1. Cancer Biology
Download icon

Correction: KEAP1 loss modulates sensitivity to kinase targeted therapy in lung cancer

Correction
  • Cited 5
  • Views 337
  • Annotations
Cite this article as: eLife 2017;6:e33173 doi: 10.7554/eLife.33173

Main text

Krall BE, Wang B, Munoz DM, Ilic N, Raghavan S, Niederst MJ, Yu K, Ruddy DA, Aguirre AJ, Kim JW, Redig AJ, Gainor JF, Williams JA, Asara JM, Doench JG, Janne PA, Shaw AT, McDonald III RE, Engelman JA, Stegmeier F, Schlabach MR, Hahn WC. 2017. KEAP1 loss modulates sensitivity to kinase targeted therapy in lung cancer. eLife 6:e18970. doi: 10.7554/eLife.18970.

Published 1, February 2017

In the published article, there is an error in the inline table for sgRNA sequences—the “Target sequence” for sgKEAP1-4is shown as “GAGGACACACTTCTCGCCCA”, which is a duplicate of the target sequence for sgKEAP1-3. The correct “Target sequence” for sgKEAP1-4is ACTGGGCGGCCGGTGCATCC.

The Corrected Table is shown here:

sgRNA Sequences

NameTarget Sequence
sgGFPGGCGAGGGCGATGCCACCTA
sgKEAP1-1CTTGTGGGCCATGAACTGGG
sgKEAP1-2TGTGTCCTCCACGTCATGAA
sgKEAP1-3GAGGACACACTTCTCGCCCA
sgKEAP1-4ACTGGGCGGCCGGTGCATCC
sgLACZ-1AACGGCGGATTGACCGTAAT
sgLACZ-2CTAACGCCTGGGTCGAACGC

The originally published Table is also shown for reference:

sgRNA Sequences

NameTarget Sequence
sgGFPGGCGAGGGCGATGCCACCTA
sgKEAP1-1CTTGTGGGCCATGAACTGGG
sgKEAP1-2GAGGACACACTTCTCGCCCA
sgKEAP1-3GAGGACACACTTCTCGCCCA
sgKEAP1-4GAGGACACACTTCTCGCCCA
sgLACZ-1AACGGCGGATTGACCGTAAT
sgLACZ-2CTAACGCCTGGGTCGAACGC

The article has been corrected accordingly.

Article and author information

Author details

  1. Elsa Beyer Krall

  2. Belinda Wang

  3. Diana M Munoz

  4. Nina Ilic

  5. Srivatsan Raghavan

  6. Matthew J Niederst

  7. Kristine Yu

  8. David A Ruddy

  9. Andrew J Aguirre

  10. Jong Wook Kim

  11. Amanda J Redig

  12. Justin F Gainor

  13. Juliet A Williams

  14. John M Asara

  15. John G Doench

  16. Pasi A Janne

  17. Alice T Shaw

  18. Robert E McDonald III III

  19. Jeffrey A Engelman

  20. Frank Stegmeier

  21. Michael R Schlabach

Publication history

  1. Received: October 27, 2017
  2. Accepted: October 27, 2017
  3. Version of Record published: October 31, 2017 (version 1)

Copyright

© 2017, Krall et al.

This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.

Metrics

  • 337
    Page views
  • 5
    Citations

Article citation count generated by polling the highest count across the following sources: PubMed Central, Crossref, Scopus.

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Download citations (links to download the citations from this article in formats compatible with various reference manager tools)

Open citations (links to open the citations from this article in various online reference manager services)