Crickets evade bats via olfaction beyond acoustic cues
- Jilin Provincial Key Laboratory of Animal Resource and Ecological Security, Northeast Normal University, China
- State Key Laboratory of Green Pesticide, College of Plant Protection, South China Agricultural University, China
- Jilin Provincial International Cooperation Key Laboratory for Biological Control of Agricultural Pests, Jilin Agricultural University, China
- Key Laboratory of Vegetation Ecology of Education Ministry, Institute of Grassland Science, Northeast Normal University, China
Figures
Figure 1
Dietary composition of S. kuhlii.
(A) Order-level composition based on 16S gene sequences, analyzed using the weighted percentage of occurrence (wPOO). Individual bats are labeled S1–S30. (B) Proportions of Orthoptera families in the diet, detected using the cytochrome c oxidase subunit I (COI) and 16S markers and presented as both relative read abundance (RRA) and wPOO. Color intensity corresponds to proportion magnitude. (C) Maximum-likelihood phylogenetic tree of Gryllidae reconstructed from 16S sequences. Operational taxonomic units (OTUs) identified in this study are highlighted in orange; reference sequences from NCBI are shown in black. Associated bat individuals are listed after each corresponding scientific name. Bootstrap support values are indicated at the nodes.
-
Figure 1—source data 1
Identification of insect operational taxonomic units (OTUs) in bat feces using 16S rRNA gene markers in Figure 1A.
- https://cdn.elifesciences.org/articles/110936/elife-110936-fig1-data1-v1.xlsx
-
Figure 1—source data 2
Identification of insect operational taxonomic units (OTUs) in bat feces using cytochrome c oxidase subunit I (COI) gene markers in Figure 1B.
- https://cdn.elifesciences.org/articles/110936/elife-110936-fig1-data2-v1.xlsx
-
Figure 1—source data 3
Sequence file used to construct the 16S phylogenetic tree shown in Figure 1C.
- https://cdn.elifesciences.org/articles/110936/elife-110936-fig1-data3-v1.zip
Figure 2 with 1 supplement
Behavioral and electrophysiological responses of L. equestris to S. kuhlii body odor.
(A) Schematic of the Y-tube olfactometer used in two-choice assays. The cricket’s release position (junction) and airflow direction are indicated. (B) Choice percentages of crickets for the control vs. test arm across three treatments: bat body odor, air without bat odor (control for odor bias), and limonene. (C) Representative gas chromatography–electroantennographic detection (GC–EAD) recordings. Upper panel: flame ionization detection (FID) chromatograms of bat body odor extract (brown) and an odor-free control (blue). Lower panel: corresponding EAD response (black) of a L. equestris antenna. Peaks 1–6 correspond to compounds identified by GC–MS (see panel D); asterisks mark compounds that elicited consistent antennal depolarizations (>0.1 mV). (D) Gas chromatography–mass spectrometry (GC–MS) total ion chromatograms of the same bat body odor sample (upper) and an odor-free control (lower). Identified compounds are labeled (peaks 1–6). Axes indicate retention time (x) and relative ion intensity (y).
-
Figure 2—source data 1
Behavioral preference of crickets in Y-tube maze experiment with control in Figure 2B.
- https://cdn.elifesciences.org/articles/110936/elife-110936-fig2-data1-v1.xlsx
-
Figure 2—source data 2
Behavioral preference of crickets in Y-tube maze experiment with bat odor in Figure 2B.
- https://cdn.elifesciences.org/articles/110936/elife-110936-fig2-data2-v1.xlsx
-
Figure 2—source data 3
Behavioral preference of crickets in Y-tube maze experiment with limonene in Figure 2B.
- https://cdn.elifesciences.org/articles/110936/elife-110936-fig2-data3-v1.xlsx
-
Figure 2—source data 4
Retention times and mass-spectral identification information for volatile compounds detected in the body odor of S. kuhlii by gas chromatography–mass spectrometry (GC–MS) in Figure 2D.
- https://cdn.elifesciences.org/articles/110936/elife-110936-fig2-data4-v1.xlsx
-
Figure 2—source data 5
Experimental electron ionization (EI) mass spectra of compounds 1–6 detected in the body odor of S. kuhlii and the corresponding standard EI mass spectra used for their gas chromatography–mass spectrometry (GC–MS) identification in Figure 2D.
- https://cdn.elifesciences.org/articles/110936/elife-110936-fig2-data5-v1.zip
Figure 2—figure supplement 1
Gas chromatography–electroantennographic detection (GC–EAD) responses of L. equestris antennae to S. kuhlii body odor.
Upper panel shows the flame ionization detection (FID) chromatogram of S. kuhlii body odor extract, with peaks 1–6 corresponding to compounds identified by gas chromatography–mass spectrometry (GC–MS). The five EAD traces show antennal responses from five individual L. equestris crickets exposed to the same bat body odor extract (n=5 crickets). Asterisks indicate EAD active peaks that elicited antennal depolarizations. Lower panel shows the FID chromatogram and EAD traces from odor-free control samples, which did not elicit antennal responses in three tested crickets (n=3 crickets).
Figure 3
Volatile organic compound (VOC) profiles of potential odor sources in S. kuhlii.
(A) Hierarchical clustering of VOC profiles from feces, hair, and snout secretions, based on compositional similarity (values normalized 0–1). All three odor sources were sampled from the same nine bats (27 samples total). (B) Individual-level relative abundance of terpenoid compounds in VOC collections from hair, snout secretions, and feces. Each stacked bar represents one VOC collection from an individual bat, and the segment corresponding to limonene indicates its presence and relative contribution in the sample. (C) Principal component analysis (PCA) of VOC profiles from the same samples, based on compound presence/absence data, with the addition of a pooled body odor composite (combined from eight bats) for comparison. Ellipses represent 90% confidence intervals, and marginal density plots are shown for each source.
-
Figure 3—source data 1
Volatile compounds identified from bat feces, hair, and secretions using headspace solid-phase microextraction coupled with gas chromatography–mass spectrometry (HS–SPME–GC–MS) analysis in Figure 3A–C.
- https://cdn.elifesciences.org/articles/110936/elife-110936-fig3-data1-v1.xlsx
Figure 4 with 2 supplements
Electrophysiological and ecological responses of L. equestris to candidate bat body odor compounds.
(A) Electroantennographic (EAG) responses to four candidate compounds (n=8 individuals). Significance vs. the hexane control is indicated (***p<0.001; repeated-measures ANOVA with Bonferroni-corrected paired t-tests, see Results for exact F- and p-values and post hoc comparisons). (B) Concentration-dependent EAG responses to limonene (n=6 individuals). **p<0.01, ***p<0.001 vs. control (same statistical test, see Results). (C) Mean call rate over time (calls per minute) in field plots treated with limonene (n=8 datasets) or a hexane control (n=7 datasets). Shaded areas represent 95% confidence intervals (1200 recordings total).
-
Figure 4—source data 1
Electroantennographic (EAG) responses in crickets to four candidate compounds in Figure 4A.
- https://cdn.elifesciences.org/articles/110936/elife-110936-fig4-data1-v1.xlsx
-
Figure 4—source data 2
Concentration-dependent effects of limonene on electroantennogram (EAG) responses in crickets in Figure 4B.
- https://cdn.elifesciences.org/articles/110936/elife-110936-fig4-data2-v1.xlsx
-
Figure 4—source data 3
The variation in cricket chirping frequency within each quadrat before and after treatment analysis in Figure 4C.
- https://cdn.elifesciences.org/articles/110936/elife-110936-fig4-data3-v1.xlsx
Figure 4—figure supplement 1
Study site and field setup.
(A) Satellite image of the roosting habitat of the insectivorous bat S. kuhlii, indicating the locations of bat roosting trees and experimental quadrats. (B) A representative quadrat established within the natural habitat of the cricket L. equestris for field experiment. (C) An AudioMoth acoustic recorder deployed inside a quadrat.
Figure 4—figure supplement 2
Waveform and spectrogram characterizing the calling song of L. equestris.
The upper panel depicts the oscillogram of a male calling song, while the lower panel presents the corresponding spectrogram, plotting frequency (kHz) against time (s).
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Biological sample (Scotophilus kuhlii) | Bat | This paper | See Materials and methods, ‘Diet composition and prey availability of S. kuhlii’ | |
| Biological sample (Loxoblemmus equestris) | Cricket | This paper | See Materials and methods, ‘Behavioral and electrophysiological assays of cricket responses to S. kuhlii body odor’ | |
| Sequence-based reagent | LCO-1490 | Lin et al., 2023 | PCR primer | GGTCAACAAATCATAAAGATATTGG |
| Sequence-based reagent | ZBJ-ArtR2c | Lin et al., 2023 | PCR primer | WACTAATCAATTWCCAAATCCTCC |
| Sequence-based reagent | Coleop_16Sc | Lin et al., 2023 | PCR primer | TGCAAAGGTAGCATAATMATTAG |
| Sequence-based reagent | Coleop_16Sd | Lin et al., 2023 | PCR primer | TCCATAGGGTCTTCTCGTC |
| Commercial assay or kit | DNA extraction kit | Omega Bio-tek | ||
| Chemical compound, drug | Limonene | Macklin | CAS:5989-54-8 | Purity: ≥95% |
| Chemical compound, drug | Undecane | Macklin | CAS:1120-21-4 | Purity: ≥98% |
| Chemical compound, drug | Pentadecane | Macklin | CAS:629-62-9 | Purity: ≥99% |
| Chemical compound, drug | Hexadecane | Macklin | CAS:544-76-3 | Purity: ≥98% |
| Chemical compound, drug | Hexane | MREDA | CAS:110-54-3 | Purity: ≥98% |
| Chemical compound, drug | Dichloromethane | MREDA | CAS:75-09-2 | Purity: ≥99% |
| Other | MiSeq sequencing platform | Illumina | MiSeq PE300; RRID:SCR_016379 | Used for sequencing COI and 16S amplicons from bat fecal samples |
| Other | Gas chromatography system (GC) | Agilent Technologies, USA | Agilent 7820A; HP-5 column; RRID:SCR_019445 | Used for GC–EAD separation of volatile compounds from bat body odor |
| Other | Electroantennographic detection system (EAD) | Syntech, Germany | IDAC-4; MP-15; PRG-3 | Used for both GC–EAD and EAG experiments |
| Other | Gas chromatography–mass spectrometry system (GC–MS) | Agilent Technologies, USA | Agilent 6850 GC-5975 MS; HP-5 column | Used to identify volatile compounds in bat body odor extracts |
| Other | Headspace solid-phase microextraction–gas chromatography–mass spectrometry system (HS–SPME–GC–MS) | Agilent Technologies, USA | Agilent 7890B GC-7000D MS; DVB/CWR/PDMS fiber; DB-5MS column | Used to analyze volatile organic compounds in bat hair, snout secretions, and feces |
| Other | Dynamic headspace sampling system | This paper | Vacuum pump (QC-1S); Adsorbent columns (Porapak-Q) | Used to collect volatile organic compounds from the body odor of adult S. kuhlii for subsequent GC–EAD and GC–MS analyses |
| Other | Y-tube olfactometer | Shelai Instrument Platform | Used for two-choice behavioral assays of cricket responses to bat body odor and limonene | |
| Other | AudioMoth acoustic recorder | Open Acoustic Devices | Version: 1.2.0 | Used to record cricket calling activity during field experiments |
| Software, algorithm | Usearch | Edgar, 2016 | Version: 11.0; RRID:SCR_027438 | |
| Software, algorithm | MEGA | Kumar et al., 2016 | Version: 7.0; RRID:SCR_000667 | |
| Software, algorithm | IQ-TREE | Nguyen et al., 2015 | Version: 1.6.12; RRID:SCR_017254 | |
| Software, algorithm | GcEad | Syntech | Version: 1.2.5 | |
| Software, algorithm | EagPro | Syntech | Version: 2.0 | |
| Software, algorithm | MassHunter | Agilent Technologies | Version: B.08.00 | |
| Software, algorithm | Avisoft SASLab Pro | Avisoft Bioacoustics | Version: 5.2.07; RRID:SCR_014438 | |
| Software, algorithm | R | R Foundation for Statistical Computing | Version: 4.3.2; RRID:SCR_001905 | |
| Software, algorithm | Python | Python Software Foundation | Version: 3.9; RRID:SCR_008394 |
Appendix 1—table 1
Composition of Gryllidae (crickets) in the insect prey community at a foraging site of S. kuhlii.
Species identified from grassland samples collected between July and September 2022 are listed with their corresponding order, family, and number of individuals.
| Insect species | Order | Family | Number |
|---|---|---|---|
| Loxoblemmus equestris | Orthoptera | Gryllidae | 70 |
| Polionemobius taprobanensis | Orthoptera | Gryllidae | 1 |
| Svercacheta siamensis | Orthoptera | Gryllidae | 5 |
| Amusurgus genji | Orthoptera | Gryllidae | 1 |
| Modicogryllus consobrinus | Orthoptera | Gryllidae | 1 |
| Teleogryllus emma | Orthoptera | Gryllidae | 2 |
Appendix 1—table 2
Annotation information for terpenoid compounds detected in volatile organic compound (VOC) samples from S. kuhlii.
Key parameters used for VOC annotation are summarized, including the NIST retention index (RI), quantitative ion, qualitative ion(s), and molecular weight (MW, Da). Compound identification was based on matching retention time and the presence of one quantitative ion and two to three qualitative ions with standard references, followed by qualification and quantification against an in-house database.
| Compound | NIST RI | Quant. ion | Qual. ion | MW (Da) |
|---|---|---|---|---|
| Limonene | 1023 | 93 | 136 | 136.125 |
| ar-Curcumene | 1524 | 119 | 132 | 202.172 |
| α-Phellandrene | 969 | 93 | 91 | 136.125 |
| δ-Elemene | 1377 | 121 | 93 | 204.188 |
| trans-Farnesol | 1710 | 41 | 69 | 222.198 |
| Terpinolene | 1052 | 93 | 121 | 136.125 |
| Nerolidol | 1564 | 93 | 69 | 222.198 |
| Phytol | 2045 | 71 | 43 | 296.308 |
| δ-Cadinene | 1469 | 161 | 134 | 204.188 |
| Pulegone | 1212 | 152 | 81 | 152.12 |
| Cedrol | 1543 | 95 | 150 | 222.198 |
| β-Elemene | 1398 | 81 | 68 | 204.188 |
| Safranal | 1186 | 107 | 91 | 150.104 |
| 7-Octylidene-bicycloheptane | 1522 | 135 | 93 | 206.203 |
Appendix 1—table 3
Generalized linear mixed models examining the effects of limonene (experimental) vs. hexane (control) treatments on call activity in the cricket L. equestris.
The model was fitted using a zero-inflated negative binomial distribution via the glmmTMB package in R. Fixed effects included the four-level treatment–phase combination (Control–Pre-exposure, Control–Post-exposure, Experimental–Pre-exposure, Experimental–Post-exposure); random effects comprised a random intercept for plot-night (plot:date). Results are presented twice with different reference categories: first with ‘Control–Pre-exposure’, then with ‘Experimental–Pre-exposure’. Both presentations derive from the same fitted model, yielding two intercept estimates but identical coefficients.
| Term | Estimate | SE | 95% CI | Z | p |
|---|---|---|---|---|---|
| Control–Pre-exposure (Intercept) | 5.30 | 0.18 | [4.94, 5.66] | 29.02 | <0.001 |
| Control–Post-exposure | 0.40 | 0.06 | [0.28, 0.51] | 6.68 | <0.001 |
| Experimental–Post-exposure | –0.59 | 0.25 | [-1.08,–0.10] | –2.35 | 0.019 |
| Experimental–Pre-exposure | 0.10 | 0.25 | [–0.39, 0.59] | 0.38 | 0.720 |
| Experimental–Pre-exposure (Intercept) | 5.40 | 0.17 | [5.06, 5.73] | 31.59 | <0.001 |
| Experimental–Post-exposure | –0.68 | 0.06 | [-0.80,–0.57] | –11.90 | <0.001 |
| Control–Post-exposure | 0.30 | 0.25 | [–0.19, 0.79] | 1.21 | 0.228 |
| Control–Pre-exposure | –0.10 | 0.25 | [–0.59, 0.39] | –0.38 | 0.702 |
Appendix 1—table 4
Synthetic chemical standards and solvents used in the study.
| Compound | Source | CAS Registry Number | Purity (%) |
|---|---|---|---|
| Undecane | Macklin | 1120-21-4 | ≥98% |
| Pentadecane | Macklin | 629-62-9 | ≥99% |
| Hexadecane | Macklin | 544-76-3 | ≥98% |
| Limonene | Macklin | 5989-54-8 | ≥95% |
| Dichloromethane | MREDA | 75-09-2 | ≥99% |
| Hexane | MREDA | 110-54-3 | ≥98% |
Additional files
Download links
A two-part list of links to download the article, or parts of the article, in various formats.
Downloads (link to download the article as PDF)
Open citations (links to open the citations from this article in various online reference manager services)
Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)
Crickets evade bats via olfaction beyond acoustic cues
eLife 15:RP110936.
https://doi.org/10.7554/eLife.110936.3
