Abstract
The nuclear receptor, Farnesoid X Receptor (FXR/NR1H4), is increasingly recognized as a promising drug target for metabolic diseases, including nonalcoholic steatohepatitis (NASH). Protein coding genes regulated by FXR are well known, but whether FXR also acts through regulation of expression of long non-coding RNAs (lncRNAs), which vastly outnumber protein-coding genes, remains unknown. Utilizing RNA-seq and GRO-seq analyses in mouse liver, we found that FXR induces many RNA transcripts from chromatin regions bearing enhancer features. Among these we discovered a previously unannotated liver-enriched enhancer-derived lncRNA (eRNA), termed FincoR. We further show that FincoR is specifically induced by hammerhead-type FXR agonists, including GW4064 and tropifexor. CRISPR/Cas9-mediated liver-specific knockdown of FincoR in dietary NASH mice reduced the beneficial effects of tropifexor, an FXR agonist currently in clinical trials for NASH and primary biliary cholangitis (PBC), indicating that that amelioration of liver fibrosis and inflammation in NASH treatment by tropifexor is mediated in part by FincoR. Overall, our results indicate that pharmacological activation of FXR by hammerhead-type agonists induces a novel eRNA, FincoR, ameliorating NASH in mice. FincoR may represent a new drug target for combating metabolic disorders, including NASH.
Introduction
Nonalcoholic fatty liver disease (NAFLD) is the most common chronic liver disease and a leading cause of liver transplants and liver-related death (Friedman and Sanyal 2018). NAFLD begins with simple steatosis but may further progress to a severe form, non-alcoholic steatohepatitis (NASH), and later, fatal cirrhosis and liver cancer (Friedman and Sanyal, 2018). Despite its striking global increase and clinical importance, there is no approved drug for NASH. The urgent need for development of therapeutic agents for NASH has greatly increased research interest in the nuclear receptor, Farnesoid X Receptor (FXR, NR1H4) (Evans and Mangelsdorf, 2014).
FXR is activated by its physiological ligands, bile acids (BAs), and regulates expression of genes involved in BA, lipid, and glucose metabolism and hepatic autophagy, which maintains metabolite levels and metabolic homeostasis (Lee et al., 2006; Calkin and Tontonoz, 2012; Lee et al., 2014; Seok et al., 2014; Kliewer and Mangelsdorf, 2015). Ligand-activated FXR also protects against hepatic inflammation and liver injury (Wang et al., 2008; Jung et al., 2020). The action of FXR, similar to other nuclear receptors, is achieved primarily by binding to chromatin at specific gene loci to regulate the transcription of target genes (Lee et al., 2006; Thomas et al., 2010; Lee et al., 2012; Calkin and Tontonoz, 2012). Consistent with its crucial physiological functions, FXR is increasingly recognized as a promising drug target, particularly for liver diseases, such as NASH and primary biliary cholangitis (PBC) (Downes et al., 2003; Ali et al., 2015; Abenavoli et al., 2018; Kremoser, 2021). For example, semi-synthetic or non-steroidal synthetic agonists of FXR, including obeticholic acid (OCA) and hammerhead-type agonists, such as tropifexor and cilofexor, are currently under clinical trials for NASH and PBC patients (Tully et al., 2017; Abenavoli et al., 2018; Kremoser, 2021; Sanyal et al., 2023). However, how pharmacological activation of FXR mediates such beneficial therapeutic effects is poorly understood.
Non-protein-coding RNAs (ncRNAs) are one of the fascinating discoveries of modern biology (Cech and Steitz, 2014). Indeed, only about 2% of the human genome encodes proteins, while the vast majority are transcribed into ncRNAs (The ENCODE Project Consortium, 2012). Of these ncRNAs, long non-coding RNAs (lncRNAs) are a group of transcripts longer than 200 nucleotides and play important roles in diverse biological processes (Lam et al., 2014; Li et al., 2016; Sartorelli and Lauberth, 2020; Statello et al., 2021; Mattick et al., 2023). Many lncRNAs are produced from genomic regions bearing epigenetic features of enhancers (Hon et al., 2017; Mattick et al., 2023). This is consistent with the idea that many transcriptional enhancers actively transcribe noncoding RNAs that are referred to as eRNAs, some of which are functionally important for enhancer functions (Lai and Shiekhattar, 2014; Li et al., 2016). Due to the increasing technical sensitivity of RNA detection, many enhancers have been found to produce eRNAs (>85k in humans and >57k in mice) (Hirabayashi et al., 2019). Many eRNAs have not yet been annotated in current lncRNA databases, such as GENCODE. Exploring eRNA landscapes and functions in diverse biology and disease states will facilitate our understanding of both lncRNAs and enhancers (Li et al., 2016; Mattick et al., 2023). However, the landscape of eRNAs in mouse liver has been minimally explored (Fang et al., 2014), and has not been studied in response to specific nuclear receptor activation, such as by FXR. Moreover, functional role of eRNAs in vivo in intact organisms is understudied.
FXR was shown to regulate expression of small non-coding microRNA (miR) genes, for example miR-34a and miR-802 (Lee et al., 2010; Seok et al., 2021), but it has not been reported whether FXR mediates its function through regulating lncRNAs, which far outnumber miRs. Because FXR directly regulates expression of its target genes (Thomas et al., 2010; Lee et al., 2012), we examined if FXR regulates enhancer-derived lncRNAs, and if such transcripts participate in its physiological or pharmacological functions. By utilizing RNA-seq and GRO-seq analyses of mouse liver treated by FXR ligands, we identified a series of FXR-regulated eRNAs, including many that were previously unannotated. Among these, we focused on a highly induced and abundantly expressed eRNA that we referred to as FXR-induced non-coding RNA (FincoR) for functional studies. FincoR is highly enriched in mouse liver and is induced specifically by hammerhead-type FXR agonists, including GW4064 and tropifexor. In vivo studies utilizing CRISPR/Cas9-mediated liver-specific knockdown of FincoR in dietary NASH mice indicated that FincoR is critically involved in mediating the beneficial pharmacological effects of tropifexor in reducing liver fibrosis and inflammation.
Results
Activation of FXR by GW4064 induces a novel eRNA, FincoR, in mouse liver
To identify enhancer-derived lncRNAs (eRNAs) potentially regulated by FXR, we first obtained a list of putative enhancers in mouse liver based on ENCODE H3K27ac ChIP-Seq data (ENCFF001KMI, see methods). Then, we performed ribo-depleted total RNA-seq in the livers from mice treated with a specific FXR agonist, GW4064, to identify transcripts produced from these enhancer regions (see Supplementary Table S1). To avoid confounding issues of RNA signals from genes, we specifically focused on intergenic enhancer regions (+/-3kb from H3K27ac peak center) that harbor discernible RNA-Seq signals (RPKM > 1).
This genomic analysis resulted in identification of 190 high-confidence eRNAs in mouse liver. Among these, 14 eRNAs were upregulated and 5 were downregulated by GW4064 treatment (FDR < 0.05, Log2 FC > 1, Figure 1A) (see Supplementary Table S2). FXR-regulated eRNAs were produced adjacent to many genes with important roles in liver metabolism and disease, for example, Hes1 (Figure 1-Figure Supplement 1A, B). One of the most robustly induced eRNAs was FXR-induced non-coding RNA (FincoR), an unannotated novel transcript located on chromosome 19 (Figure 1A, B, C). Reverse transcription qPCR (RT-qPCR) confirmed that treatment with GW4064 substantially induced expression of FincoR, more than 10-fold in mouse liver, which is similar to induction of Shp, a well-known FXR target gene (Figure 1D) (Goodwin et al., 2000; Claudel et al., 2005; Evans and Mangelsdorf, 2014). Induction of FincoR by GW4064 was transient, peaked within 1 h and then, declined gradually, similar pattern to Shp (Figure 1-Figure Supplement 1C). Expression of genes adjacent to FincoR, including Gcnt1, Rfk, Pcsk5 and Prune2, did not change after acute 1 h FXR activation as shown by RNA-seq (Figure 1C), and confirmed for Gcnt1 by time course qPCR (Figure 1-Figure Supplement 1C).

Activation of FXR by GW4064 induces FincoR, a novel eRNA, in mouse liver.
(A) C57BL/6 male mice were fasted overnight and i.p. injected with vehicle or GW4064 (30 mg/kg) for 1 h, and livers were collected (n = 4 mice). RNAs from two mice (per group) were pooled for RNA-seq. Volcano plot showing significantly induced eRNAs (FincoR highlighed) by GW4064 treatment. The x axis denotes log2 fold change (GW4064/Veh) of eRNAs and the y axis denotes -log10 FDR of eRNAs. (B) The bar plot showing the RPMs of up-regulated eRNAs by GW4064 treatment. (C) FincoR induction by GW4064 treatment was shown in the genome browser track. (D) GW4064 induction of FincoR and Shp was measured in the liver by qPCR (n = 4 mice). Data are presented as mean ± SEM. Statistical significance was determined by the two-way ANOVA Sidak’s multiple comparisons test with *p < 0.05 and ***p < 0.001. Veh, vehicle; GW, GW4064; pos, positive strand; neg, negative strand; Refseq, reference sequence.
We also found that the short GW4064 treatment resulted in 590 up-regulated genes and 500 down-regulated genes (FDR < 0.05) (Figure 1-Figure Supplement 2A). GO enrichment analysis of these differentially expressed genes (DEGs) revealed their roles in the regulation of triglyceride, fatty acid, and cholesterol metabolism (Figure 1-Figure Supplement 2B), which is consistent with known roles of FXR in these physiological processes (Claudel et al., 2005).
Ligand-activated FXR directly activates transcription of eRNAs, including FincoR
We sought to examine, 1) if these eRNAs were directly activated by FXR, and 2) if the activation takes place transcriptionally using FXR liver-specific knockout (FXR-LKO) mice that were treated with GW4064 to determine if FXR was required for induction of eRNAs by GW4064. FXR-LKO mice were generated from FXR floxed mice (FXR-flox) (Figure 2-Figure Supplement 1A) and transcription of eRNAs was detected by global run-on sequencing (GRO-seq), a widely used method to detect nascent RNA transcription, including eRNAs (Lam et al., 2014; Li et al., 2016; Sartorelli and Lauberth, 2020). GRO-seq showed that FXR-induced eRNAs were activated transcriptionally by GW4064 in FXR-flox mice, but such induction was abolished in FXR-LKO mice (Figure 2A). In particular, FincoR is robustly induced in the GRO-Seq analysis and its induction is dependent on hepatic FXR (Figure 2B). RT-qPCR confirmed the FXR-dependent expression of FincoR, similar to that of Shp (Figure 2-Figure Supplement 1B).

Ligand-activated FXR directly activates transcription of eRNAs including FincoR in the liver.
(A) Experimental outline: FXR-Flox and LKO male mice were fasted overnight and treated with vehicle or GW4064, livers were collected 1 h later (n = 2 each) and nuclei was isolated for Gro-seq. Box plot shows the up-regulated eRNA GRO-Seq RPKMs in different conditions. (B) Gro-seq profile of FincoR expression and genome browser tracks of H3K4me1, H3K27ac, FXR and RXRα binding peaks at FincoR locus were shown. (C) ChIP assays were performed in liver samples from Fig. 1A to detect FXR, RXRα, and BRD4 occupancy to the FXR binding peak region close to the transcription start site of FincoR. (D) HepG2 cells were transfected with luciferase reporter expressing wild type FXRE or mutant FXRE (see materials and methods) for 24 hrs before further subject to GW4064 for 6 hrs. The relative luciferase activity was shown.
We next examined if FXR binds to these enhancers that produce the identified eRNAs by analyzing published mouse liver ChIP-Seq data for FXR (Supplementary Table S3) (Thomas et al., 2010; Lee et al., 2012). FXR binding was strongly enriched at the enhancers associated with FXR-induced eRNAs as were the enhancer marks H3K27ac and H3K4me1 (Figure 2-Figure Supplement 1C). In Figure 2B, the results show the binding of FXR and the presence of histone marks at the FincoR enhancer region determined by ChIP-seq as compared with nascent transcripts detected by Gro-seq. These analyses support the conclusion that activation of FXR transcriptionally induces this series of eRNAs via chromatin binding at these enhancers, including FincoR. We validated FXR binding at the enhancer region that produces FincoR using mouse liver ChIP (Figure 2C). We also examined binding of a well-known DNA binding partner of FXR, Retinoid x Receptor alpha (RXRα/NR2B1) (Evans and Mangelsdorf, 2014; Zheng et al., 2018), and bromodomain-containing protein 4 (BRD4), an acetylated histone reader protein that often binds at active enhancers (Chen et al., 2016; Li et al., 2016; Rahnamoun et al., 2018; Sartorelli and Lauberth, 2020) and a transcriptional coactivator of FXR (Jung et al., 2020). GW4064 treatment resulted in substantial increases in recruitment of both FXR and RXRα to the enhancer region close to the transcription start site of FincoR (arrow shown below in Figure 2B), whereas binding was not detected at a control region (Figure 2C). We also found that BRD4 occupancy was increased at this enhancer region after GW4064 treatment (Figure 2C). These results indicate that GW4064 activation of FXR leads to increased occupancy of the FXR/RXRα heterodimer and BRD4 to the enhancer region to upregulate FincoR eRNA in the liver.
We identified an inverted repeat1 (IR1) motif that was known to bind FXR (Lee et al., 2006; Calkin and Tontonoz, 2012) within the major FXR binding peak near the start site of FincoR (arrow shown below in Figure 2B), which we also refer to as FXRE (Figure 2B, C). We examined the functionality of this IR1 motif for mediating transcriptional activation by GW4064 using reporter assays (Figure 2D). We cloned the region containing the IR1 motif into the pGL4.23 luciferase reporter and generated a mutated IR1 motif construct as a comparison (Figure 2D). After transfection into human hepatic HepG2 cells, GW4064 treatment significantly elevated the luciferase activity of the reporter with the wild type IR1 motif, but not with the mutated IR1 motif (Figure 2D). Together, these results suggest that GW4064-activated FXR directly upregulates FincoR expression.
FincoR is a liver-specific nucleus-enriched eRNA
Because enhancers and eRNAs generally act in a tissue-specific manner (Li et al., 2016; Sartorelli and Lauberth, 2020), we examined the tissue-specific expression of FincoR in mice. Strikingly, FincoR is highly expressed in the liver and it is expressed at extremely low levels in most other tissues, except for a detectable, but still fairly low, level in the lung. GW4064 treatment resulted in induction of FincoR specifically in the liver (Figure 3A). The level of FincoR detected in isolated primary mouse hepatocytes (PMHs) was similar to that in mouse liver tissue treated with GW4064, suggesting that the majority of FincoR is present in hepatocytes (Figure 3B).

FincoR is a liver-specific nucleus-enriched eRNA.
(A) C57BL/6 male mice were fasted overnight and i.p. injected with vehicle or GW4064 (30 mg/kg) for 1 h. Tissues were collected and FincoR mRNA level was measured (n = 2 mice). (B) C57BL/6 male mice were fasted overnight and i.p. injected with vehicle or GW4064 (30 mg/kg) for 1 h. One small piece of liver was snap-frozen for later RNA isolation and the remaining part was used for immediate primary hepatocyte isolation. Then, RNAs were extracted from liver or primary hepatocytes and FincoR expression was measured. (C) Agarose gel electrophoresis of PCR products generated in 5′ (left) and 3′ (right) RACE of FincoR in liver samples. Primer locations were show. (D) Schematic diagrams of full-length FincoR. (E) PhyloCSF analysis of the coding potential of FincoR. (F) In vitro translation of FincoR using the Promega Transcend Non-Radioactive Translation Detection Systems. Luciferase is used as controls for coding RNA. (G) qPCR analysis of FincoR, 36b4 in Poly(A)+ and Poly(A)-RNA fractions from GW4064 treated mouse liver. (H) FincoR identified in the subcellular fraction using cellular fractionation assays. The primary hepatocytes were isolated from GW4064 or DMSO treated mouse liver and the cytoplasm and nucleus fractions of these hepatocytes were separated and both fractions were subjected to RNA extraction and qPCR. RACE, rapid amplification of cDNA ends.
By using the 5’ and 3’ rapid amplification of cDNA ends (RACE), we identified one transcript of FincoR that is of approximately 3.7 kb in length (Figure 3C). However, based on RNA-seq, the length of FincoR is over 10 kb (Figure 1C), suggesting there are likely additional multiple RNA isoforms that we were not able to identify by RACE. We next analyzed the coding potential of FincoR utilizing a comparative genomic program, PhyloCSF. While adjacent genes Gcnt1 and Prune2 (Figure 3D, E) were correctly predicted to encode proteins, FincoR did not contain a potential protein-coding open reading frame (Figure 3E). Consistent with this bioinformatic prediction, a vector expressing FincoR failed to produce any proteins in an in vitro transcription/translation assay (Figure 3F) confirming that the FincoR transcript is a noncoding RNA. FincoR transcripts were enriched by binding to oligo-dT beads, suggesting that FincoR is 3’ polyadenylated (Figure 3G). Further, FincoR was detected in the nuclear compartment and GW4064 treatment increased the nuclear abundance of FincoR (Figure 3H), consistent with its potential transcriptional regulatory function. Together, these results from molecular biochemical characterization studies reveal that FincoR is a liver-enriched nuclear polyadenylated eRNA.
FincoR is induced specifically by the hammerhead-type synthetic FXR agonist
To determine whether induction of the FXR-induced FincoR is ligand-specific, we examined the effects of hammerhead-type synthetic FXR agonists, GW4064, cilofexor, and tropifexor; a semi-synthetic agonist, OCA; and a non-hammerhead-type gut-specific agonist, fexaramine (Figure 4A) (Downes et al., 2003; Fang et al., 2015). Remarkably, treatment with each of the hammerhead type agonists for 1 h resulted in a robust induction of FincoR (Figure 4B), whereas FincoR levels were unchanged after treatment with OCA or fexaramine for 1 h (Figure 4B). Treatment with OCA for 4 h or even one-week treatment with OCA failed to induce hepatic FincoR in mice, while expression of Shp was significantly induced (Figure 4C, D). Acute feeding with a diet supplemented with 0.5% cholic acid (CA), a primary BA, for 6 h also failed to induce FincoR expression (Figure 4E). Collectively, these results demonstrate that FincoR is induced specifically by hammerhead type FXR agonists.

FincoR is induced by the hammerhead class of non-steroidal FXR agonists, including GW4064 and tropifexor.
(A) The chemical structures of the FXR agonists including the hammerhead class of non-synthetic FXR agonists, non-hammerhead-type non-synthetic agonists, semi-synthetic BA and natural BA. (B) C57BL/6 mice were treated with GW4064 (30 mg/kg) or Cilofexor (30 mg/kg) or Tropifexor (0.5 mg/kg) or Fexaramine (100 mg/kg) or OCA (20 mg/kg) for 1 h after over-night fasting. The liver RNAs were extracted and FincoR expression was measured (n = 3∼4 mice). (C) C57BL/6 mice were treated with OCA (20 mg/kg) or Fexaramine (100 mg/kg) for 4 hrs after over-night fasting. The liver RNAs were extracted and FincoR expression was measured (n = 3 mice). (D) C57BL/6 mice were daily treated with OCA (20 mg/kg) for 7 days after over-night fasting. The liver RNAs were extracted and FincoR expression was measured (n = 5 mice). Shp gene was used as a positive control. (E) C57BL/6 mice were fed with 0.5% cholic acid (CA) diet for 6 hrs after over-night fasting. The liver RNAs were extracted and FincoR expression was measured (n = 3∼4 mice). (B-E) Data are presented as mean ± SEM. Statistical significance was determined by the Student’s t test with *p < 0.05, **p < 0.01 and ***p < 0.001.
Generation of CRISPR/Cas9-mediated FincoR liver-specific knockdown mice
To explore the functional role of hepatic FincoR, we utilized the CRISPR/Cas9 technique to generate FincoR liver-specific knockdown (FincoR-LKD) mice (Figure 5-Figure Supplement 1A). Adenoviral-mediated sgRNA expression in Cas9 mice resulted in downregulation of FincoR specifically in the liver by about 60%, but not in other tissues (Figure 5B). As FXR is a key regulator of bile acid, cholesterol, lipid, and glucose metabolism and FincoR is specifically regulated by FXR, FincoR may have a role in the metabolic process in physiology and disease. We examined liver triglyceride, cholesterol, bile acid, glycogen and serum non-esterified fatty acids (NEFA) but FincoR downregulation did not result in any significant changes under physiological conditions (Figure 5C).

Generation of CRISPR/Cas9-mediated FincoR liver-specific knockdown mice.
(A) Male Cas9 mice were infected with adenovirus expressing sgRNA for FincoR or control for 1 week. Then the liver and serum were collected from these mice after 4∼5 hrs of fasting. (B) The expression of FincoR in the liver was measured by qPCR (n = 4 mice). (C) Hepatic triglyceride, cholesterol, bile acid, glycogen and serum NEFA were measured (n = 5∼7 mice) (D) Male Cas9 mice were infected with adenovirus expressing sgRNA for FincoR or control for 1 week. Then these mice were fasted overnight and treated with GW4064 for 3 hrs before tissue collection. RNA-seq profiles of expression of hepatic FincoR and the adjacent genes were shown (n = 2 mice). (E) Genome-wide changes in mRNA expression shown in a volcano plot. The numbers refer to the number of genes up-or down-regulated by 2-fold or more with a p-value < 0.01. (F) Gene ontology analysis of biological pathways using DAVID Tools.
To explore the molecular signatures and pathways affected by FincoR, we examined the global gene expression by RNA-seq analysis in mouse liver after FincoR knock-down (Figure 5D). While FincoR was markedly downregulated, the neighboring genes, such as Gcnt1, Rfk, Pcsk5, were largely unchanged (Figure 5D). The RNA-seq analysis revealed 18 up-regulated genes and 53 downregulated genes in FincoR-LKD liver (Supplementary Table S4; Figure 5E). GO analysis indicated that these genes were enriched in pathways involved in fatty acid oxidation, organelle organization and metabolic process (Figure 5F). Among the down-regulated genes, Ppp1r3g which has a role in controlling glycogen synthesis, and Igfbp2 which functions in insulin resistance, were markedly reduced (Supplementary Table S4; Figure 5-Figure Supplement 1D, E). Among the up-regulated genes, expression of Eda2r was substantially increased, which belongs to a member of tumor necrosis factor receptor superfamily and is involved in inflammation, the immune response and development (Figure 5-Figure Supplement 1F). Fndc1 which is involved in fibronectin matrix remodeling was also suppressed by FincoR (and thus upregulated upon its KO, Figure 5-Figure Supplement 1G). These studies suggested that FincoR may have a role in modulating metabolic homeostasis by regulating genes involved in metabolism and inflammation.
Amelioration of hepatic steatosis mediated by tropifexor is independent of FincoR in diet-induced NASH mice
Tropifexor, also known as LJN452, is a highly potent hammerhead type FXR agonist that is currently under clinical trials for NASH and PBC patients (Tully et al., 2017; Kremoser, 2021; Sanyal et al., 2023). Because FincoR is induced specifically by the hammerhead class of FXR agonist (Figure 4) and has a potential role in the regulation of metabolism and inflammation (Figure 5), we hypothesized that FincoR may play a role in tropifexor-mediated beneficial effects on reducing NASH pathologies in mice.
We adopted a mouse model that had been fed the Amylin Liver NASH-promoting (AMLN) diet (Zhao et al., 2018; Hernandez et al., 2019; Sun et al., 2022), and examined the effects of liver-specific downregulation of FincoR in potentially impacting tropifexor effects on NASH pathology. Cas9 mice fed AMLN diet for 12 weeks were injected via tail veins with adenovirus expressing control sgRNA or FincoR sgRNA, respectively, and then treated daily with tropifexor (0.3 mg/kg) for 12 days (Figure 6A). In these mice, as a technical validation of RNA induction and knockdown, FincoR levels were significantly increased by FXR agonist tropifexor, and the increase was blocked by adenovirus expressing sgRNA for FincoR (Figure 6B).

In diet-induced NASH mice, tropifexor-mediated beneficial effects on reducing hepatic steatosis are largely independent on FincoR.
(A-E) Male Cas9 mice were fed with NASH diet for 12 weeks. Then these mice were randomly assigned to 3 groups and infected with adenovirus expressing sgRNA for FincoR or control. Three days later, the mice were treated with Tropifexor (0.3 mg/kg) for 12 days. On the tissue collection day, the mice were given the last shot of Tropifexor or vehicle and fasted for 4 hrs before tissues were collected (n = 6 ∼ 7 mice). (A) Experimental scheme. (B) Hepatic FincoR expression was measured (n = 6∼7 mice). (C) Oil Red O staining of liver sections. Scale bar (50 μm). (D) Hepatic TG, hepatic cholesterol, gallbladder BA and hepatic BA levels were measured (n = 6 ∼ 7 mice). (E) mRNA levels in the liver of the indicated genes involved in bile acid regulation and lipid regulation (n = 6 ∼ 7 mice). (B, D and E) Data are presented as mean ± SEM. Statistical significance was determined by the one-way ANOVA (Sidak’s multiple comparisons test) with *p < 0.05, **p < 0.01 and ***p < 0.001. Ad, adenovirus; H & E, hematoxylin and eosin; TG, triglyceride; Veh, vehicle; ns, not significant.
We then examined the effect of tropifexor treatment and FincoR downregulation on hepatic steatosis in these mice. Tropifexor treatment markedly reduced neutral lipids determined by Oil Red O staining of liver sections (Figure 6C) and liver TG levels (Figure 6D), and these beneficial effects on reducing fatty liver were not altered by FincoR downregulation. Also, FincoR downregulation had little effects on liver cholesterol and gallbladder bile acid levels, although these levels were reduced by Tropifexor (Figure 6D).
Consistent with the phenotypes, hepatic expression of key genes involved in BA synthesis was dramatically reduced by tropifexor treatment (i.e., Cyp7a1 and Cyp8b1), which is consistent with decreased gallbladder BA levels by this drug (Figure 6E). Similarly, tropifexor also lowered lipid synthesis genes (Srebp1, Lipin, Scd1), consistent with decreased liver TG levels. However, downregulation of FincoR did not result in changes in mRNA levels of these genes (Figure 6E). These results indicate that tropifexor-mediated beneficial effects on reducing hepatic steatosis are independent of FincoR.
FincoR facilitates alleviation of liver inflammation by tropifexor in diet-induced NASH
Tropifexor ameliorated fibrotic NASH pathologies in preclinical studies (Tully et al., 2017; Hernandez et al., 2019) and recently completed phase 2 clinical trials for NASH patients (Sanyal et al., 2023). We, therefore, further examined the effects of FincoR downregulation on altering other NASH pathologies, including hepatocellular apoptosis, liver fibrosis and inflammation.
In the same AMLN diet-fed mice above (Figure 6), analyses of liver sections revealed that tropifexor treatment reduced hepatocyte swelling/ballooning (H&E staining), decreased numbers of apoptotic cells (TUNEL staining), alleviated fibrosis (Sirius red staining), and lowered infiltration of macrophages (F4/80 staining) (Figure 7A). Remarkably, these tropifexor-mediated beneficial effects on NASH pathologies were all markedly diminished by FincoR downregulation (Figure 7A). This was consistently found in various liver lobes and two representative pictures from 2 different lobes are shown (Figure 7A). In control experiments, FincoR downregulation in vehicle-treated mice did not result in marked changes in NASH pathologies (Figure 7-Figure Supplement 1). These results demonstrate that FincoR is required for tropifexor-mediated beneficial effects on reducing NASH pathologies, specifically reducing hepatic inflammation, fibrosis and hepatocyte apoptosis. Consistent with these results, serum ALT levels, an indicator of liver damage, were significantly elevated after FincoR downregulation (Figure 7B). Protein levels of key inflammatory markers, IL1β and CCL2, in liver extracts were also elevated after FincoR downregulation (Figure 7C).

In diet-induced NASH mice, tropifexor-mediated beneficial effects on reducing liver fibrosis and inflammation are diminished by FincoR downregulation.
H & E, F4/80, Sirius Red and TUNEL staining of liver sections from Figure 6. Scale bar (50 μm). Image analyses were done using Image J and the area of collagen staining, TUNEL and F4/80 levels were quantified (n = 5/group). (B) Serum ALT level was measured (n = 5/group). (C) IL-1β and CCL2 levels in the liver tissues were determined by ELISA (n = 5/group). (D) mRNA levels in the liver of the indicated genes involved in inflammation, fibrosis and cell death (n = 5/group). (E) Model: FincoR is a liver-specific lncRNA that is induced specifically by hammerhead-type FXR agonists (top). In diet-induced NASH mice, FincoR is required for tropifexor-mediated beneficial effects on reducing hepatic inflammation, fibrosis, and cell death with the mechanisms to be explored further (bottom). (A-D) Data are presented as mean ± SEM. Statistical significance was determined by the one-way ANOVA (Sidak’s multiple comparisons test) with *p < 0.05, **p < 0.01 and ***p < 0.001.
Consistent with the phenotypes from histological analyses, hepatic expression of fibrosis and inflammation was altered by FincoR knockdown. For example, tropifexor treatment reduced mRNA levels of several genes that promote fibrosis (Col1a1, Col1a2, Acta2) and hepatic inflammation (Eda2r, Ifng, Ccl3), whereas these reductions were largely reversed by FincoR downregulation (Figure 7D). We also detected increased expression of inflammatory genes (Ccl2, Ccr2, Lcn2) and extracellular matrix remodeling gene (Fndc1) in mice liver with FincoR knockdown (Figure 7D). Tropifexor treatment suppresses hepatic apoptosis by reducing pro-apoptotic genes (Ctsb, Ctss) and upregulating anti-apoptotic genes such as Bcl2 (Warren et al., 2019). Importantly, these effects were significantly reversed by FincoR downregulation (Figure 7D).
Collectively, these results demonstrate that in diet-induced NASH mice, pharmacological activation of FXR by tropifexor reduced fibrosis, apoptosis, and inflammation in NASH mice, which was dependent, at least in part, on the induction of FincoR.
Discussion
FXR maintains metabolic homeostasis by transcriptional regulation of genes. Direct regulation of protein-coding genes by FXR, including Shp, is well characterized. In this study we show that FXR also mediates its functions by induction of lncRNA genes, which vastly outnumber protein-coding genes. We further show that pharmacological activation of FXR by hammerhead-type agonists induces a liver-specific enhancer-derived lncRNA, which we named FincoR, that contributes to reduction of NASH pathologies in mice.
FincoR is specifically induced by the hammerhead class of FXR agonists, such as GW4064, cilofexor, and tropifexor. It was not induced by other FXR ligands, including its endogenous ligand, cholic acid, suggesting that FincoR does not contribute to physiological functions of FXR, but instead plays a role in pharmacological FXR responses and possibly in pathological processes. GW4064 is the mother compound of these isoxazole type ligands but is not an ideal therapeutic agent because of its poor water solubility and pharmacokinetics (Abel et al., 2010). In contrast, tropifexor and cilofexor have better pharmacokinetics and were generally well-tolerated in clinical trials for NASH and PBC patients (Tully et al., 2017; Abenavoli et al., 2018; Kremoser, 2021; Sanyal et al., 2023), but the underlying mechanisms for their beneficial effects are poorly understood. Intriguingly, a recent study showed that the gene signature regulated by tropifexor-activated FXR appears to be broader than that of OCA, partly because the tropifexor backbone allows a more favorable interaction of FXR with coactivators or epigenomic modulators (Hernandez et al., 2019). Further, tropifexor was shown to regulate distinct sets of genes, particularly those promoting fibrosis, inflammation, and oxidative stress, in experimental NASH (Hernandez et al., 2019). Utilizing CRISPR/Cas9-mediated liver-specific knockdown of FincoR in diet-induced NASH mice, we demonstrate that beneficial effects on reducing liver fibrosis, inflammation, and apoptosis mediated by tropifexor were largely dependent on FincoR (Model, Figure 7E).
The roles of regulatory RNAs in liver function and diseases and as therapeutic targets or drugs are increasingly being appreciated (Sallam et al., 2016; Zhao et al., 2018; Brocker et al., 2020; Li et al., 2021). For example, a critical role for an oxysterol nuclear receptor LXR-induced lncRNA, LeXis, in feedback modulation of cholesterol biosynthesis has been shown (Sallam et al., 2016). Recently, the role of a lncRNA, Pair, in the liver phenylalanine metabolism has been demosntrated (Li et al., 2021). Enhancer RNAs are a less characterized class of lncRNAs and are highly associated with enhancer functions in gene regulation (Li et al., 2016). Numerous studies have revealed transcriptional roles for eRNAs in various cellular processes (Lai and Shiekhattar, 2014; Lam et al., 2014; Li et al., 2016) but most previous eRNA studies have used culture cells (Li et al., 2013; Hsieh et al., 2014), with only a few in vivo studies in mouse models (Mirtschink et al., 2019; Tang et al., 2023). In our current study, through integrative analysis of transcriptome and histone mark ChIP-Seq, we identified FXR-induced eRNAs, including the highly induced FincoR. We further examined the expression of function of FincoR utilizing mouse models. Our current work characterized the role of FincoR in gene regulation and in mediating beneficial pharmacological effects of FXR agonists in NASH, representing an important progress in understanding physiological/pathological roles of eRNAs in vivo. Future work is warranted to understand the exact mechanisms by which FincoR facilitates action of FXR agonists to alleviate inflammation, fibrosis and apoptosis.
While this study focused on regulation of FincoR by pharmacological activation of FXR, physiological and pathological regulations of FincoR appear to be complex. FincoR was not induced by acute cholic acid feeding, but FincoR levels were elevated in mouse models of cholestatic liver (data not shown), where BA metabolism is dysregulated. Since different BAs can activate or repress the gene-regulating function of FXR (Wahlstrom et al., 2016), altered BA composition in cholestatic liver may contribute to induction of FincoR. Further, binding peaks for multiple nuclear receptors, FXR, LXR, PPARα, RXRα, and HNF-4α, were detected in the FincoR gene locus so that regulation of FincoR likely involves combinatorial regulation by multiple nuclear receptors (Other Supplementary Figure 1). Interestingly, occupancy of the nuclear receptor PPARα at the enhancer region was increased in fasted mice (Other Supplementary Figure 2). It will be interesting to see whether expression of FincoR is differently regulated by these nuclear receptors in response to physiological and pathological cues.
FXR is increasingly recognized as an important therapeutic target for enterohepatic diseases, but the development of clinically applicable and more targeted FXR-based therapy is still challenging. In this study, we provided the first characterization of an eRNA, FincoR, induced by pharmacological activation of FXR and show that FincoR has a beneficial role in reducing liver fibrosis and inflammation in dietary NASH mice. Complete understanding of the function and mechanisms of FincoR may provide novel insights for the development of desirable therapy for NASH and other chronic liver diseases.
Materials and Methods
Animal experiments
All animal studies were performed according to procedures approved by the Institutional Animal Care & Use Committee at the University of Illinois at Urbana-Champaign and were in accordance with National Institutes of Health guidelines. Mice were maintained in 12/12 h light/dark cycles and fed standard rodent chow. FXR-LKO mice were generated by breeding FXR floxed mice with Albumin-Cre mice (The Jackson Lab). FincoR-LKD mice were generated as previously reported (Zhao et al., 2018). Briefly, Cas9 transgenic mice (JAX #024858) were via the tail vein injected with adenoviruses (approximately 5x108 PFU) expressing two sgRNAs targeting FincoR (sgRNA1: GGGTTAAGAGCTGTAGGCTG and sgRNA2: ACTTCTATGTCCAACAACCG). The sequences of sgRNAs were designed using a CRISPR design tool (http://crispr.mit.edu/).
Mice were given a single dose of vehicle or 30 mg/kg GW4064 (in corn oil, Tocris Bioscience, #2473) after overnight fasting. Mice were treated with 0.5 mg/kg tropifexor (in corn oil, MedChem Express, HY-107418), 30 mg/kg cilofexor (in corn oil, MedChemExpress, HY-109083), 100 mg/kg fexaramine (in 0.5% methylcellulose, MedChem Express, HY-10912), and 20 mg/kg OCA (in 0.5% methylcellulose, MedChem Express, HY-12222) as indicated. C57BL6 mice were fed with a chow diet containing 0.5% CA for 6 hrs (Jung et al., 2020).
For liver-specific downregulation of FincoR, mice were fed AMLN diet (Research Diets, D09100310, 40 kcal% fat, 2% cholesterol, 20 kcal% fructose) for 12 weeks and then, were injected with adenovirus expressing control sgRNA or sgRNA targeting FincoR and administration of tropifexor was started 3 days later given at 0.3 mg/kg dissolved in corn oil.
RNA-Seq
C57BL/6 mice were fasted overnight and treated with 30 mg/kg GW4064 or vehicle for 1 h. RNA-seq was performed as previously described (Byun et al., 2018; Seok et al., 2018; Byun et al., 2020). Briefly, the RNAs from livers (n = 2 mice/group, each group contains RNAs pooled from 2 mice) were prepared (RNeasy, Qiagen). Ribosomal RNA was removed with the Ribozero HMR Gold kit (Illumina).
Construction of strand-specific RNAseq libraries
Construction of the RNAseq libraries and sequencing on the Illumina NovaSeq 6000 were performed at the Roy J. Carver Biotechnology Center at the University of Illinois at Urbana-Champaign. After DNase digestion, purified total RNAs were analyzed on a Fragment Analyzer (Agilent) to evaluate RNA integrity. The total RNAs were converted into individually barcoded polyadenylated mRNAseq libraries with the Kapa HyperPrep mRNA kit (Roche). Libraries were barcoded with Unique Dual Indexes (UDI’s) which have been developed to prevent index switching. The adaptor-ligated double-stranded cDNAs were amplified by PCR for 8 cycles with the Kapa HiFi polymerase (Roche). The final libraries were quantitated with Qubit (ThermoFisher) and the average cDNA fragment sizes were determined on a Fragment Analyzer. The libraries were diluted to 10 nM and further quantitated by qPCR on a CFX Connect Real-Time qPCR system (Bio-Rad) for accurate pooling of barcoded libraries and maximization of number of clusters in the flowcell.
Sequencing of libraries in the NovaSeq
The barcoded RNAseq libraries were loaded on one SP lane on a NovaSeq 6000 for cluster formation and sequencing. The libraries were sequenced from one end of the fragments for a total of 100 bp. The fastq read files were generated and demultiplexed with the bcl2fastq v2.20 Conversion Software (Illumina, San Diego, CA). The quality of the demultiplexed fastq files was evaluated with the FastQC software, which generates reports with the quality scores, base composition, k-mer, GC and N contents, sequence duplication levels and overrepresented sequences.
GRO-seq
To harvest the nuclei from mouse liver cells, the liver was harvested at indicated time and washed with a cold swelling buffer (10 mM Tris pH 7.5, 2 mM MgCl2, 3 mM CaCl2, 2 U/ml Superase-In). The nuclei were prepared by Dounce homogenization in cold swelling buffer and filtered using the cell strainer (100 μm, BD Biosciences). Nuclei were collected by centrifugation at 400 x g for 10 min, then resuspended in the lysis buffer (swelling buffer with 10% glycerol and 1% IGEPAL) and incubated on ice for 5 min. Nuclei were washed twice with the lysis buffer and resuspended at a concentration of 108 nuclei/ml in the freezing buffer (50 mM Tris pH 8.3, 40% glycerol, 5 mM MgCl2, 0.1 mM EDTA). We then followed our previous method (Li et al., 2013; Oh et al., 2021) to conduct nuclear run-on and GRO-Seq library preparation. Briefly, the nuclei in freezing buffer were subjected to the nuclear run-on reaction by mixing with an equal volume of run-on buffer (10 mM Tris-Cl pH 8.0, 5 mM MgCl2, 1 mM dithiothreitol (DTT), 300 mM KCl, 20 units of Superase-In, 1% sarkosyl, 500 µM ATP, GTP, Br-UTP and 2 µM CTP) for 5 min at 30 °C. The BrU-labeled run-on RNAs were extracted by TRIzol and purified by anti-BrdU agarose beads (Santa Cruz Biotech, sc-32323 AC). The run-on RNAs were then subjected to end repair by T4 PNK, poly-adenylation, and then to cDNA first strand synthesis by a custom primer (oNTI223) that allows circularization of the cDNA. This cDNA then was re-linearized by Ape1 (NEB), size selected by TBE gel and the products of the desired size were excised (∼320–350 bp) for final library prep and sequencing. GRO-Seq samples were run on a NextSeq 500 sequencer from Illumina with a single-end 80 nt model.
Histological analyses
For histology, tissues were dissected and immediately fixed in 10% formalin overnight and processed for paraffin embedding and H&E staining. Paraffin-embedded liver sections were incubated with F4/80 antibody, and antibody was detected using a peroxidase-based method (Abcam, ab64238). Liver collagen was detected by Sirius Red staining (Abcam, ab246832) and apoptosis was detected by TUNEL staining (Millipore, S7100). For Oil Red O staining, liver tissue was frozen in OCT compound (Sakura Finetek, 4583), sectioned, and stained. Liver sections were imaged with a NanoZoomer Scanner (Hamamatsu) and quantification was done using NIH ImageJ.
Metabolic analyses
Hepatic levels of TG (Sigma, MAK266), cholesterol (Sigma, MAK043), glycogen (Biovision, K646-100), total BA levels (Diazyme, DZ042A), serum NEFA (Sigma, MAK044) and serum ALT (Sigma, MAK052) were determined according to the manufacturer’s instructions. Mouse liver IL-1β (R&D systems, MLB00C) and CCL2 (R&D systems, DY479-05) were detected by commercially available ELISA kit.
Mouse liver ChIP
Liver ChIP assay was performed as described previously (Seok et al., 2018; Byun et al., 2020; Jung et al., 2020). Briefly, chromatin extracts were prepared from FXR floxed and FXR-LKO mouse livers after treatment of the mice with GW4064 which was followed by preclearing and immunoprecipitation using control IgG or FXR antibody (Novus Biologicals, NBP2-16550; Santa Cruz, sc-25309), RXRα antibody (Proteintech, catalog no. 21218-1-AP), or BRD4 antibody (Bethyl Laboratories, catalog #A301-985A50). Enrichment in chromatin precipitates of gene sequences was measured by qRCR using primers listed (Supplementary Table S5).
Primary mouse hepatocytes and HepG2 cells
Primary hepatocytes were isolated from C57BL/6 mice by collagenase (Worthington Biochemical Corporation, LS004188) perfusion and maintained in William’s E Medium with primary hepatocyte maintenance supplements (Gibco #CM4000) in six-well plates as described previously (Kim et al., 2015; Jung et al., 2020). HepG2 cells were maintained in DMEM supplemented with 10% fetal bovine serum at 37°C and 5% CO2.
Luciferase reporter assay
The enhancer region containing the FXR binding element was amplified by PCR and cloned into the pGL4.23 vector (Promega). HepG2 cells were transiently transfected with FXR (100 ng/well) and RXRα (5 ng/well) in combination with reporters containing the wild type FXRE or mutated FXRE (200 ng/well) (Supplementary Table S5). β-galactosidase plasmid (200 ng/well) was also transfected as internal controls. Cells were treated with GW4064 or DMSO after transient transfection. Six hours later, the cells were harvested. All reporter assays were repeated at least three times in triplicates.
RACE
5’ and 3’ RACE assays were performed using a SMARTer RACE kit (Clontech) according to the manufacturer’s instructions. The resulting PCR products were separated by electrophoresis in agarose gels and cloned into the pRACE vector provided by the kit. The transcription start sites and end sites of FincoR were determined by sequencing. The gene-specific primers used for 5’-and 3’-RACE are provided (Supplementary Table S5).
In vitro transcription and translation (TNT)
Expression plasmids for luciferase and FincoR were mixed with a Coupled Reticulocyte Lysate System (Promega). After incubating at 30°C for 60 min, translated products were separated on 4-20% gradient SDS polyacrylamide gels and transferred to PVDF membranes. Chemiluminescent detection of in vitro translated protein was performed following the manufacturer’s protocol (Promega).
RT-qPCR
Total RNA was extracted using RNeasy Mini Kit (Qiagen, 74104) and 2 µg of RNA was reverse transcribed and relative mRNA expression was normalized to those of 36B4. The qPCR primers are shown in Supplementary Tables S5.
Subcellular fractionation
Using a Cytoplasmic and Nuclear RNA Purification Kit (Norgen, Thorold, ON, Canada), the cytoplasm and nucleus fractions from primary hepatocytes isolated from livers of mice treated with GW4064 or DMSO were separated, and both fractions were subjected to RNA extraction and qRT-PCR.
Immunoblotting analysis
Total liver lysates were prepared as described before (Sun et al., 2022). Antibodies for immunoblotting for β-ACTIN (#4970) were purchased from Cell Signaling Technology. Antibodies for immunoblotting for FXR (sc-25309) were purchased from Santa Cruz.
FincoR polyadenylation study
Total RNA was prepared using the RNeasy mini prep kit (Qiagen). Poly(A)+ and poly(A)-RNA was separated by Dynabeads™ mRNA Purification Kit (ThermoFisher Scientific) according to the manufacturer’s instructions. Briefly, total RNA was incubated with the Dynabeads/binding buffer suspension at room temperature for 5 min and the reaction tubes were placed on a magnet until solution was clear. The supernatant containing poly(A)-RNA was saved. The beads with poly(A)+ RNA were washed three times with washing buffer provided by the kit. RNA was extracted from the supernatant and beads respectively using Trizol. qPCR was performed to analyze levels of FincoR and 36b4 in the Poly(A)+ and poly(A)-RNA fractions.
Genomics Analysis
RNA-Seq and GRO-Seq reads were mapped to the mouse reference genome mm10 with STAR aligner. Transcript quantifications were done with HOMER tool set and enhancer RNAs were identified based on H3K27ac ChIP-Seq in mouse liver. Briefly, intergenic H3K27ac ChIP-Seq peaks were selected as putative enhancer regions in mouse liver. Then +/-3kb regions around putative enhancers with RNA-Seq signal (>1 RPKM) were considered as putative eRNAs in mouse livers. Overlapped eRNAs regions were merged, and redundant ones were removed. In addition, any +/-3kb extended eRNAs regions that overlapped with protein-coding genes were further removed to avoid transcriptional readthrough from genes. We used DESeq2 to identify significantly regulated eRNAs with a cutoff of (FDR < 0.05, Log2FC > 1). Public ChIP-Seq datasets were obtained from ENCODE or GEO (Supplementary Table S3).
Statistical analysis
Statistical analysis was performed using GraphPad Prism 9. Statistical differences were evaluated using two-tailed unpaired Student’s t-test for comparisons between two groups, or ANOVA and appropriate post hoc analyses for comparisons of more than two groups. Statistical methods and corresponding p values for data shown in each panel were indicated in figure legends.
Data availability
RNA-seq and Gro-seq data were deposited in GEO under the following accession numbers GSE 221986.
Acknowledgements
We thank Deepa Prakashini Govindasamy Rajagopal for the help with tissue genotyping. We also thank Kristina Schoonjans at Ecole Polytech, Switzerland, for providing FXR floxed mice. This study was supported by an American Diabetes Association Postdoctoral Fellowship to J.C. (1-19-PDF-117), and by a John and Rebekah Harper Fellowship to R.W. W.L. is a Cancer Prevention and Research Institute of Texas (CPRIT) Scholar. This work is supported by funding from NCI (K22CA204468), NIGMS (R21GM132778, R01GM136922), Welch Foundation (AU-2000-20220331), CPRIT (RR160083) to W.L., and grants from the NIH (R01 DK062777 and R01 DK095842) to J.K.K.
Supplementary Figure Legends

(A, B) Examples of FXR-regulated eRNAs produced near the genes Hes1 (A) and Slc35g1 (B) were shown. (C) Time course expression of FincoR. C57BL/6 male mice were fasted overnight and i.p. injected with vehicle or GW4064 (30 mg/kg) for 1, 3, 6,12 h. Livers were collected at indicated time points (n = 3 mice) and FincoR, Shp and Gcnt1 were measured. Data are presented as mean ± SEM. Statistical significance was determined by the two-way ANOVA Sidak’s multiple comparisons test with *p < 0.05 and ***p < 0.001.

(A) Volcano plot showing the differential expressed genes (DEGs) by GW4064 treatment (DESeq2 FDR<0.05). The numbers refer to the number of genes up-or down-regulated. (B) Bar plot showing the enriched Gene ontology in terms of biological processes for up-regulated genes.

(A) FXR protein levels in the livers isolated from FXR-Flox and FXR-LKO mice were shown. (B) Validation of hepatic FXR-dependent induction of FincoR by qPCR (n = 3 mice). Shp gene was used as a control. Data are presented as mean ± SEM. Statistical significance was determined by the two-way ANOVA Tukey’s multiple comparisons test with *p < 0.05, **p < 0.01 and ***p < 0.001. (C) Metagene plots showing H3K27ac, H3K4me1, FXR, and RXRα ChIP-Seq profiles centered on up-regulated eRNAs.

(A) The scheme for the FincoR loss of function experiments. (B) The genomic DNAs from liver, spleen, intestine, brain, heart, muscle, kidney, lung and adipose tissue were isolated and PCR was performed using the primers (Supplementary Table S5E) to verify tissue-specific knock-out. (C-G) RNA-seq profiles of expression of hepatic Prune2 (C), PPP1r3g (D), Igfbp2 (E), Eda2r (F) and Fndc1 (G) were shown (n = 2 mice).

The effects of FincoR downregulation on NASH pathologies.
Male Cas9 mice were fed with NASH diet for 12 weeks. Then these mice were randomly assigned to 2 groups and infected with adenovirus expressing sgRNA for FincoR or control. The tissues were collected 2 weeks later. Liver histology analysis was performed. Scale bar (50 μm).

Hepatic genome browser tracks of FXR, RXRα, LXR, PPARα, and HNF4α binding peaks at FincoR locus.

PPARα occupnacy in the FincoR enhancer region.
C57BL/6 male mice were fasted overnight with or without refed for 3 hrs and then sacrificed. ChIP assays were performed in liver samples to detect PPARα occupancy to the FXR binding peak region close to the transcription start site of FincoR.
Supplemental Tables

Sequencing data generated in this study

Public ChIP-Seq dataset



Primer sequences used in this study
References
- 1.Synthesis and pharmacological validation of a novel series of non-steroidal FXR agonistsBioorg Med Chem Lett 20:4911–4917Google Scholar
- 2.Obeticholic Acid: A New Era in the Treatment of Nonalcoholic Fatty Liver DiseasePharmaceuticals (Basel 11Google Scholar
- 3.Recent advances in the development of farnesoid X receptor agonistsAnn Transl Med 3:5Google Scholar
- 4.Long non-coding RNA Gm15441 attenuates hepatic inflammasome activation in response to PPARA agonism and fastingNat Commun 11:5847Google Scholar
- 5.Postprandial FGF19-induced phosphorylation by Src is critical for FXR function in bile acid homeostasisNat Commun 9:2590Google Scholar
- 6.Fasting-induced FGF21 signaling activates hepatic autophagy and lipid degradation via JMJD3 histone demethylaseNat Commun 11:807Google Scholar
- 7.Transcriptional integration of metabolism by the nuclear sterol-activated receptors LXR and FXRNat Rev Mol Cell Biol 13:213–224Google Scholar
- 8.The noncoding RNA revolution-trashing old rules to forge new onesCell 157:77–94Google Scholar
- 9.BET Inhibition Attenuates Helicobacter pylori-Induced Inflammatory Response by Suppressing Inflammatory Gene Transcription and Enhancer ActivationJ Immunol 196:4132–4142Google Scholar
- 10.The Farnesoid X receptor: a molecular link between bile acid and lipid and glucose metabolismArterioscler Thromb Vasc Biol 25:2020–2030Google Scholar
- 11.An integrated encyclopedia of DNA elements in the human genomeNature 489:57–74Google Scholar
- 12.A chemical, genetic, and structural analysis of the nuclear bile acid receptor FXRMol Cell 11:1079–1092Google Scholar
- 13.Nuclear Receptors, RXR, and the Big BangCell 157:255–266Google Scholar
- 14.Circadian enhancers coordinate multiple phases of rhythmic gene transcription in vivoCell 159:1140–1152Google Scholar
- 15.Intestinal FXR agonism promotes adipose tissue browning and reduces obesity and insulin resistanceNat Med 21:159–165Google Scholar
- 16.Mechanisms of NAFLD development and therapeutic strategiesNat Med 24:908–922Google Scholar
- 17.A regulatory cascade of the nuclear receptors FXRSHP 1Google Scholar
- 18.Tropifexor-Mediated Abrogation of Steatohepatitis and Fibrosis Is Associated With the Antioxidative Gene Expression Profile in RodentsHepatol Commun 3:1085–1097Google Scholar
- 19.NET-CAGE characterizes the dynamics and topology of human transcribed cis-regulatory elementsNat Genet 51:1369–1379Google Scholar
- 20.An atlas of human long non-coding RNAs with accurate 5’ endsNature 543:199–204Google Scholar
- 21.Enhancer RNAs participate in androgen receptor-driven looping that selectively enhances gene activationProc Natl Acad Sci U S A 111:7319–7324Google Scholar
- 22.BRD4 inhibition and FXR activation, individually beneficial in cholestasis, are antagonistic in combinationJCI Insight 6 Google Scholar
- 23.Farnesoid X receptor-induced lysine-specific histone demethylase reduces hepatic bile acid levels and protects the liver against bile acid toxicityHepatology 62:220–231Google Scholar
- 24.Bile Acids as Hormones: The FXR-FGF15/19 PathwayDig Dis 33:327–331Google Scholar
- 25.FXR agonists for NASH: How are they different and what difference do they make?J Hepatol 75:12–15Google Scholar
- 26.Enhancer RNAs: the new molecules of transcriptionCurr Opin Genet Dev 25:38–42Google Scholar
- 27.Enhancer RNAs and regulated transcriptional programsTrends Biochem Sci 39:170–182Google Scholar
- 28.FXR, a multipurpose nuclear receptorTrends Biochem Sci 31:572–580Google Scholar
- 29.A pathway involving farnesoid X receptor and small heterodimer partner positively regulates hepatic sirtuin 1 levels via microRNA-34a inhibitionJ Biol Chem 285:12604–12611Google Scholar
- 30.Genomic analysis of hepatic farnesoid X receptor binding sites reveals altered binding in obesity and direct gene repression by farnesoid X receptor in miceHepatology 56:108–117Google Scholar
- 31.Nutrient-sensing nuclear receptors coordinate autophagyNature 516:112–115Google Scholar
- 32.Functional roles of enhancer RNAs for oestrogen-dependent transcriptional activationNature 498:516–520Google Scholar
- 33.Enhancers as non-coding RNA transcription units: recent insights and future perspectivesNat Rev Genet 17:207–223Google Scholar
- 34.A noncoding RNA modulator potentiates phenylalanine metabolism in miceScience 373:662–673Google Scholar
- 35.Long non-coding RNAs: definitions, functions, challenges and recommendationsNat Rev Mol Cell Biol 24:430–447Google Scholar
- 36.Inhibition of the Hypoxia-Inducible Factor 1alpha-Induced Cardiospecific HERNA1 Enhance-Templated RNA Protects From Heart DiseaseCirculation 139:2778–2792Google Scholar
- 37.Enhancer release and retargeting activates disease-susceptibility genesNature 595:735–740Google Scholar
- 38.RNAs interact with BRD4 to promote enhanced chromatin engagement and transcription activationNat Struct Mol Biol 25:687–697Google Scholar
- 39.Feedback modulation of cholesterol metabolism by the lipid-responsive non-coding RNA LeXisNature 534:124–128Google Scholar
- 40.Tropifexor for nonalcoholic steatohepatitis: an adaptive, randomized, placebo-controlled phase 2a/b trialNat Med 29:392–400Google Scholar
- 41.Enhancer RNAs are an important regulatory layer of the epigenomeNat Struct Mol Biol 27:521–528Google Scholar
- 42.Transcriptional regulation of autophagy by an FXR-CREB axisNature 516:108–111Google Scholar
- 43.Fasting-induced JMJD3 histone demethylase epigenetically activates mitochondrial fatty acid beta-oxidationJ Clin Invest 128:3144–3159Google Scholar
- 44.Defective FXR-SHP Regulation in Obesity Aberrantly Increases miR-802 Expression, Promoting Insulin Resistance and Fatty LiverDiabetes 70:733–744Google Scholar
- 45.Gene regulation by long non-coding RNAs and its biological functionsNat Rev Mol Cell Biol 22:96–118Google Scholar
- 46.Obesity-induced miR-802 directly targets AMPK and promotes nonalcoholic steatohepatitis in miceMol Metab 66:101603Google Scholar
- 47.Long noncoding RNA LEENE promotes angiogenesis and ischemic recovery in diabetes modelsJ Clin Invest 133Google Scholar
- 48.Genome-wide tissue-specific farnesoid X receptor binding in mouse liver and intestineHepatology 51:1410–1419Google Scholar
- 49.Discovery of Tropifexor (LJN452), a Highly Potent Non-bile Acid FXR Agonist for the Treatment of Cholestatic Liver Diseases and Nonalcoholic Steatohepatitis (NASH)J Med Chem 60:9960–9973Google Scholar
- 50.Intestinal Crosstalk between Bile Acids and Microbiota and Its Impact on Host MetabolismCell Metab 24:41–50Google Scholar
- 51.Farnesoid X receptor antagonizes nuclear factor kappaB in hepatic inflammatory responseHepatology 48:1632–1643Google Scholar
- 52.BCL-2 family isoforms in apoptosis and cancerCell Death Dis 10:177Google Scholar
- 53.Long noncoding RNA licensing of obesity-linked hepatic lipogenesis and NAFLD pathogenesisNat Commun 9:2986Google Scholar
- 54.Structural insights into the heterodimeric complex of the nuclear receptors FXR and RXRJ Biol Chem 293:12535–12541Google Scholar
Article and author information
Author information
Version history
- Sent for peer review:
- Preprint posted:
- Reviewed Preprint version 1:
- Reviewed Preprint version 2:
- Version of Record published:
Cite all versions
You can cite all versions using the DOI https://doi.org/10.7554/eLife.91438. This DOI represents all versions, and will always resolve to the latest one.
Copyright
© 2024, Chen et al.
This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.
Metrics
- views
- 1,152
- downloads
- 89
- citations
- 11
Views, downloads and citations are aggregated across all versions of this paper published by eLife.