Abstract
The Gram-negative bacterium Myxococcus xanthus glides on solid surfaces. Dynamic bacterial focal adhesion complexes (bFACs) convert proton motive force from the inner membrane into mechanical propulsion on the cell surface. It is unclear how the mechanical force transmits across the rigid peptidoglycan (PG) cell wall. Here we show that AgmT, a highly abundant lytic PG transglycosylase homologous to Escherichia coli MltG, couples bFACs to PG. Coprecipitation assay and single-particle microscopy reveal that the gliding motors fail to connect to PG and thus are unable to assemble into bFACs in the absence of an active AgmT. Heterologous expression of E. coli MltG restores the connection between PG and bFACs and thus rescues gliding motility in the M. xanthus cells that lack AgmT. Our results indicate that bFACs anchor to AgmT-modified PG to transmit mechanical force across the PG cell wall.
Introduction
In natural ecosystems, the majority of bacteria attach to surfaces1. Surface-associated motility is critical for many bacteria to navigate and populate their environments2. The Gram-negative bacterium Myxococcus xanthus moves on solid surfaces using two independent mechanisms: social (S-) motility and adventurous (A-) motility. S-motility, analogous to the twitching motility in Pseudomonas and Neisseria, is powered by the extension and retraction of type IV pili3,4. A-motility, also known as gliding motility, does not depend on conventional motility-related cell surface appendages, such as flagella or pili2,5. In M. xanthus, AglR, AglQ, and AglS form a membrane channel that functions as the gliding motor by harvesting proton motive force6,7. The motor unit associates with at least fourteen gliding-related proteins that reside in the cytoplasm, inner membrane, periplasm, and outer membrane8–10.
Recently, the mechanisms for bFAC assembly and the coupling between bFACs and substrate begin to emerge8,11,12. In each gliding cell, two distinct populations of gliding complexes coexist: dynamic complexes move along helical paths and static complexes remain fixed relative to the substrate11,13–15. Motors transport incomplete gliding complexes along helical tracks but form complete, force-generating complexes at the ventral side of cells that appear fixed to the substrate (Fig. 1)11,15. Based on their functional analogy with eukaryotic focal adhesion sites, these complete gliding machineries are called bacterial focal adhesion complexes (bFACs). Despite their static appearance, bFACs are dynamic under single-molecule microscopy. Individual motors frequently display move-stall-move patterns, in which they move rapidly along helical trajectories, join a bFAC where they remain stationary briefly, then move rapidly again toward the next bFAC or reverse their moving directions13,16,17. bFACs adhere to the gliding substrate through an outer membrane adhesin12. As motors transport bFACs toward lagging cell poles, cells move forward but bFACs remain static relative to the gliding substrate.

Stationary bFACs drive M. xanthus gliding.
Motors carrying incomplete gliding complexes either diffuse or move rapidly along helical paths but do not generate propulsion. Motors stall and become nearly static relative to the substrate when they assemble into complete bFACs with other motor-associated proteins at the ventral side of the cell. Stalled motors push MreB and bFACs in opposite directions and thus exert force against outer membrane adhesins. Overall, as motors transport bFACs toward lagging cell poles, cells move forward but bFACs remain static relative to the substrate. IM, inner membrane; OM, outer membrane.
bFAC assembly can be quantified at nanometer resolution using the single-particle dynamics of gliding motors13,18. Single particles of a fully functional, photoactivatable mCherry (PAmCherry)-labeled AglR display three dynamic patterns, stationary, directed motion, and diffusion13,18. The stationary population consists of the motors in fully assembled bFACs, which do not move before photobleach. In contrast, the motors moving in a directed manner carry incomplete gliding complexes along helical tracks, whereas the diffusing motors assemble to even less completeness11,13,15,18. As motors only generate force in static bFACs11, the population of nonmotile motors indicates the overall status of fully assembled bFACs.
However, how bFACs transmit force across the peptidoglycan (PG) cell wall is unclear. PG is a mesh-like single molecule of crosslinked glycan strands that surrounds the entire cytoplasmic membrane. The rigidity of PG defines cell shape and protects cells from osmotic lysis19,20. If bFACs physically penetrate PG, their transportation toward lagging cell poles would tear PG and trigger cell lysis. To avoid breaching PG, an updated model proposes that there are two subcomplexes in each bFAC, one on each side of the PG layer. Rather than forming stable and rigid interactions, these two subcomplexes only associate transiently to form a bFAC11,21 (Fig. 1).
As motors reside in the fluid inner membrane, to transmit force to the cell surface, they must push against two relatively rigid structures, one on each side of the membrane, in opposite directions21 (Fig. 1). MreB is a bacterial actin homolog that associates with the motors and plays essential roles in gliding2,5,6,14,18,22. The motors could push against MreB filaments in the cytoplasm, whereas PG could be the structure that motors push against in the periplasm11,21. The interaction between the inner complex and PG not only satisfies the physical requirement for force generation but also supports efficient bFACs assembly. Without this interaction, once the inner subcomplex disassociates from the outer one, it will quickly escape bFACs and no longer contribute to force generation21. In this case, the fraction of time each motor generates force (remains in bFACs) will be extremely low21. How the inner complex interacts with PG remains unknown. It was speculated that gliding motors in the inner complex could bind PG directly11. However, such binding has not been confirmed by experiments.
In this study, we found that AgmT, a lytic transglycosylase (LTG) for PG, is essential for M. xanthus gliding motility. AgmT is required for maintaining PG integrity under the stress from the antibiotic mecillinam. Using single-particle tracking microscopy and coprecipitation assays, we found that AgmT is required for the gliding motors to connect to PG and stall in bFACs. Importantly, expressing Escherichia coli MltG heterologously rescues the connection between PG and bFACs and thus restores gliding motility. Hence, the LTG activity of AgmT anchors bFAC to PG, potentially by modifying PG structure. Our findings reveal the long-sought connection between PG and bFAC that allows mechanical force to transmit across the PG cell wall.
Results
AgmT, a putative LTG, is essential for gliding motility
To elucidate how bFACs interact with PG, we searched for potential PG-binding domains among the proteins that are required for gliding motility. A previous report identified 35 gliding-related genes in M. xanthus through transposon-mediated random mutagenesis23. Among these genes, agmT (ORF K1515_0491024) was predicted to encode a protein with a large “periplasmic solute-binding” domain23. After careful analysis, we found that AgmT showed significant similarity to the widely conserved YceG/MltG family LTGs. About 70% of bacterial genomes, including firmicutes, proteobacteria, and actinobacteria, encode YceG/MltG domains25. Especially, the putative active site, Glu223 (corresponding to E218 in E. coli MltG)25, is conserved in AgmT (Fig. 2A). To confirm the function of AgmT in gliding, we constructed an agmT in-frame deletion mutant. To eliminate S-motility, we further knocked out the pilA gene that encodes pilin for type IV pilus. In contrast to the pilA− cells that were still motile with gliding motility, the ΔaglR pilA− cells that lack an essential component in the gliding motor, were unable to move outward from the colony edge. Similarly, the ΔagmT pilA− cells also formed sharp colony edges, indicating that they were nonmotile with gliding (Fig. 2B). As AgmT is a putative LTG for PG, we then tested if its predicted active site, Glu223, is required for gliding. Because the amino acid following Glu223 is also a glutamate (Glu224), we replaced both glutamate residues with alanine (AgmTEAEA) using site-directed mutagenesis to alter their codons on the chromosome. agmTEAEA pilA− cells were nonmotile (Fig. 2B). Thus, the putative LTG activity of AgmT is essential for M. xanthus gliding motility.

AgmT, a putative lytic transglycosylase, is required for M. xanthus gliding.
A) AgmT shows significant similarity to a widely conserved PG transglycosylase in YceG/MltG family. The conserved glutamine residue is marked by an asterisk. M_xant, M. xanthus; E_coli, E. coli; M_tube, Mycobacterium tuberculosis; S_coel, Streptomyces coelicolor; A_calc, Acinetobacter calcoaceticus; X_albi, Xanthomonas albilineans; N_meni, Neisseria menningitidis; R_prow, Rickettsia prowazekii; T_aqua, Thermus aquaticus. B) AgmT is required for M. xanthus gliding. Colony edges were imaged after incubating cells on 1.5% agar surface for 24 h. Deleting or Disabling the active site of AgmT abolishes gliding but fusing an PAmCherry (PAmCh) to its C-terminus does not. Heterologous Expression of E. coli MltG restores gliding of ⊗agmT cells but not the cells that express AgmTEAEA.
Besides agmT, the genome of M. xanthus contains 13 genes that encode putative LTGs (Table S1). To test if these proteins also contribute to gliding, we knocked out each of these 13 genes in the pilA− background. The resulting mutants all retained gliding motility, indicating that AgmT is the only LTG that is required for M. xanthus gliding (Fig. S1).
AgmT is an LTG
To determine if AgmT is an LTG, we expressed the periplasmic domain (amino acids 25 – 339) of wild-type AgmT and AgmTEAEA in E. coli. We purified PG from wild-type M. xanthus cells, labeled it with Remazol brilliant blue (RBB), and tested if the purified AgmT variants hydrolyze labeled PG in vitro and release the dye26,27. Similar to lysozyme that specifically cleaves the ®-1,4-glycosidic bonds in PG, wild-type AgmT solubilized dye-labeled M. xanthus PG that absorbs light at 595 nm. In contrast, the AgmTEAEA variant failed to release the dye (Fig. 3A). Hence, AgmT displays LTG activity in vitro.

AgmT regulates cell morphology and integrity under antibiotic stress.
A) Purified AgmT solubilizes dye-labeled PG sacculi, but AgmTEAEA does not. Lysozyme serves as a positive control. Absorption at 595 nm was measured after 18 h incubation at 25 °C. Data are presented as mean values ± SD from three replicates. B) AgmT regulates cell morphology. Compared to wild-type cells, cells that lack AgmT and express AgmTEAEA are significantly shorter and wider. Heterologous expression of E. coli MltG partially restores cell length but not cell width in agmT and agmTEAEA backgrounds. Asterisks, 200 ⎧M sodium vanillate added. p values were calculated using a one-way ANOVA test between two unweighted, independent samples. Whiskers indicate the 25th - 75th percentiles and red dots the median. The total number of cells analyzed is shown on top of each plot. C) AgmT regulates cell morphology and integrity under mecillinam stress (100 ⎧g/ml). Expressing E. coli MltG by a vanillate-inducible promoter (Pvan) restores resistance against mecillinam in agmT cells but not in the cells that express AgmTEAEA. van,. Arrows point to newly lysed cells. Scale bars, 5 µm.
Whereas AgmT does not affect growth rate (Fig. S2), cells that lacked AgmT or expressed AgmTEAEA maintained rod shape but were slightly shorter and wider than the wild-type ones (Fig. 3B). Nevertheless, altered morphology alone does not likely account for abolished gliding. In fact, a previously reported mutant that lacks all three class A penicillin-binding proteins (⊗3) displays similarly shortened and widened morphology28, but is still motile by gliding (Fig. S1).
A recent report revealed that Vibrio cholerae MltG degrades un-crosslinked PG turnover products and prevents their detrimental accumulation in the periplasm29. To test if AgmT plays a similar role in M. xanthus, we used mecillinam to induce cell envelope stress. Mecillinam is a ®-lactam that induces the production of toxic, un-crosslinked PG strands30. Rather than collapsing the rod shape, mecillinam only causes bulging near the centers of wild-type M. xanthus cells, whereas large-scale cell lysis does not occur and cell poles still maintain rod shape even after prolonged (20 h) treatment (Fig. 3C)28. Thus, wild-type M. xanthus can largely mitigate mecillinam stress. In contrast, mecillinam-treated agmT cells increased their width drastically, displayed significant cell surface irregularity along their entire cell bodies, and lysed frequently (Fig. 3C). Cells expressing AgmTEAEA as the sole source of AgmT displayed similar, but even stronger phenotypes under mecillinam stress, growing into elongated, twisted filaments that formed multiple cell poles and lysed frequently (Fig. 3C). These results confirm that similar to V. cholerae MltG, M. xanthus AgmT is important for maintaining cell integrity under mecillinam stress. The different responses from agmT and agmTEAEA cells suggest that AgmT could interact with other PG-related enzymes and that the inactive AgmT variant might still modulate PG through these enzymes. Alternatively, other LTGs could partially substitute AgmT while AgmTEAEA blocks these enzymes from accessing un-crosslinked PG strands.
AgmT is essential for bFACs assembly
How does AgmT support gliding? We first tested if AgmT regulates the function of the gliding motor. For this purpose, we quantified the motor dynamics by tracking single particles of AglR, an essential component of the motor. We spotted the cells that express a fully functional, photo-activatable mCherry (PAmCherry)-labeled AglR13 on 1.5% agar surface. We used a 405-nm excitation laser to activate the fluorescence of a few labeled AglR particles randomly in each cell and quantified their localization using a 561-nm laser at 10 Hz using single particle tracking photo-activated localization microscopy (sptPALM) under highly inclined and laminated optical sheet (HILO) illumination13,18,31. Using this setting, only a thin section of each cell surface that was close to the coverslip was illuminated. To analyze the data, we only chose the fluorescent particles that remained in focus for 4 - 12 frames (0.4 - 1.2 s). As free PAmCherry particles diffuse extremely fast in the cytoplasm, entering and exiting the focal plane frequently, they usually appear as blurry objects that cannot be followed at 10-Hz close to the membrane18. For this reason, the noise from any potential degradation of AglR-PAmCherry was negligible. Consistent with our previous results13,16, 32.1% (n = 2,700) of AglR-PAmCherry particles remained within one pixel (160 nm · 160 nm) before photobleach, indicating that they were nonmotile. The remaining 67.9% AglR-PAmCherry particles were motile, leaving trajectories of various lengths (Fig. 4A, 4B).

AgmT and its LTG activity are essential for bFAC assembly.
A) Overall distribution of AglR-PAmCherry particles on 1.5% agar surface is displayed using the composite of 100 consecutive frames. Single-particle trajectories of AglR-PAmCherry were generated from the same frames. Individual trajectories are distinguished by colors. Deleting agmT or disabling the transglycosylase activity of AgmT (AgmTEAEA) decrease the stationary population of AglR particles. B) The stationary population of AglR-PAmCherry particles, which reflects the AglR molecules in bFACs, changes in response to substrate hardness (controlled by agar concentration) and the presence and function of AgmT. The total number of particles analyzed is shown on top of each plot. C) AglR fails to assemble into bFACs in the absence of active AgmT, even on 5.0% agar surfaces. D) AgmT and its LTG activity also support the assembly of AglZ into bFACs. White arrows point to bFACs. Scale bars, 5 µm.
bFAC assembly is sensitive to mechanical cues. As the agar concentration increases in gliding substrate, more motor molecules engage in bFACs, where they appear immobile10,15. We exposed aglR-PAmCherry cells to 405-nm excitation (0.2 kW/cm2) for 2 s, where most PAmCherry molecules were photoactivated and used epifluorescence to display the overall localization of AglR13,18,32. As the agar concentration increased bFACs increased significantly in size (Fig. 4C). Accordingly, the immobile AglR particles detected by sptPALM increased from 10.7% (n = 1112) on 0.5% agar to 45.2% (n = 726) on 5.0% agar surface (Fig. 4B). Thus, the stationary population of AglR-PAmCherry particles reflects the AglR molecules in fully assembled bFACs.
In contrast to the cells that expressed wild-type AgmT (agmT+), AglR particles were hyper motile in the cells that lacked AgmT or expressed AgmTEAEA. On 1.5% agar surfaces, the immobile populations of AglR particles decreased to 10.5% (n = 2,989) and 11.7% (n = 1,408), respectively. Consistently, AglR-containing bFACs were not detectable in these cells, even on 5% agar surfaces (Fig. 4A-C).
To test if other components in the gliding machinery also depend on AgmT to assemble into bFACs, we tested the localization of AglZ, a cytoplasmic protein that is commonly used for assessing bFAC assembly11,33. In the cells that expressed wild-type AgmT, yellow fluorescent protein (YFP)-labeled AglZ formed a bright cluster at the leading cell pole and multiple stationary, near-evenly spaced clusters along the cell body, indicating the assembly of bFACs (Fig. 4D). In contrast, AglZ-YFP only formed single clusters at cell poles in the cells that lacked AgmT or expressed AgmTEAEA (Fig. 4D). Taken together, the LTG activity of AgmT is essential for bFACs assembly.
AgmT does not assemble into bFACs
We first hypothesized that AgmT itself could assemble into bFACs, where it could either generate pores in PG that allow the inner and outer gliding complexes interact directly or bind to PG and recruit other components to bFACs through protein-protein interactions. If this is the case, AgmT should localize in bFACs. To test this possibility, we labeled AgmT with PAmCherry on its C-terminus and expressed the fusion protein as the sole source of AgmT using the native promoter and locus of agmT. agmT-PAmCherry pilA− cells displayed gliding motility that was indistinguishable from pilA− cells (Fig. 2B), indicating that the fusion protein is functional. Immunoblot using an anti-mCherry antibody showed that AgmT-PAmCherry accumulated in two bands that corresponded to monomers and dimers of the full-length fusion protein, respectively (Fig. 5A). This result is consistent with the structure of E. coli MltG that functions as homodimers (PDB: 2r1f). Importantly, AgmT-PAmCherry was about 50 times more abundant than AglR-PAmCherry (Fig. 5A). To test if AgmT itself assembles into bFACs, we first expressed AgmT-PAmCherry and AglZ-YFP together using their respective loci and promoter. We exposed agmT-PAmCherry cells to 405-nm excitation (0.2 kW/cm2) for 2 s to visualize the overall localization of AgmT. We found that on a 1.5% agar surface that favors gliding motility, AglZ aggregated into bFACs whereas AgmT localized near evenly along cell bodies without forming protein clusters (Fig. 5B). Thus, AgmT does not localize into bFACs. These results echo the fact that despite its abundance, AgmT has not been identified as a component in bFACs despite extensive pull-down experiments using various bFAC components as baits6,10,34.

AgmT does not assemble into bFACs but connects bFACs to PG.
A) Immunoblotting using M. xanthus cell lysates and an anti-mCherry antibody shows that PAmCherry-labeled AgmT and AgmTEAEA accumulate as full-length proteins. AgmT is significantly more abundant than the motor protein AglR. The bacterial actin homolog MreB visualized using an MreB antibody is shown as a loading control. B) AgmT does not aggregate into bFACs. C) The LTG activity of AgmT is required for connecting bFACs to PG and expressing the E. coli LTG MltG (MltGEc) restores PG binding by bFACs in cells that lack AgmT but not in the ones that express an inactive AgmT variant (AgmTEAEA). AglR-PAmCherry was detected using an anti-mCherry antibody to mark the presence of bFACs that co-precipitate with PG-containing (lysozyme-) pellets. Lysates from the cells that express AglR-PAmCherry in different genetic backgrounds were pelleted by centrifugation in the presence and absence of lysozyme.
We reasoned that if AgmT assembles into bFACs, AgmT and gliding motors should display similar dynamic patterns. To test this possibility further, we used sptPALM to track the movements of AgmT-PAmCherry single particles on 1.5 agar surfaces at 10 Hz. Distinct from the AglR particles of which 32.1% remained stationary, AgmT moved in a diffusive manner, showing no significant immobile population. Importantly, compared to the diffusion coefficients (D) of mobile AglR particles (1.8 · 10−2 ± 3.6 · 10−3 ⎧m2/s (n = 1,833)), AgmT particles diffused much faster (D = 2.9 · 10−2 ± 5.3 · 10−3 ⎧m2/s (n = 8,548)). Taken together, neither the localization nor dynamics of AgmT displayed significant correlation with bFAC components. We thus conclude that AgmT does not assemble into bFACs
AgmT connects bFACs to PG through its LTG activity
We then explored the possibility that AgmT could modify PG through its LTG activity and thus generate the anchor sites for certain components in bFACs. If this hypothesis is true, heterologous expression of a non-native LTG could rescue gliding motility in the ⊗agmT strain. To test this hypothesis, we fused the E. coli mltG gene (mltGEc) to a vanillate-inducible promoter and inserted the resulting construct to the cuoA locus on M. xanthus chromosome that does not interfere gliding35. We subjected the ⊗agmT and agmTEAEA cells that expressed MltGEc to mecillinam (100 ⎧g/ml) stress. Induced by 100 ⎧M sodium vanillate, MltGEc restored cell morphology and integrity of the ⊗agmT strain to the wild-type level (Fig. 3C). This result confirmed that MltGEc was expressed and enzymatically active in M. xanthus. In contrast, MltGEc failed to confer mecillinam resistance to the agmTEAEA cells (Fig. 3C). A potential explanation is that AgmTEAEA could still bind to PG and thus block MltGEc from accessing M. xanthus PG. Consistent with its activity, MltGEc restored gliding motility in the agmT pilA cells but not in the agmTEAEA pilA ones (Fig. 2B). As MltGEc substitutes AgmT in gliding motility, it is the LTG activity, rather than specific interactions between AgmT and bFACs, that is required for gliding.
It is challenging to visualize how AgmT facilitates bFAC assembly through its enzymatic activity in vitro. First, the inner complex in a bFAC spans the cytoplasm, inner membrane, and periplasm and contains multiple proteins whose activities are interdependent8,10,11. It is hence difficult to purify the entire inner complex in its functional state. Second, Faure et al. hypothesized that AglQ and AglS in the gliding motor could bind PG directly11. However, such binding has not been proved experimentally due to the difficulty in purifying the membrane integral AglRQS complex. To overcome these difficulties, we used AglR-PAmCherry to represent the inner complex of bFAC and investigated how bFACs bind PG in their native environment. To do so, we expressed AglR-PAmCherry in different genetic backgrounds as the sole source of AglR using the native aglR locus and promoter. We lysed these cells using sonication, subjected their lysates to centrifugation, isolated the pellets that contained PG, and detected the presence of AglR-PAmCherry in these pellets by immunoblots using a mCherry antibody. Eliminating AgmT and disabling its active site significantly reduced the amounts of AglR in the pellets (Fig. 5B). Because such pellets contain both the PG and membrane fractions, we further eliminated PG in cell lysates using lysozyme before centrifugation and determined the amount of AglR-PAmCherry in the pellets that only contained membrane fractions. Regardless of the presence and activity of AgmT, comparable amounts of AglR precipitated in centrifugation pellets after lysozyme treatment, indicating that AgmT does not affect the expression or stability of AglR (Fig. 5B). Thus, active AgmT facilitates the association between bFACs and PG. Strikingly, the heterologous expression of MltGEc enriched AglR-PAmCherry in the PG-containing pellets from the ⊗agmT cells but not the agmTEAEA ones (Fig. 5B). These results indicate that AgmT connects bFACs to PG through its LTG activity.
Discussion
Gliding bacteria adopt a broad spectrum of nanomachineries. Compared to the trans-envelope secretion system that drives gliding in Flavobacterium johnsoniae and Capnocytophaga gingivalis that both contain PG, the gliding machinery of M. xanthus appears to lack a stable structure that transverses cell envelope, especially across the PG layer2,36,37. In order to generate mechanical force from the fluid M. xanthus gliding machinery, the inner complex must establish solid contact with PG and push the outer complex to slide11,21. In this work, we discovered AgmT as the long-sought factor that connects bFACs to PG. Such connection not only satisfies the requirement for force generation but is also essential for bFAC assembly.
It is rather unexpected that AgmT itself does not assemble into bFACs. Because MltGEc substitutes AgmT in gliding, rather than interacting with bFAC components specifically, AgmT facilitates bFAC assembly through its LTG activity. A few possibilities could explain the function of AgmT. First, LTGs usually break glycan strands and produce unique anhydro caps on their ends38–41. Certain components in bFACs could specifically bind to such modified glycan strands in PG and further recruit other components. Second, AgmT could generate small openings all over the PG meshwork that allow the inner and outer subcomplexes in bFACs to interact locally. Third, AgmT could reduce the overall rigidity of M. xanthus PG, allow the bulky inner subcomplexes to deform the PG layer, and thus establish a viscous coupling between bFACs and PG6,21.
Then how does AgmT, a protein localized diffusively, facilitate bFAC assembly into near-evenly spaced foci? The actin homolog MreB is the only protein in bFACs that displays quasiperiodic localization independent of other components18,22. M. xanthus MreB assembles into bFACs and positions the latter near evenly along the cell body6,13,18,22,42. MreB filaments change their orientation in accordance with local membrane curvatures and could hence respond to mechanical cues43–46. Strikingly, M. xanthus does assemble bFACs in response to substrate hardness (Fig. 4C) and assembled bFACs could distort the cell envelope, generating undulations on the cell surface6,10,13,47,48. Taken together, whereas AgmT potentially modifies the entire PG layer, it is still the quasiperiodic MreB filaments that determine the loci for bFAC assembly in response to the mechanical cues from the gliding substrate.
Most bacteria encode multiple LTGs that function in PG growth, remodeling, and recycling. Trans-envelope structures often require highly specialized LTGs to penetrate PG49. This work provides an example that macro bacterial machineries domesticate non-specialized LTGs for specialized functions. Other examples include MltD in the Helicobacter pylori flagellum and MltE in the E. coli type VI secretion system50,51. Both M. xanthus AgmT and E. coli MltG belong to the YceG family, which is the first identified LTG family that is conserved in both Gram-negative and positive bacteria39. LTGs in this family localize to the inner membrane and feature periplasmic transglycosylase domains39. Due to their unique localization, the YceG family LTGs are important for determining the length of nascent glycan strands and for degrading the toxic un-crosslinked strands from futile PG synthesis29,52. Due to the wide distribution of YceG family LTGs, it is challenging to study how the unique M. xanthus gliding machinery adopts AgmT in evolution. Nevertheless, the fact that AgmT is the only M. xanthus LTG that belongs to this family (Table S2) could partially explain why it is the only LTG that has been adopted by the gliding machinery. It will be interesting to investigate if other LTGs, once anchored to the inner membrane, could also facilitate bFAC assembly.
Methods
Strains and growth conditions
M. xanthus strains used in this study are listed in Table S2. Vegetative M. xanthus cells were grown in liquid CYE medium (10 mM MOPS pH 7.6, 1% (w/v) Bacto™ casitone (BD Biosciences), 0.5% yeast extract and 8 mM MgSO4) at 32 °C, in 125-ml flasks with vigorous shaking, or on CYE plates that contains 1.5% agar. All genetic modifications on M. xanthus were made on the chromosome. Deletion and insertion mutants were constructed by electroporating M. xanthus cells with 4 μg of plasmid DNA. Transformed cells were plated on CYE plates supplemented with 100 μg/ml sodium kanamycin sulfate and 10 μg/ml tetracycline hydrochloride when needed. AgmT and AgmTEAEA were labeled with PAmCherry at their C-termini by fusing their gene to a DNA sequence that encodes PAmCherry through a KESGSVSSEQLAQFRSLD (AAGGAGTCCGGCTCCGTGTCCTCCGAGCAGCTGGCCCAGTTCCGCTCCCTGGA C) linker. All constructs were confirmed by PCR and DNA sequencing.
Immunoblotting
The expression and stability of PAmCherry-labeled proteins were determined by immunoblotting using an anti-mCherry antibody (Rockland Immunochemicals, Inc., Lot 46705) and a goat anti-Rabbit IgG (H+L) secondary antibody, HRP (Thermo Fisher Scientific, catalog # 31460). MreB was detected using an anti-MreB serum22 and the same secondary antibody. The blots were developed with Pierce™ ECL Western Blotting Substrate (Thermo Fisher Scientific REF 32109) and MINI-MED 90 processor (AFP Manufacturing).
Gliding assay
Cells at 4 ×109 colony formation units (cfu)/ml were spotted on CYE plates (5 μl/spot) containing 1.5% agar, incubated at 32 °C for 48 h. Colony edges were photographed using a Nikon Eclipse™ e600 microscope with a 10× 0.30 NA objective and an OMAX™ A3590U camera.
Protein expression and purification
DNA sequences encoding amino acids 25 – 339 of AgmT and AgmTEAEA were amplified by polymerase chain reaction (PCR) and inserted into the pET28a vector (Novogen) between the restriction sites of EcoRI and HindIII. The resulting plasmids were transformed into E. coli strain BL21(DE3). Transformed cells were cultured in 20 ml LB (Luria-Bertani) broth at 37 °C overnight and used to inoculate 1 L LB medium supplemented with 1.0% glucose. Protein expression was induced by 0.1 mM IPTG (isopropyl-h-d-thiogalactopyranoside) when the culture reached an OD600 of 0.8. Cultivation was continued at 16 °C for 10 h before the cells were harvested by centrifugation at 6,000 × g for 20 min. Proteins were purified using the NGC™ Chromatography System (BIO-RAD) and a 5-ml HisTrap™ (Cytiva)17,53. Purified proteins were concentrated using Amicon™ Ultra centrifugal filter units (Millipore Sigma) with a molecular cutoff of 10 kDa and stored at −80 °C.
RBB assay
PG was purified following the published protocol28,54. In brief, M. xanthus cells were grown until mid-stationary phase and harvested by centrifugation (6,000 × g, 20 min, 25 °C). Supernatant was discarded and the pellet was resuspended and boiled in 1× PBS with 5% SDS for 2 h. SDS was removed by repetitive wash with MilliQ water and centrifugation (21,000 × g, 10 min, 25 °C). Purified PG from 100 ml culture was suspended into 1 ml 1× PBS and stored at −20 °C. RBB labelling of PG was performed essentially as previously described26,27. Purified sacculi were incubated with 20 mM RBB in 0.25 M NaOH overnight at 37 °C. Reactions were neutralized by adding equal volumes of 0.25 M HCl and RBB-labeled PG was collected by centrifugation at 21,000 × g for 15 min. Pellets were washed repeatedly with MilliQ water until the supernatants became colorless. RBB-labelled sacculi were incubated with purified AgmT and AgmTEAEA (1 mg/ml) at 25 °C for 12 h. lysozyme (1 mg/ml) was used as a positive control. Dye release was quantified by the absorption at 595 nm from the supernatants after centrifugation (21,000 × g, 10 min, 25 °C).
PG binding assay
M. xanthus cells expressing AglR-PAmCherry were grown in liquid CYE to OD600 ∼1, harvested by centrifugation (6,000 × g, 20 min, 25 °C), washed by 1× PBS, and resuspended into 1× PBS to OD600 6. Cells (1 ml) were lysed using a Cole-Parmer 4710 Ultrasonic Homogenizer (40% output). Unbroken cells and large debris were eliminated by centrifugation (6,000 × g, 10 min, 25 °C). Supernatants were subjected to centrifugation at 21,000 × g for 15 min. Pellets that contain the PG and membrane fractions were resuspended to 1 ml in 1× PBS. To collect the pellets that do not contain PG, supernatants from sonication lysates were incubated with 5 mg/ml lysozyme at 25 °C for 5 h before centrifugation. Resuspended pellets (5 ⎧l each) were mixed with equal volumes of 2× loading buffer and applied to SDS PAGE and immunoblotting.
Microscopy Analysis
For all imaging experiments, 5 ⎧l cells were spotted on an agarose pad. For the treatments with inhibitors, inhibitors were added into both the cell suspension and agarose pads. The length and width of cells were determined from differential interference contrast (DIC) images using a MATLAB (MathWorks) script18,28,55. DIC and fluorescence images of cells were captured using a Hamamatsu ImagEM X2™ EM-CCD camera C9100-23B (effective pixel size 160 nm) on an inverted Nikon Eclipse-Ti™ microscope with a 100× 1.49 NA TIRF objective. For sptPALM, M. xanthus cells were grown in CYE to 4 ×108 cfu/ml and PAmCherry was activated using a 405-nm laser (0.3 kW/cm2), excited and imaged using a 561-nm laser (0.2 kW/cm2). Images were acquired at 10 Hz. For each sptPALM experiment, single PAmCherry particles were localized in at least 100 individual cells from three biological replicates. sptPALM data were analyzed using a MATLAB (MathWorks) script18,28,55. Briefly, cells were identified using differential interference contrast images. Single PAmCherry particles inside cells were fit by a symmetric 2D Gaussian function, whose center was assumed to be the particle’s position18. Particles that explored areas smaller than 160 nm × 160 nm (within one pixel) in 0.4 - 1.2 s were considered immobile. Sample trajectories were generated using the TrackMate56 plugin in the ImageJ suite (https://imagej.net).
Supporting information
Acknowledgements
This work is supported by the National Institute of Health R01GM129000 to B. N.. C. R. C. is supported in the 2023 – 2024 academic year by a National Institute of Health Diverse Predoctoral Training in Genetics grant T32GM135115 awarded to the Genetics and Genomics Interdisciplinary Program at Texas A&M University.
Competing Interests
The authors declare no competing interests.
References
- 1Surface Sensing and Adaptation in BacteriaAnnu Rev Microbiol 74:735–760https://doi.org/10.1146/annurev-micro-012120-063427Google Scholar
- 2Novel mechanisms power bacterial gliding motilityMol Microbiol 101:186–193https://doi.org/10.1111/mmi.13389Google Scholar
- 3Architecture of the type IVa pilus machineScience 351:aad2001https://doi.org/10.1126/science.aad2001Google Scholar
- 4Genetic and functional evidence that Type IV pili are required for social gliding motility in Myxococcus xanthusMol Microbiol 18:547–558Google Scholar
- 5Uncovering the mystery of gliding motility in the myxobacteriaAnnu Rev Genet 45:21–39https://doi.org/10.1146/annurev-genet-110410-132547Google Scholar
- 6Myxobacteria gliding motility requires cytoskeleton rotation powered by proton motive forceProc Natl Acad Sci U S A 108:2498–2503https://doi.org/10.1073/pnas.1018556108Google Scholar
- 7Motor-driven intracellular transport powers bacterial gliding motilityProc Natl Acad Sci U S A 108:7559–7564https://doi.org/10.1073/pnas.1101101108Google Scholar
- 8Contact- and Protein Transfer-Dependent Stimulation of Assembly of the Gliding Motility Machinery in Myxococcus xanthusPLoS Genet 11:e1005341https://doi.org/10.1371/journal.pgen.1005341Google Scholar
- 9Emergence and modular evolution of a novel motility machinery in bacteriaPLoS Genet 7:e1002268https://doi.org/10.1371/journal.pgen.1002268Google Scholar
- 10A multi-protein complex from Myxococcus xanthus required for bacterial gliding motilityMol Microbiol 76:1539–1554https://doi.org/10.1111/j.1365-2958.2010.07184.xGoogle Scholar
- 11The mechanism of force transmission at bacterial focal adhesion complexesNature 539:530–535https://doi.org/10.1038/nature20121Google Scholar
- 12Unmasking of the von Willebrand A-domain surface adhesin CglB at bacterial focal adhesions mediates myxobacterial gliding motilitySci Adv 9:eabq0619https://doi.org/10.1126/sciadv.abq0619Google Scholar
- 13Flagella stator homologs function as motors for myxobacterial gliding motility by moving in helical trajectoriesProc Natl Acad Sci U S A 110:E1508–1513https://doi.org/10.1073/pnas.1219982110Google Scholar
- 14Bacteria that glide with helical tracksCurr Biol 24:R169–R173https://doi.org/10.1016/j.cub.2013.12.034Google Scholar
- 15Bacterial Gliding Motility: Rolling Out a Consensus ModelCurr Biol 27:R154–R156https://doi.org/10.1016/j.cub.2016.12.035Google Scholar
- 16The polarity of myxobacterial gliding is regulated by direct interactions between the gliding motors and the Ras homolog MglAProc Natl Acad Sci U S A 112:E186–193https://doi.org/10.1073/pnas.1421073112Google Scholar
- 17PlpA, a PilZ-like protein, regulates directed motility of the bacterium Myxococcus xanthusMol Microbiol 107:214–228https://doi.org/10.1111/mmi.13878Google Scholar
- 18MotAB-like machinery drives the movement of MreB filaments during bacterial gliding motilityProc Natl Acad Sci U S A 115:2484–2489https://doi.org/10.1073/pnas.1716441115Google Scholar
- 19Growth and Division of the Peptidoglycan MatrixAnnu Rev Microbiol 75:315–336https://doi.org/10.1146/annurev-micro-020518-120056Google Scholar
- 20Toward a Mechanistic Understanding of Bacterial Rod Shape Formation and RegulationAnnu Rev Cell Dev Biol 37:1–21https://doi.org/10.1146/annurev-cellbio-010521-010834Google Scholar
- 21Flagellar Motor Transformed: Biophysical Perspectives of the Myxococcus xanthus Gliding MechanismFront Microbiol 13:891694https://doi.org/10.3389/fmicb.2022.891694Google Scholar
- 22Bacterial motility complexes require the actin-like protein, MreB and the Ras homologue, MglAEmbo J 29:315–326https://doi.org/10.1038/emboj.2009.356Google Scholar
- 23Identification of genes required for adventurous gliding motility in Myxococcus xanthus with the transposable element marinerMol Microbiol 49:555–570Google Scholar
- 24De Novo Assembly and Annotation of the Complete Genome Sequence of Myxococcus xanthus DZ2Microbiol Resour Announc :e0107421https://doi.org/10.1128/mra.01074-21Google Scholar
- 25Identification of MltG as a potential terminase for peptidoglycan polymerization in bacteriaMol Microbiol 99:700–718https://doi.org/10.1111/mmi.13258Google Scholar
- 26Daughter cell separation is controlled by cytokinetic ring-activated cell wall hydrolysisEMBO J 29:1412–1422https://doi.org/10.1038/emboj.2010.36Google Scholar
- 27The bacterial septal ring protein RlpA is a lytic transglycosylase that contributes to rod shape and daughter cell separation in Pseudomonas aeruginosaMol Microbiol 93:113–128https://doi.org/10.1111/mmi.12643Google Scholar
- 28Coordinated peptidoglycan synthases and hydrolases stabilize the bacterial cell wallNature communications 14:5357https://doi.org/10.1038/s41467-023-41082-3Google Scholar
- 29Lytic transglycosylases mitigate periplasmic crowding by degrading soluble cell wall turnover productsElife 11https://doi.org/10.7554/eLife.73178Google Scholar
- 30Beta-lactam antibiotics induce a lethal malfunctioning of the bacterial cell wall synthesis machineryCell 159:1300–1311https://doi.org/10.1016/j.cell.2014.11.017Google Scholar
- 31Highly inclined thin illumination enables clear single-molecule imaging in cellsNat Methods 5:159–161https://doi.org/10.1038/nmeth1171Google Scholar
- 32Establishing rod shape from spherical, peptidoglycan-deficient bacterial sporesProc Natl Acad Sci U S A 117:14444–14452https://doi.org/10.1073/pnas.2001384117Google Scholar
- 33Evidence that focal adhesion complexes power bacterial gliding motilityScience 315:853–856Google Scholar
- 34Integrin-like adhesin CglD confers traction and stabilizes bacterial focal adhesions involved in myxobacterial gliding motilitybioRxiv :2023.2010.2019.562135https://doi.org/10.1101/2023.10.19.562135Google Scholar
- 35Two systems for conditional gene expression in Myxococcus xanthus inducible by isopropyl-beta-D-thiogalactopyranoside or vanillateJ Bacteriol 194:5875–5885https://doi.org/10.1128/JB.01110-12Google Scholar
- 36Structure and mechanism of the proton-driven motor that powers type 9 secretion and gliding motilityNature Microbiology 6:221https://doi.org/10.1038/s41564-020-00823-6Google Scholar
- 37Cargo transport shapes the spatial organization of a microbial communityProc Natl Acad Sci U S A 115:8633–8638https://doi.org/10.1073/pnas.1808966115Google Scholar
- 38A step-by-step in crystallo guide to bond cleavage and 1,6-anhydro-sugar product synthesis by a peptidoglycan-degrading lytic transglycosylaseJ Biol Chem 293:6000–6010https://doi.org/10.1074/jbc.RA117.001095Google Scholar
- 39Lytic transglycosylases: concinnity in concision of the bacterial cell wallCrit Rev Biochem Mol Biol 52:503–542https://doi.org/10.1080/10409238.2017.1337705Google Scholar
- 40Novel type of murein transglycosylase in Escherichia coliJ Bacteriol 124:1067–1076https://doi.org/10.1128/jb.124.3.1067-1076.1975Google Scholar
- 41Peptidoglycan hydrolases of Escherichia coliMicrobiol Mol Biol Rev 75:636–663https://doi.org/10.1128/MMBR.00022-11Google Scholar
- 42The small G-protein MglA connects to the MreB actin cytoskeleton at bacterial focal adhesionsJ Cell Biol 210:243–256https://doi.org/10.1083/jcb.201412047Google Scholar
- 43MreB filaments align along greatest principal membrane curvature to orient cell wall synthesisElife 7https://doi.org/10.7554/eLife.32471Google Scholar
- 44Mechanics and dynamics of translocating MreB filaments on curved membranesElife 8https://doi.org/10.7554/eLife.40472Google Scholar
- 45Rod-like bacterial shape is maintained by feedback between cell curvature and cytoskeletal localizationProc Natl Acad Sci U S A 111:E1025–1034https://doi.org/10.1073/pnas.1317174111Google Scholar
- 46MreB polymers and curvature localization are enhanced by RodZ and predict E. coli’s cylindrical uniformityNature communications 9:2797https://doi.org/10.1038/s41467-018-05186-5Google Scholar
- 47Mechanisms for bacterial gliding motility on soft substratesProc Natl Acad Sci U S A 116:25087–25096https://doi.org/10.1073/pnas.1914678116Google Scholar
- 48Mathematical modeling of mechanosensitive reversal control in Myxococcus xanthusFront Microbiol 14:1294631https://doi.org/10.3389/fmicb.2023.1294631Google Scholar
- 49Structural analysis of a specialized type III secretion system peptidoglycan-cleaving enzymeJ Biol Chem 290:10406–10417https://doi.org/10.1074/jbc.M115.639013Google Scholar
- 50Peptidoglycan maturation enzymes affect flagellar functionality in bacteriaMol Microbiol 86:845–856https://doi.org/10.1111/mmi.12019Google Scholar
- 51Domestication of a housekeeping transglycosylase for assembly of a Type VI secretion systemEMBO Rep 18:138–149https://doi.org/10.15252/embr.201643206Google Scholar
- 52MltG activity antagonizes cell wall synthesis by both types of peptidoglycan polymerases in Escherichia coliMol Microbiol 115:1170–1180https://doi.org/10.1111/mmi.14660Google Scholar
- 53Purification and preliminary X-ray crystallographic analysis of the ligand-binding domain of Sinorhizobium meliloti DctBBiochim Biophys Acta 1764:839–841https://doi.org/10.1016/j.bbapap.2005.10.023Google Scholar
- 54Ultra-Sensitive, High-Resolution Liquid Chromatography Methods for the High-Throughput Quantitative Analysis of Bacterial Cell Wall Chemistry and StructureMethods Mol Biol 1440:11–27https://doi.org/10.1007/978-1-4939-3676-2_2Google Scholar
- 55Coordinated peptidoglycan synthases and hydrolases stabilize the bacterial cell wallGitHub https://doi.org/10.5281/zenodo.8234126
- 56TrackMate 7: integrating state-of-the-art segmentation algorithms into tracking pipelinesNat Methods 19:829–832https://doi.org/10.1038/s41592-022-01507-1Google Scholar
Article and author information
Author information
Version history
- Preprint posted:
- Sent for peer review:
- Reviewed Preprint version 1:
- Reviewed Preprint version 2:
- Version of Record published:
Cite all versions
You can cite all versions using the DOI https://doi.org/10.7554/eLife.99273. This DOI represents all versions, and will always resolve to the latest one.
Copyright
© 2024, Carbo et al.
This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.
Metrics
- views
- 1,420
- downloads
- 76
- citations
- 7
Views, downloads and citations are aggregated across all versions of this paper published by eLife.