Main text

Krall BE, Wang B, Munoz DM, Ilic N, Raghavan S, Niederst MJ, Yu K, Ruddy DA, Aguirre AJ, Kim JW, Redig AJ, Gainor JF, Williams JA, Asara JM, Doench JG, Janne PA, Shaw AT, McDonald III RE, Engelman JA, Stegmeier F, Schlabach MR, Hahn WC. 2017. KEAP1 loss modulates sensitivity to kinase targeted therapy in lung cancer. eLife 6:e18970. doi: 10.7554/eLife.18970.

Published 1, February 2017

In the published article, there is an error in the inline table for sgRNA sequences—the “Target sequence” for sgKEAP1-4is shown as “GAGGACACACTTCTCGCCCA”, which is a duplicate of the target sequence for sgKEAP1-3. The correct “Target sequence” for sgKEAP1-4is ACTGGGCGGCCGGTGCATCC.

The Corrected Table is shown here:

sgRNA Sequences

NameTarget Sequence
sgGFPGGCGAGGGCGATGCCACCTA
sgKEAP1-1CTTGTGGGCCATGAACTGGG
sgKEAP1-2TGTGTCCTCCACGTCATGAA
sgKEAP1-3GAGGACACACTTCTCGCCCA
sgKEAP1-4ACTGGGCGGCCGGTGCATCC
sgLACZ-1AACGGCGGATTGACCGTAAT
sgLACZ-2CTAACGCCTGGGTCGAACGC

The originally published Table is also shown for reference:

sgRNA Sequences

NameTarget Sequence
sgGFPGGCGAGGGCGATGCCACCTA
sgKEAP1-1CTTGTGGGCCATGAACTGGG
sgKEAP1-2GAGGACACACTTCTCGCCCA
sgKEAP1-3GAGGACACACTTCTCGCCCA
sgKEAP1-4GAGGACACACTTCTCGCCCA
sgLACZ-1AACGGCGGATTGACCGTAAT
sgLACZ-2CTAACGCCTGGGTCGAACGC

The article has been corrected accordingly.

Article and author information

Author details

  1. Elsa Beyer Krall

  2. Belinda Wang

  3. Diana M Munoz

  4. Nina Ilic

  5. Srivatsan Raghavan

  6. Matthew J Niederst

  7. Kristine Yu

  8. David A Ruddy

  9. Andrew J Aguirre

  10. Jong Wook Kim

  11. Amanda J Redig

  12. Justin F Gainor

  13. Juliet A Williams

  14. John M Asara

  15. John G Doench

  16. Pasi A Janne

  17. Alice T Shaw

  18. Robert E McDonald III III

  19. Jeffrey A Engelman

  20. Frank Stegmeier

  21. Michael R Schlabach

Version history

  1. Received:
  2. Accepted:
  3. Version of Record published:

Copyright

© 2017, Krall et al.

This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.

Metrics

  • 647
    views
  • 11
    citations

Views, downloads and citations are aggregated across all versions of this paper published by eLife.

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Open citations (links to open the citations from this article in various online reference manager services)

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

  1. Elsa Beyer Krall
  2. Belinda Wang
  3. Diana M Munoz
  4. Nina Ilic
  5. Srivatsan Raghavan
  6. Matthew J Niederst
  7. Kristine Yu
  8. David A Ruddy
  9. Andrew J Aguirre
  10. Jong Wook Kim
  11. Amanda J Redig
  12. Justin F Gainor
  13. Juliet A Williams
  14. John M Asara
  15. John G Doench
  16. Pasi A Janne
  17. Alice T Shaw
  18. Robert E McDonald III III
  19. Jeffrey A Engelman
  20. Frank Stegmeier
  21. Michael R Schlabach
  22. William C Hahn
(2017)
Correction: KEAP1 loss modulates sensitivity to kinase targeted therapy in lung cancer
eLife 6:e33173.
https://doi.org/10.7554/eLife.33173

Share this article

https://doi.org/10.7554/eLife.33173