger ER stress in the adipose tissue, which in turn activate cAMP/PKA leading to increased activation of HSL leading to increased lipolysis of adipocyte triglycerides. Increased lipolysis is likely to elevate circulating NEFA, and we found that TB patients had significantly higher NEFA levels in their serum. Interestingly, pre-immunization of mice with rPPE2 was able to counter the adverse effects of PPE2 in mouse models of infection used in this study. Therefore, the development of PPE2 subunit vaccine may constitute an effective strategy to clinically manage TB-associated insulin resistance and exacerbated diabetic complications in TB patients.
Materials and methods
Ethical statement and sample collection
All animal experimental protocols were approved by the Institutional Animal Ethics Committee of Centre for DNA Fingerprinting and Diagnostics (CDFD), Hyderabad, India. Balb/c mice were maintained at the animal house facility of CDFD, Hyderabad, under standard conditions. The study involving human sample collection was approved by the Institutional Ethical Committee for Biomedical Research, at Bhagwan Mahavir Medical Research Centre (BMMRC) (No 941/BMMRC/2020/IEC). The study included 51 active pulmonary TB patients and 14 BCG-vaccinated healthy controls with no prior TB history.
About 5 ml peripheral blood was collected, plasma was separated and stored at –80[°C until further use. The control group (8 males, 6 females; age 16–40) and TB group (39 males, 12 females; age 18–75) were all HIV-negative. All the samples were collected after obtaining written informed consents from the study participants. Active TB was diagnosed using smear microscopy, chest radiography, molecular tests, and clinical evaluation, following NTEP guidelines (India).
Reagents
Antibodies and reagents used in this study are anti-phospho-HSL (Cell Signaling Technology, USA), anti-HSL antibody (St Jhon Laboratory, USA), anti-β-actin antibody (Cell Signaling Technology, USA), TNA-α inhibitor (654256-M, Millipore, USA), H89 dihydrochloride (H89, Santa Cruz, USA), NEFA Kit (FUJIFILM, Japan). Free glycerol reagent was purchased from Sigma-Aldrich, USA (F6428-40mL).
Purification of recombinant PPE2 protein
PPE2 protein was purified as described by us earlier (Bhat et al., 2017). Sequence information is provided in Table 1. For affinity purification of the recombinant PPE2 protein, the CDS was amplified from BAC-Rv329 (A5) using a forward primer (5′-CGAGAGCTCATGACCGCCCCGATCTGGATGG-3′) and a reverse primer (5′-GCAGAATTCTCACTCCACCCGGGTCGCTGAGT-3′) and cloned into the SacI and EcoR1 site of a T7 polymerase driven Escherichia coli expression vector pRSET A (Invitrogen, Carlsbad, USA) in frame with an N-terminal histidine tag to facilitate purification using metal affinity purification resins. The pRSET A vector containing the PPE2 gene was then transformed into Escherichia coli BL21 (DE3) pLysS cells and a primary inoculum was prepared from a single transformed colony. The primary culture was inoculated into 800 ml terrific broth in the presence of chloramphenicol (35 μg/ml) and ampicillin (100 μg/ml). The culture was grown in a shaker incubator at 37°C till the absorbance reached to about 0.5. At this stage, expression of the recombinant protein was induced by adding IPTG (Isopropyl β-d-1-thiogalactopyranoside, Sigma-Aldrich, USA) to a final concentration of 1 mM and incubation was continued further for 16 hours at 18°C in a shaker incubator to favor soluble expression of the protein. Cells were then harvested by centrifugation and the pellets were suspended in lysis buffer (PBS containing 5% glycerol, 0.3% sodium lauroyl sarcosine). The cell suspension was then sonicated and the lysate was centrifuged at 12000 rpm for 30 minutes. The soluble recombinant protein present in the supernatant was allowed to bind with the TALON resin (Clontech, USA) for an hour, loaded into a column and washed with washing buffer (PBS containing 5% glycerol and 20 mM Imidazole). The resin-bound protein was eluted using elution buffer (PBS containing 5% glycerol and 200 mM imidazole). Eluted samples were loaded onto an SDS-PAGE gel to confirm the presence of the recombinant PPE2 protein. The PPE2-positive fractions were pooled together and dialyzed against PBS containing 5% glycerol to remove imidazole from the protein samples. The concentration of the purified protein was estimated using MicroBCATM Protein Assay Kit from Thermo Scientific (Rockford, USA) following manufacturer’s instructions. To remove LPS contamination, the recombinant proteins were treated with 10% (v/v) polymyxin B-agarose (Sigma-Aldrich, USA; binding capacity 200 – 500 µg of LPS/ml) for 1 hour at 4°C as described by us earlier (Bhat et al., 2012).
Cloning and expression of ppe2 gene of M. tuberculosis in M. smegmatis bacteria
The non-pathogenic M. smegmatis mc2155 bacteria were received from ATCC and were grown in Middlebrook 7H9 medium (HiMedia Laboratories, India) supplemented with 0.05% Tween-80 (Sigma-Aldrich, USA) and 10% Albumin-dextrose-catalase (ADC) (HiMedia Laboratories, India), For generating M. smegmatis expressing PPE2 protein of M. tuberculosis (Msmeg-PPE2), ppe2 was cloned in a mycobacterial shuttle vector pVV16 into Nde I – Pst I sites for expression in M. smegmatis as described earlier (Bisht et al., 2023b). Transformation of pVV16-ppe2 construct into M. smegmatis (Msmeg-PPE2) was carried out as described earlier (Bhat et al., 2017). M. smegmatis harboring the empty vector (Msmeg-pVV16) alone was used as control.
Culture of bacterial strains
The DH5α strain of E. coli, used for cloning was grown in Luria-Bertani broth (Becton Dickinson, Difco Laboratories). Wild-type M. tuberculosis strain (CDC1551) and ppe2 deleted mutant M. tuberculosis strain (CDC1551-ΔPPE2) and complemented strain (CDC1551-ΔPPE2::PPE2) were maintained as described earlier (Bisht et al., 2023b) in ABSL3/BSL3 facility of the University of Delhi South Campus (UDSC), Delhi, India. Mycobacterial strains were grown in Middlebrook 7H9 Broth supplemented with 10% albumin, dextrose, catalase, and NaCl (HiMedia Laboratories) along with 0.2% glycerol (Sigma-Aldrich, USA) and 0.05% Tween-80 (Sigma-Aldrich, USA).
Differentiation of 3T3-L1 preadipocytes into mature adipocyte cells
3T3-L1 fibroblast cells were differentiated into adipocytes using a differentiation cocktail containing dexamethasone, insulin and IBMX. In brief, 3T3-L1 cells (obtained from ATCC) were cultured in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum and antibiotics (all from Invitrogen USA) and were maintained in an incubator at 37°C and 5% of CO2. At confluence, preadipocytes were induced to differentiate into adipocytes by culturing them in differentiation cocktail (DMI) comprising of 1 μM dexamethasone (Sigma-Aldrich, USA), 0.5 mM isobutylmethylxantine (Sigma-Aldrich, USA) and 10 μg/ml bovine insulin (Sigma-Aldrich, USA). On day 2, the medium was replaced with DMEM with 10% fetal bovine serum and insulin (10 µg/ml). From day 4 onwards, medium was replaced with 10% FBS in DMEM and antibiotics but without insulin, and this medium was changed every 2 days up to day 8 after confluence, when ∼95% of the cells were differentiated to adipocytes.
Measurement of degree of differentiation of 3T3-L1 cells in the presence of rPPE2
The degree of differentiation was measured by staining with Oil Red O as described by Wu et al. (2007). 3T3-L1 cells were differentiated either in the absence or presence of different concentrations of recombinantly purified PPE2 protein of M. tuberculosis (rPPE2). On day 10, the cells were fixed with 10% paraformaldehyde for one hour and subsequently washed with distilled water. The fixed cells were stained with 0.7% solution of Oil Red O stain (Sigma-Aldrich, USA) in isopropanol, followed by multiple washes with distilled water. To quantify Oil Red O stain retained by the lipid droplets present in matured 3T3-L1 cells, the dye was extracted using isopropanol and the absorbance was measured at 490 nm using a spectrophotometer. Also, total RNA was isolated from differentiating 3T3-L1 adipocyte culture medium containing rPPE2 (3 µg/ml) at various time points and adipogenic markers like PPAR-γ, C/EBP-α, fatty acid synthase (FAS) expression was measured by reverse transcription polymerase chain reaction (RT-PCR) using gene-specific primers.
Effect of PPE2 on adipose tissue physiology in vivo
Balb/c mice of 9-11 weeks of age were infected with 100 million of either M. smegmatis carrying empty vector pVV16 (Msmeg-pVV) or M. smegmatis expressing PPE2 (Msmeg-PPE2) through intravenous route and were sacrificed on 7th day post-infection. The perigonadal and visceral fat tissue were harvested for measuring the weight and also used for histopathology and extraction of total RNA. Histopathology was carried out by hematoxylin and eosin (H&E) staining.
RNA isolation and RT-PCR and semi-quantitative reverse transcriptase PCR
Total RNA was extracted from 3T3-L1 or perigonadal and visceral fat tissue using trizol following the manufacturer’s protocol (Invitrogen, USA). After converting the total RNA into cDNA, the levels of expression of PPAR-γ, C/EBP-α, FAS, CD36 and Adiponectin was measured by qPCR. GAPDH was used as an internal control. The primers used are as follows; GAPDH (F 5’ACAACTTTGTCAAGCTCATTTCCT3’ and R 5’GATAGGGCCTCTCTTGCTCA3’), PPAR-γ (F 5’ATTCTCAGTGGAGACCGC3’ and 5’AGCAGGGGGTGAAGGCTC3’), C/EBP-α (F 5’GAGAATGGGGGCACCACC3’ and R 5’GCAACAGCGGCTGGCGAC3’), FAS (F 5’ATCCCCGGCTGCCCCATG3’ and R 5’CCGAAGCCAGTGCTCGCT3’), CD36 (F 5’ TGGCCTTACTTGGGATTGG3’ and R 5’CCAGTGTATATGTAGGCTCATCCA3’) and Adiponectin (F 5’GCCTGTCCCCATGAGTAC3’ and R 5’TCTTCGGCATGACTGGGC3’). Also, the levels of expression of ATF4 (F 5’CATGCCAGATGAGCTCTTGA3’ and R (5’CAAGAATGTAAAGGGGGCA3’) and GRP78 (F 5’AGATCTTCTCCACGGCTTCC3’ and R (5’GGAGCAGGAGGAATTCCAGT3’) in perigonadal fat tissue were checked where β-actin (F 5’3GGCTGTATTCCCCTCCATCG’ and R 5’CCAGTTGGTAACAATGCCATGT3’) was used as internal control. PDE3B level in 3T3-L1 was measured by semi-quantitative reverse transcriptase PCR using the following primer; PDE3B (F 5’ ATTGAGTGGCAGAACCAGTTTCC3’ and R 5’ CTGCTGCGATCCCACCTTGAACA3’).
Protein treatment in mice
Balb/c mice of 9-11 weeks old mice were administered with either bovine serum albumin (BSA) or rPPE2 intravenously (3 mg/kg) on alternate days for 12 days. On day 14, glucose tolerance test was performed using standard protocol as described in the following section.
Mice were sacrificed on day 15th and perigonadal and visceral adipose tissue weights were measured. Also, perigonadal and visceral tissues were harvested for histopathology analyses using H&E staining and RNA isolation was carried out for measuring the expression of PPAR-γ, C/EBP-α and Adiponectin.
Histopathology
For histopathology analyses, tissue samples were fixed with 4% paraformaldehyde and embedded in paraffin wax, and then sectioned (4∼5 μm) for hematoxylin and eosin (H&E) staining. For this, the sections were deparaffinized and hydrated in distilled water and stained with Hematoxylin (30 seconds), washed in distilled water, and counterstained with Eosin (1% in distilled water for 30 seconds). Slides were washed, dehydrated, and mounted on slides for imaging. Tissue section images were acquired using Nikon ECLIPSE Ni-U light upright microscope.
Intraperitoneal glucose tolerance test (IPGTT)
Balb/c mice were starved overnight and an intraperitoneal injection of glucose was given at a dose of 2 g/kg as 25% glucose solution in sterile saline. Blood glucose levels were monitored from the tail tip vein using a glucometer at 30, 60, 90 and 120 minutes post-injection. The data plotted as percent of initial glucose concentration versus time (Veloso et al., 2019; Martinez et al., 2019). The area under the curve was calculated using the trapezoid method using Graph Pad Prism (GraphPad Software, USA).
Immunization of mice with rPPE2 and analysis of fat tissue distribution
Balb/c mice were immunized subcutaneously with 100 μg of rPPE2 protein in incomplete Freund’s adjuvant. Subsequently, three booster doses (100 μg rPPE2/mouse) were administered subcutaneously in incomplete Freund’s adjuvant at 15 days intervals. Sera were tested for the presence of PPE2-specific antibody by ELISA. These immunized Balb/c mice were infected with 100 million Msmeg-pVV/Msmeg-PPE2 through intravenous route and were sacrificed at 7th day post-infection. Total body fat percentage was measured by a Dual-energy X-ray Absorptiometry machine (Discovery QDR series, Hologic, USA). After sacrificing the mice, the perigonadal and visceral fat content was measured by weighing the tissues and harvested for histopathology by H&E staining.
M. tuberculosis infection
Balb/c mice of 9-11 weeks of age were aerosol-infected with approximately 200-300 cfu per mice of either CDC1551 (wild-type M. tuberculosis) or CDC1551-ΔPPE2 (ppe2KO) or CDC1551-ΔPPE2::PPE2 (ppe2-complemented ppe2KO strain) and sacrificed at 30 days post-infection (dpi) and 60 dpi respectively. The perigonadal and visceral fat tissue were harvested and the weight of these tissues was measured. The histopathology of perigonadal and visceral fat tissue was performed using hematoxylin and eosin (H&E) staining. Additionally, RNA was extracted from perigonadal and visceral fat tissue using Trizol following the manufacturer’s protocol (Invitrogen, USA) and the levels of expression of PPAR-γ and CD36 were measured by qPCR. GAPDH was used as control. Perigonadal adipose tissue from mice sacrificed at day 60 post-infection was used for mRNA sequencing study.
Transcriptome analysis
Total RNA was extracted from the perigonadal fat tissues from uninfected, wild-type-and ppe2KO CDC1551-infected mice using Direct-ZOL Mini Prep Kit (Zymo Research) as per the manufacturer’s protocol. RNA quality and quantity were assessed using a NanoDrop spectrophotometer and Agilent Tape station with high-sensitivity RNA ScreenTape. Paired-end RNA-sequencing libraries were prepared using NEBNext® UltraTM II Directional RNA Library Prep Kit for Illumina (NEB) as per the manufacturer’s protocol. The libraries were purified using AMPureXP beads and analyzed on 4200 Tape Station system (Agilent Technologies) using high-sensitivity D1000 Screen tape as per the manufacturer’s protocol. The sequencing was performed on an Illumina MiSeq platform. The raw reads were processed using Trimmomatic v0.39 to remove adaptor sequences, ambiguous reads (reads with unknown nucleotide ‘N’ larger than 5%), and low-quality sequences (reads with more than 10% quality threshold (QV) < 25phred score). High-quality reads with a minimum length of 100 nucleotides (nt) after trimming were retained. These high-quality reads (QV>25) were mapped on the mouse reference genome (GRCm39.110) obtained from ENSEMBLE using STAR (v2.7.10a) using default parameters. FeatureCounts (version 2.0.3) was used to count the number of reads mapped to each gene. Differential gene expression analysis was performed using the DESeq2 R package between the groups. Log2 Fold Change values greater than zero were considered upregulated, while those less than zero were downregulated, along with a P-value threshold of 0.05 for statistically significant results. Finally, the gene set enrichment analysis (GSEA) was performed using software GSEA (4.3.3) from the UC San Diego and Broad Institute website following the standard data processing pipeline (GSEA (gsea-msigdb.org)) (Subramanian et al., 2005; Mootha et al., 2003)
Colony forming unit (CFU) count
For CFU count, perigonadal adipose tissue from M. tuberculosis-infected mice was homogenized in saline solution and plated on 7H11 plates supplemented with 10% OADC (HIMEDIA, India). Plates were next incubated at 37°C and the colonies were counted after 30-35 days post-plating.
NEFA estimation
Non-esterified free fatty acids (NEFA) were analyzed in human and mouse sera samples using LabAssay™ NEFA (FFA) kit from FUJIFILM, Japan, following the manufacturer’s protocols.
Western blotting
3T3-L1 cells were lysed using RIPA buffer (50 mM Tris-HCl [pH 8], 150 mM NaCl, 2 mM EDTA, 1% NP-40, 0.5% Sodiumdeoxycholate, 0.1% SDS and protease inhibitors) and the proteins were resolved on SDS-PAGE followed by Western blotting using specific primary antibody and appropriate combinations of HRP (horseradish peroxidase) conjugated secondary Ab (Sigma-Aldrich, USA). Bound HRP enzyme was detected by chemiluminescence following the manufacturer’s protocol (GE Healthcare, UK).
Measurement of lipolysis
Lipolysis in mature 3T3-L1 adipocytes was measured by estimating free glycerol released in the medium using Free Glycerol Reagent Kit (F6428-40mL, Sigma-Aldrich, USA) following the manufacturer’s protocol. Briefly, 10 µl of culture medium was added to 800 µl of free glycerol reagent and kept at 37[ for 5 minutes. The reaction results in production of a quinoneimine dye which was measured at 540 nm using a spectrophotometer. The results were expressed as µg of glycerol released per mg protein.
Statistical analysis
GraphPad Prism software, version 8.0 was used for determining the significance of the difference in the mean between the samples. Student t-test was performed to calculate significance between two samples. p < 0.05 was considered to be significant.
Data availability
RNA sequencing data is available with the corresponding author.
Acknowledgements
We thank UDSC-ABSL3/BSL3 facility for providing access to the BSL3 facility at the University of Delhi South Campus for the work related to the use of the pathogenic strain of Mycobacterium tuberculosis. We thank Dr Garima Khare from UDSC and her team members, Dr Prachi Nagpal and Dr Nupur Angrish, for their assistance during the mouse aerosol infection. We also thank Dr Sandeep Kumar Kotturu and Dr. N.V Sanjeev Kumar for kind help. The authors gratefully acknowledge the financial support by the Science and Engineering Research Board (SERB), Department of Science and Technology (DST), Government of India (JCB/2021/000035), Council of Scientific and Industrial Research (CSIR), Govt. of India (37WS(0020)/2023-24/EMR-II/ASPIRE), Department of Biotechnology (DBT), Govt of India (BT/PR51149/MED/29/1660/2023) to SM and SG, Indian Council of Medical Research (ICMR), Govt. of India (2021-10087/GTGE/ADHOC-BMS and IIRPSG-2024-01-01453) and a core grant from CDFD by DBT. VM was supported by the DST-INSPIRE fellowship, Govt. of India.
Additional information
Author contributions
M.K.B., S.G. and S.M. conceived, designed the experiments, and analyzed the data. M.K.B. performed all the experiments. V.M. helped in 3T3-L1 experiments. V.L.V. provided healthy control and TB patients plasma samples. M.K.B., S.G. and S.M. wrote the manuscript. S.G. and S.M. corrected and edited the manuscript.
Funding
Department of Science and Technology, Ministry of Science and Technology, India (DST) (JCB/2021/000035)
Sangita Mukhopadhyay
Council of Scientific and Industrial Research, Govt of India (37WS(0020)/2023-24/EMR-II/ASPIRE)
Sangita Mukhopadhyay
Department of Biotechnology, Govt of India (BT/PR51149/MED/29/1660/2023)
Sangita Mukhopadhyay
Indian Council of Medical Research, Govt of India (2021-10087/GTGE/ADHOC-BMS)
Sangita Mukhopadhyay
Indian Council of Medical Research, Govt of India (IIRPSG-2024-01-01453)
Sangita Mukhopadhyay
Additional files
References
- The Mycobacterium tuberculosis PPE protein Rv1168c induces stronger B cell response than Rv0256c in active TB patientsInfection, Genetics and Evolution 40:339–345https://doi.org/10.1016/j.meegid.2015.09.005Google Scholar
- Mycobacterium tuberculosis persistence in various adipose depots of infected mice and the effect of anti-tubercular therapyMicrobes and Infection 16:571–80https://doi.org/10.1016/j.micinf.2014.04.006Google Scholar
- Updates on the risk factors for latent tuberculosis reactivation and their managementsEmerging Microbes & infections 5:e10https://doi.org/10.1038/emi.2016.10Google Scholar
- Prevalence of diabetes mellitus among tuberculosis patients in Sub-Saharan Africa: a systematic review and meta-analysis of observational studiesBMC Infectious Diseases 19https://doi.org/10.1186/s12879-019-3892-8Google Scholar
- Adipose macrophage infiltration is associated with insulin resistance and vascular endothelial dysfunction in obese subjects. ArteriosclerosisThrombosis, and Vascular Biology 28:1654–1659https://doi.org/10.1161/ATVBAHA.108.170316Google Scholar
- The antilipolytic effect of insulin in human adipose tissue in obesity, diabetes mellitus, hyperinsulinemia and starvationMetabolism 30:753–760https://doi.org/10.1016/0026-0495(81)90020-2Google Scholar
- Adipose tissue regulates pulmonary pathology during TB infectionmBio 10:e02771–18https://doi.org/10.1128/mBio.02771-18Google Scholar
- Mycobacterium tuberculosis infection modulates adipose tissue biologyPLoS Pathogens 13:e1006676https://doi.org/10.1371/journal.ppat.1006676Google Scholar
- PPE2 protein of Mycobacterium tuberculosis may inhibit nitric oxide in activated macrophagesAnnals of the New York Academy of Sciences 1283:97–101https://doi.org/10.1111/nyas.12070Google Scholar
- The PPE2 protein of Mycobacterium tuberculosis translocates to the host nucleus and inhibits nitric oxide productionScientific Reports 7https://doi.org/10.1038/srep39706Google Scholar
- The cause-effect relation of tuberculosis on incidence of diabetes mellitusFrontiers in Cellular and Infection Microbiology 26:1134036https://doi.org/10.3389/fcimb.2023.1134036Google Scholar
- The PPE2 protein of Mycobacterium tuberculosis is secreted during infection and facilitates mycobacterial survival inside the hostTuberculosis 143:e102421https://doi.org/10.1016/j.tube.2023.102421Google Scholar
- CD36, a signaling receptor and fatty acid transporter that regulates immune cell metabolism and fateThe Journal of Experimental Medicine 219:e20211314https://doi.org/10.1084/jem.20211314Google Scholar
- Biochemistry of adipose tissue: an endocrine organArchives of medical science 9:191–200https://doi.org/10.5114/aoms.2013.33181Google Scholar
- Phosphorylation and activation of hormone-sensitive adipocyte phosphodiesterase type 3BMethods 14:43–53https://doi.org/10.1006/meth.1997.0564Google Scholar
- Lipolysis response to endoplasmic reticulum stress in adipose cellsThe Journal of Biological Chemistry 287:6240–6249https://doi.org/10.1074/jbc.M111.299115Google Scholar
- The role of PDE3B phosphorylation in the inhibition of lipolysis by insulinMolecular and Cellular Biology 35:2752–2760https://doi.org/10.1128/MCB.00422-15Google Scholar
- Impact of diabetes mellitus on treatment outcomes of patients with active tuberculosisThe American Journal of Tropical Medicine and Hygiene 80:634–639Google Scholar
- Visceral adipose tissue specific persistence of Mycobacterium tuberculosis may be reason for the metabolic syndromeMedical Hypotheses 71:222–228https://doi.org/10.1016/j.mehy.2008.03.028Google Scholar
- Transcriptional control of adipocyte formationCell Metabolism 4:263–273https://doi.org/10.1016/j.cmet.2006.07.001Google Scholar
- Inflammation promotes adipocyte lipolysis via IRE1 kinaseThe Journal of Biological Chemistry 296https://doi.org/10.1016/j.jbc.2021.100440Google Scholar
- Diabetes as a risk factor for tuberculosis diseaseThe Cochrane Database of Systematic Reviews 8:CD016013https://doi.org/10.1002/14651858.CD016013Google Scholar
- Diabetes among tuberculosis patients and its impact on tuberculosis treatment in South Asia: a systematic review and meta-analysisScientific Reports 11https://doi.org/10.1038/s41598-021-81057-2Google Scholar
- Prmt6 represses the pro-adipogenic Ppar-gamma– C/ebp-alpha transcription factor loopScientific Reports 14https://doi.org/10.1038/s41598-024-57310-9Google Scholar
- Adipocyte dysfunctions linking obesity to insulin resistance and type 2 diabetesNature reviews. Molecular Cell Biology 9:367–377https://doi.org/10.1038/nrm2391Google Scholar
- Insulin resistance and impaired adipogenesisTrends in Endocrinology and Metabolism: TEM 26:193–200https://doi.org/10.1016/j.tem.2015.01.006Google Scholar
- The role of infiltrating immune cells in dysfunctional adipose tissueCardiovascular Research 113:1009–1023https://doi.org/10.1093/cvr/cvx108Google Scholar
- Impaired adipogenesis and dysfunctional adipose tissue in human hypertrophic obesityPhysiological Reviews 98:1911–1941https://doi.org/10.1152/physrev.00034.2017Google Scholar
- Adiposity and insulin resistance in humans: the role of the different tissue and cellular lipid depotsEndocrine Reviews 34:463–500https://doi.org/10.1210/er.2012-1041Google Scholar
- Diabetes Atlashttps://diabetesatlas.org/atlas/11th-edition/Google Scholar
- Diabetes mellitus increases the risk of active tuberculosis: a systematic review of 13 observational studiesPLoS Medicine 5:e152Google Scholar
- Bi-directional screening for tuberculosis and diabetes: a systematic reviewTropical Medicine & International Health 15:1300–1314https://doi.org/10.1111/j.1365-3156.2010.02632.xGoogle Scholar
- Inhibition of adipogenesis in 3T3-L1 cells and suppression of abdominal fat accumulation in high-fat diet-feeding C57BL/6J mice after downregulation of hyaluronic acidInternational Journal of Obesity 38:1035–1043https://doi.org/10.1038/ijo.2013.202Google Scholar
- MCP-1 contributes to macrophage infiltration into adipose tissue, insulin resistance, and hepatic steatosis in obesityThe Journal of Clinical Investigation 116:1494–1505https://doi.org/10.1172/JCI26498Google Scholar
- Presence of multiple strains of Mycobacterium tuberculosis in adipose tissue samples from tuberculosis patientsPLoS One 7:e30626Google Scholar
- Evolving role of adiponectin in cancer–controversies and updateCancer Biology & Medicine 13:101–119https://doi.org/10.28092/j.issn.2095-3941.2015.0092Google Scholar
- ER stress in adipocytes and insulin resistance: mechanisms and significance (Review)Molecular Medicine Reports 10:2234–2240https://doi.org/10.3892/mmr.2014.2532Google Scholar
- Tuberculosis (TB) treatment challenges in TB-diabetes comorbid patients: a systematic review and meta-analysisAnnals of Medicine 56https://doi.org/10.1080/07853890.2024.2313683Google Scholar
- Adiponectin: structure, physiological functions, role in diseases, and effects of nutritionNutrients 13https://doi.org/10.3390/nu13041180Google Scholar
- Differential immune response of adipocytes to virulent and attenuated Mycobacterium tuberculosisMicrobes and Infection 13:1242–1251https://doi.org/10.1016/j.micinf.2011.07.002Google Scholar
- Insulin-induced phosphorylation and activation of cyclic nucleotide phosphodiesterase 3B by the serine-threonine kinase AktMolecular and Cellular Biology 19:6286–6296https://doi.org/10.1128/MCB.19.9.6286Google Scholar
- Adipocyte dysfunction, inflammation and metabolic syndromeReviews in Endocrine and Metabolic Disorders 15:277–287https://doi.org/10.1007/s11154-014-9301-0Google Scholar
- Insulin units and conversion factors: a story of truth, boots, and faster half-truthsJournal of Diabetes Science and Technology 13:597–600https://doi.org/10.1177/1932296818805074Google Scholar
- SH3 domains: modules of protein-protein interactionsBiophysical Reviews 5:29–39https://doi.org/10.1007/s12551-012-0081-zGoogle Scholar
- A role of the inflammasome in the low storage capacity of the abdominal subcutaneous adipose tissue in obese adolescentsDiabetes 65:610–618https://doi.org/10.2337/db15-1478Google Scholar
- The global burden of tuberculosis: results from the Global Burden of Disease Study 2015Lancet Infectious Diseases 18:261–284https://doi.org/10.1016/S1473-3099(17)30703-XGoogle Scholar
- Promoter-enhancer looping at the PPARγ2 locus during adipogenic differentiation requires the Prmt5 methyltransferaseNucleic Acids Research 44:5133–5147https://doi.org/10.1093/nar/gkw129Google Scholar
- Understanding latent tuberculosis: a moving targetJournal of Immunology 185:15–22https://doi.org/10.4049/jimmunol.0903704Google Scholar
- The change in blood glucose levels in tuberculosis patients before and during anti-tuberculosis treatment in ChinaGlobal Health Action 10https://doi.org/10.1080/16549716.2017.1289737Google Scholar
- Adiponectin and development of type 2 diabetes in the Pima Indian populationLancet 360:57–58https://doi.org/10.1016/S0140-6736(02)09335-2Google Scholar
- Stress hyperglycemia in patients with tuberculosis disease: epidemiology and clinical implicationsCurrent Diabetes Reports 18https://doi.org/10.1007/s11892-018-1036-yGoogle Scholar
- The CD36-PPARγ pathway in metabolic disordersInternational Journal of Molecular Sciences 19https://doi.org/10.3390/ijms19051529Google Scholar
- mTORC2/Akt activation in adipocytes is required for adipose tissue inflammation in tuberculosisEBioMedicine 45:314–327https://doi.org/10.1016/j.ebiom.2019.06.052Google Scholar
- Homeostasis model assessment: insulin resistance and beta-cell function from fasting plasma glucose and insulin concentrations in manDiabetologia 28:412–419https://doi.org/10.1007/BF00280883Google Scholar
- Prevalence of dysglycemia and clinical presentation of pulmonary tuberculosis in Western IndiaInternational Journal of Tuberculosis and Lung Disease 21:1280–1287Google Scholar
- PGC-1α-responsive genes involved in oxidative phosphorylation are coordinately downregulated in human diabetesNature Genetics 34:267–273https://doi.org/10.1038/ng1180Google Scholar
- Adipocyte lipolysis and insulin resistanceBiochimie 125:259–66https://doi.org/10.1016/j.biochi.2015.10.024Google Scholar
- Increased prevalence of diabetes mellitus in patients with pulmonary tuberculosis in TanzaniaTubercle 71:271–276https://doi.org/10.1016/0041-3879(90)90040-fGoogle Scholar
- Glucose transporters: physiological and pathological rolesBiophysical Reviews 8:5–9https://doi.org/10.1007/s12551-015-0186-2Google Scholar
- Is adipose tissue a place for Mycobacterium tuberculosis persistence?PLoS One 1:e43https://doi.org/10.1371/journal.pone.0000043Google Scholar
- Global prevalence of diabetes in active tuberculosis: a systematic review and meta-analysis of data from 2.3 million patients with tuberculosisLancet Global Health 7:e448–e460https://doi.org/10.1016/S2214-109X(18)30487-XGoogle Scholar
- The significance of glucose intolerance in pulmonary tuberculosisTuberculosis 71:135–138https://doi.org/10.1016/0041-3879(90)90010-6Google Scholar
- Host metabolic changes during Mycobacterium tuberculosis infection cause insulin resistance in adult miceJournal of Clinical Medicine 11https://doi.org/10.3390/jcm11061646Google Scholar
- Adiponectin as an anti-inflammatory factorClinica Chimica Acta 380:24–30Google Scholar
- Moonlighting by PPE2 protein: Focus on mycobacterial virulenceJournal of Immunology 207:2393–2397https://doi.org/10.4049/jimmunol.2100212Google Scholar
- PPE2 protein of Mycobacterium tuberculosis affects myeloid hematopoiesis in miceImmunobiology 226https://doi.org/10.1016/j.imbio.2020.152051Google Scholar
- Secretory proteins of Mycobacterium tuberculosis and their roles in modulation of host immune responses: focus on therapeutic targetsThe FEBS Journal 289:4146–4171https://doi.org/10.1111/febs.16369Google Scholar
- PPARγ neddylation essential for adipogenesis is a potential target for treating obesityCell Death & Differentiation 23:1296–1311https://doi.org/10.1038/cdd.2016.6Google Scholar
- Body composition studies in patients with wasting associated with tuberculosisNutrition 22:245–251https://doi.org/10.1016/j.nut.2005.06.009Google Scholar
- Prevalence of diabetes mellitus among tuberculosis patients in urban PuducherryNorth American Journal of Medical Sciences 6:30–34https://doi.org/10.4103/1947-2714.125863Google Scholar
- White adipose tissue dysfunction in obesity and agingBiochemical Pharmacology 192https://doi.org/10.1016/j.bcp.2021.114723Google Scholar
- Adipose tissue: Physiology to metabolic dysfunctionIn:
- Feingold K. R.
- et al.
- The association of diabetes and tuberculosisNew England Journal of Medicine 210:1–13Google Scholar
- Gene expression during 3T3-L1 adipocyte differentiation. Characterization of initial responses to the inducing agents and changes during commitment to differentiationJournal of Biological Chemistry 267:4722–4731Google Scholar
- Role of innate lymphoid cells in obesity and metabolic disease (Review)Molecular Medicine Reports 17:1403–1412https://doi.org/10.3892/mmr.2017.8038Google Scholar
- Tumor necrosis factor α is a key component in the obesity-linked elevation of plasminogen activator inhibitor 1Proceedings of the National Academy of Sciences of the United States of America 96:6902–6907https://doi.org/10.1073/pnas.96.12.6902Google Scholar
- The endocrine function of adipose tissues in health and cardiometabolic diseaseNature Reviews Endocrinology 15:507–524https://doi.org/10.1038/s41574-019-0230-6Google Scholar
- Measurement of lipolysisMethods in Enzymology 538:171–193https://doi.org/10.1016/B978-0-12-800280-3.00010-4Google Scholar
- Association of ADIPOQ gene variants with body weight, type 2 diabetes and serum adiponectin concentrations: the Finnish Diabetes Prevention StudyBMC Medical Genetics 12https://doi.org/10.1186/1471-2350-12-5Google Scholar
- Endoplasmic reticulum (ER) stress and cAMP/PKA pathway mediated Zn-induced hepatic lipolysisEnvironmental Pollution 228:256–264https://doi.org/10.1016/j.envpol.2017.05.046Google Scholar
- Mycobacterium tuberculosis PPE2 protein interacts with p67phox and inhibits reactive oxygen species productionJournal of Immunology 203:1218–1229https://doi.org/10.4049/jimmunol.1801143Google Scholar
- Gene set enrichment analysis: a knowledge-based approach for interpreting genome-wide expression profilesProceedings of the National Academy of Sciences of the United States of America 102:15545–15550https://doi.org/10.1073/pnas.0506580102Google Scholar
- Adipose failure through adipocyte overload and autoimmunityAutoimmunity Reviews 23https://doi.org/10.1016/j.autrev.2023.103502Google Scholar
- Insulin-sensitizing properties of adiponectinBiochimie 94:2131–2136https://doi.org/10.1016/j.biochi.2012.01.017Google Scholar
- Evaluation of the effects of extracts of Maytenus imbricata (Celastraceae) on the treatment of inflammatory and metabolic dysfunction induced by high-refined carbohydrate dietInflammopharmacology 27:539–548https://doi.org/10.1007/s10787-018-0496-7Google Scholar
- Prevalence of diabetes and pre-diabetes and associated risk factors among tuberculosis patients in IndiaPLoS One 7:e41367https://doi.org/10.1371/journal.pone.0041367Google Scholar
- Effect of diabetes on treatment outcome of smear-positive pulmonary tuberculosis–a report from south IndiaJournal of Diabetes and Its Complications 28:162–165https://doi.org/10.1016/j.jdiacomp.2013.12.003Google Scholar
- Global Tuberculosis Report 2023Geneva, Switzerland: World Health Organization https://www.who.int/publications/i/item/9789240083851Google Scholar
- Peroxisome proliferator-activated receptor γ in white and brown adipocyte regulation and differentiationPhysiological Research 69:759–773https://doi.org/10.33549/physiolres.934411Google Scholar
- T-cell accumulation and regulated on activation, normal T cell expressed and secreted upregulation in adipose tissue in obesityCirculation 115:1029–38https://doi.org/10.1161/CIRCULATIONAHA.106.638379Google Scholar
- Adiponectin in insulin resistance: lessons from translational researchThe American Journal of Clinical Nutrition 91:258–261https://doi.org/10.3945/ajcn.2009.28449CGoogle Scholar
Article and author information
Author information
Version history
- Preprint posted:
- Sent for peer review:
- Reviewed Preprint version 1:
Cite all versions
You can cite all versions using the DOI https://doi.org/10.7554/eLife.109532. This DOI represents all versions, and will always resolve to the latest one.
Copyright
© 2026, Bisht et al.
This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.
Metrics
- views
- 453
- downloads
- 36
- citations
- 0
Views, downloads and citations are aggregated across all versions of this paper published by eLife.