Temperature sensitivity of the interspecific interaction strength of coastal marine fish communities
- Hakubi Center, Kyoto University, Hong Kong
- Center for Ecological Research, Kyoto University, Japan
- Department of Ocean Science, The Hong Kong University of Science and Technology, Clear Water Bay, China
- Natural History Museum and Institute, Japan
- Maizuru Fisheries Research Station, Kyoto University, Japan
- Fisheries Technology Institute, Japan Fisheries Research and Education Agency, Japan
- Graduate School of Life Sciences, Tohoku University, Japan
Figures
Figure 1 with 2 supplements
Study sites and overall dynamics of environmental DNA (eDNA) concentrations and the number of fish species detected.
(a) Study sites in the Boso Peninsula. The study sites are influenced by the Kuroshio Current (red arrow; left panel) and distributed along the coastal line in the Boso Peninsula (right panel). (b) …
Figure 1—figure supplement 1
Dynamics of environmental DNA (eDNA) copy numbers of Japanese black seabream (Acanthopagrus schlegelii) that was used as an internal standard.
Gray horizontal line indicates the minimum eDNA copy number of Japanese black seabream detected. Approximately 83.3% of samples contain detectable concentrations of the standard DNA, which was used …
Figure 1—figure supplement 2
Dynamics of water temperature and the relationships between water temperature and total environmental DNA (eDNA) concentration and fish species richness.
(a) Dynamics of sea surface water temperature at the sampling sites. (b) The relationship between water temperature and total eDNA copy numbers, and (c) the relationship between water temperature …
Figure 2 with 1 supplement
Interaction networks of the fish community in the Boso Peninsula coastal region.
The ‘average’ interaction network reconstructed by quantifying information transfer between environmental DNA (eDNA) time series. Transfer entropy (TE) was quantified by leveraging all eDNA time …
Figure 2—figure supplement 1
The relationships between network properties and environmental variables.
Diagonal panels show density distributions of the data, and lower triangle area shows scattered plots. Each point represents one water sample at each study site, meaning that ‘Mean interaction …
Figure 3 with 3 supplements
Dependence of interaction strengths on biotic and abiotic variables (50 dominant fish species and 11 study sites were leveraged).
The panels show the overall effects of biotic and abiotic variables on interaction strengths of the 50 dominant fish species: Effects of (a, d) water temperature, (b, e) species richness, and (c, f) …
Figure 3—figure supplement 1
Dependence of interaction strengths on additional abiotic variables.
The panels show the overall effects of additional abiotic variables on interaction strengths of the 50 dominant fish species: Effects of (a, d) salinity, (b, e) tide level (cm), and (c, f) wave (m). …
Figure 3—figure supplement 2
The relationship between interaction strengths and water temperature, species richness, and total DNA concentrations.
The panel shows the overall relationship between interaction strengths of the 50 dominant fish species and (a, d) water temperature, (b, e) species richness, and (c, f) total DNA concentration. The y…
Figure 3—figure supplement 3
The relationship between interaction strengths and salinity, tide level, and wave.
The panel shows the overall relationship between interaction strengths of the 50 dominant fish species and (a, d) salinity, (b, e) tide level (cm), and (c, f) wave (m). The y-axis indicates the …
Figure 4 with 2 supplements
Temperature dependence of fish species interactions at the species level.
(a and b) show temperature effects on fish species interactions quantified by the MDR S-map method. Note that the MDR S-map enables quantifications of interaction strengths at each time point, and …
Figure 4—figure supplement 1
Dependence of fish species interactions on species richness at the fish species level.
(a and b) show effects of species richness on fish species interactions quantified by the MDR S-map method. (a) Points indicate the species interactions that a focal species (indicated by the strip …
Figure 4—figure supplement 2
Dependence of fish species interactions on the total DNA concentration (an index of total fish abundance) at the species level.
(a and b) show effects of the total DNA concentrations on fish species interactions quantified by the MDR S-map method. (a) Points indicate the species interactions that a focal species (indicated …
Tables
Table 1
Primer sequences used in the present study.
| Primer information | Primer sequence (5′– 3′)*,†,‡, §,¶ | Length |
|---|---|---|
| 1st PCR primers | ||
| MiFish-U-forward | ACACTCTTTCCCTACACGACGCTCTTCCGATCT NNNNNN GTCGGTAAAACTCGTGCCAGC | 60 |
| MiFish-U-reverse | GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT NNNNNN CATAGTGGGGTATCTAATCCCAGTTTG | 67 |
| MiFish-E-forward-v2 | ACACTCTTTCCCTACACGACGCTCTTCCGATCT NNNNNN RGTTGGTAAATCTCGTGCCAGC | 61 |
| MiFish-E-reverse-v2 | GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT NNNNNN GCATAGTGGGGTATCTAATCCTAGTTTG | 63 |
| MiFish-U2-forward | ACACTCTTTCCCTACACGACGCTCTTCCGATCT NNNNNN GCCGGTAAAACTCGTGCC | 57 |
| MiFish-U2-reverse | GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT NNNNNN CATAGGAGGGTGTCTAATCCCCGTTTG | 67 |
| 2nd PCR primers | ||
| 2nd-PCR-forward | AATGATACGGCGACCACCGAGATCTACAC XXXXXXXX ACACTCTTTCCCTACACGACGCTCTTCCGATCT | 70 |
| 2nd-PCR-reverse | CAAGCAGAAGACGGCATACGAGAT XXXXXXXX GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT | 66 |
-
*
Normal characters indicate target-specific universal primers (i.e., MiFish primers).
-
†
The six random bases (Ns) in the middle of the 1st PCR primers were appended to enhance cluster separation on flow cells.
-
‡
Italic characters indicate Illumina sequencing primers.
-
§
X indicates index sequences to identify each sample.
-
¶
Underlined characters indicate P5/P7 adapter sequences for Illumina sequencing.
Additional files
-
Supplementary file 1
Supplementary information for eDNA metabarcoding and statistical analyses.
(a) List of species detected from MiFish environmental DNA (eDNA) metabarcoding with raw numbers of reads. (b) A faunal inventory of the coastal marine fishes of Chiba prefecture compiled from museum collections and literature surveys. Museum acronyms are Natural History Museum and Institute, Chiba (CBM) and its coastal branch (CHMH), National Museum of Nature and Science, Tokyo (NSMT), Kanagawa Prefectural Museum of Natural History (KPM), and Yokosuka City Museum (YCM). All references can be found in the footnote. (c) Top 20 fish–fish interactions based on UIC and their interpretations. (d) Results of GAMM between interaction strengths and environmental and ecological properties.
- https://cdn.elifesciences.org/articles/85795/elife-85795-supp1-v1.xlsx
-
Transparent reporting form
- https://cdn.elifesciences.org/articles/85795/elife-85795-transrepform1-v1.pdf
