Introduction

Müller glia (MG) are the last cell type generated by the retinal progenitor cells (RPCs) during development and exhibit a gene expression profile similar to that of late retinal progenitor cells (Jadhav et al., 2009; Roesch et al., 2012). In teleost fish and amphibians, MG respond rapidly to retinal injury, undergoing robust proliferation and regenerating lost retinal neurons from MG-derived progenitor cells (Hamon et al., 2016; Todd and Reh, 2022). In contrast, the proliferative and neurogenic ability of MG in response to injury in mammals is severely limited, failing to mediate retinal self-repair (Karl et al., 2008). Recent investigations have achieved great success in mammalian retinal regeneration by stimulating MG reprogramming through a single or combination of neurogenic transcription factors (Jorstad et al., 2017; Todd et al., 2021, 2022; Ueki et al., 2015). However, this may lead to a depletion of the MG population and cause further retinal degeneration, as MG are indispensable for retinal function and homeostasis. Other studies have shown that the quiescent state of MG can be overridden by upstream signaling pathways such as Wnt and Hippo (Yao et al., 2016; Hamon et al., 2019; Rueda et al., 2019). Activation of Wnt signaling by forced expression of β-catenin in adult mouse MG promoted spontaneous cell cycle re-entry in uninjured retinas (Yao et al., 2016). Moreover, it was demonstrated that bypassing the Hippo pathway in mouse MG led to spontaneous re-entry into the cell cycle and reprogramming into a progenitor cell-like state (Hamon et al., 2019; Rueda et al., 2019). These findings suggest that the re-entry of MG into the cell cycle, which is the first step of MG-mediated retinal regeneration in zebrafish, could be unlocked in mammalian retinas.

The cell cycle of MG is mainly regulated by cyclins and cyclin-dependent kinases (CDKs). Cyclins bind to CDKs to form cyclin-CDK complexes to promote cell cycle progression. During retinal development, the expression of D-type cyclins (cyclin D1, D2, and D3) is tightly regulated (Barton and Levine, 2008; Dyer and Cepko, 2001; Trimarchi et al., 2008). Among these, cyclin D1, encoded by the Ccnd1 gene, is the predominant D-type cyclin in the developing retina and is highly expressed in the RPCs but absent in differentiated cells (Barton and Levine, 2008; Trimarchi et al., 2008). Mice lacking Ccnd1 have small eyes and hypocellular retinas due to reduced RPC proliferation (Fantl et al., 1995; Sicinski et al., 1995), which cannot be compensated by Ccnd2 and Ccnd3 (Das et al., 2012, 2009). Negative regulators of the cell cycle are CDK inhibitors (CDKIs), which include the INK4 (p16^INK4a, p15^INK4b, p18^INK4c, and p19^INK4d) and CIP/KIP families (p21^Cip1, p27^Kip1, and p57^Kip2) (Reynisdóttir et al., 1995). The CDKIs inhibit cell cycle progression by binding to and inactivating the cyclin-CDK complexes (Besson et al., 2008), and they regulate the proliferation in distinct retinal progenitor cells (Dyer and Cepko, 2000, 2001; Levine et al., 2000). P27^Kip1 inhibits the cyclin D-CDK complex to enter the S phase. Following acute retinal damage in mice, a very small number of MG re-enter the cell cycle, co-incident with the downregulation of p27^Kip1 or upregulation of cyclin D1 (Dyer and Cepko, 2001; Hamon et al., 2019; Rueda et al., 2019; Yao et al., 2016). However, this process is transient, as cyclin D1 expression rapidly returns to the basal level (Hamon et al., 2019; Rueda et al., 2019).

In this study, we propose that targeting the two key regulators of the cell cycle, cyclin D1 and p27^kip1, can effectively induce MG cell cycle re-entry. Our findings demonstrate that simultaneously reducing p27^Kip1 and increasing cyclin D1 in MG using a single AAV vector has a strong synergistic effect on promoting MG proliferation in uninjured adult mouse retinas. MG proliferation induced by this treatment is robust and self-limiting, as MG undergo a single round of cell division rather than unlimited proliferations. Through single-cell RNA sequencing (scRNA-seq), we observed that cell cycle reactivation leads to the downregulation of the interferon pathways in the MG and suppression of the MG genes. By RNA in situ hybridization and immunostaining, we showed that MG partially and temporally suppressed their glial cell fate, while the majority of MG regained the normal glial identify by four months post-CCA treatment. A few EdU+ MG daughter cells in the inner nuclear layer (INL) express the bipolar cell marker Otx2 or the amacrine cell marker HuC/D, suggesting rare de novo neurogenesis from MG. Importantly, MG cell cycle reactivation does not disrupt retinal structure or impair retinal function, as the treatment did not deplete the MG from the retina or cause neoplasia. In summary, our results showed that MG cell cycle reactivation by downregulating p27^Kip1 and upregulating cyclin D1 stimulates MG proliferation, and it is possible to combine this approach with other factors that promote regeneration to enhance retinal repair mediated by MG.

Results

Simultaneous p27^Kip1 downregulation and cyclin D1 overexpression drive robust MG proliferation in the uninjured mouse retina

To test the hypothesis that adult mouse MG are kept in a quiescent state by high levels of p27^Kip1 and low levels of cyclin D1, we examined whether spontaneous MG proliferation could be activated by directly changing the levels of these two downstream cell cycle regulators. To drive MG-specific gene expression, adeno-associated virus (AAV)-mediated transgene expression is controlled by a promoter sequence cloned from the human glial fibrillary acidic protein (GFAP) gene (Fig. 1A, Supplementary Fig. 1A) (Lee et al., 2008). AAV serotype 7m8 vectors were injected intravitreally into the eyes of C57BL/6 mice on postnatal day 6 (P6), when the majority of MG finish proliferation and start differentiation, and GFP reporter expression could be detected at three days post-AAV injection (Supplementary Fig. 1B). Our close examination showed that this GFAP promoter drives transgene expression specifically in MG but not in astrocytes (Supplementary Fig. 1C-F).

Figure 1.

To examine the effect of p27^Kip1 and cyclin D1 levels on MG proliferation, wild type mice were infected with control AAV or AAV that knocked down p27^Kip1 and/or overexpressed cyclin D1 at P6 and received intraperitoneal injections of 5-ethynyl-2’-deoxyurdine (EdU) for five consecutive days, from P13 to P17, to label the MG that had entered the S phase of the cell cycle (Fig. 1A-B). In the control retinas that were infected by AAV_7m8-GFAP-GFP-non-target (NT) shRNA, all MG, which were positive of Sox9 expression, were negative of EdU labeling (Fig. 1C). When the retina was infected by AAV_7m8-GFAP-mCherry-p27^Kip1 shRNA1, which expresses a highly efficient p27^Kip1 shRNA1, a small number of MG cells re-entered the cell cycle (Fig. 1D, G, Supplementary Fig. 2); however, the vast majority of MG remained in a quiescent state. Overexpressing cyclin D1 alone through AAV_7m8-GFAP-cyclinD1 infection stimulated a subset of MG cells to proliferate, resulting in a three-fold increase in the number of EdU+ MG cells compared to p27^Kip1 knockdown (Fig. 1E, G, Supplementary Fig. 3). Due to the uneven efficiency of AAV infection across the retina, quantification was performed in the region with the highest infection levels (Supplementary Fig. 4). Finally, the AAV_7m8-GFAP-cyclinD1-p27^Kip1 shRNA1 vector, which simultaneously overexpressed cyclin D1 and suppressed p27^Kip1, had the most significant impact on MG proliferation, with a five-fold increase in EdU+Sox9+ cells compared to cyclin D1 overexpression alone (Fig. 1F, G). The differences in MG proliferation across groups were not due to variations in virus infection efficacy, as confirmed by measuring p27^Kip1 knockdown and cyclin D1 overexpression levels by quantitative PCR (Supplementary Fig. 5). A transgenic mouse line Glast-Cre^ERT2; Sun1:GFP, in which MG nuclei were labeled by nuclear membrane-bound GFP (Supplementary Fig. 6A-C), was used to quantify the percentage of MG that re-entered the cell cycle. In the retinal area where viral infection rate was the highest, approximately 45% of Sun1:GFP+ MG were EdU positive, and the total number of MG increased by about 50% (Supplementary Fig. 6D-H), indicating that nearly half of the MG cells re-entered the cell cycle. As the AAV_7m8-GFAP-cyclinD1-p27^Kip1 shRNA1 vector enables such robust MG proliferation, we refer to it as the cell cycle activator (CCA) for short.

Previous research has shown that the ability of retina to regenerate by various stimuli declines with the age of the mice (Löffler et al., 2015; Ueki et al., 2015). We compared the efficiency of CCA in driving MG proliferation in young (P28) and older adult mouse (P255-P347) retinas to that in P6 pups (Fig. 1H). Remarkably, MG proliferation induced by CCA remained robust in adult mice (Fig. 1H). These findings suggest that CCA efficiently drives MG proliferation irrespective of the age of the mice. The synergistic effect of cyclin D1 overexpression and p27^Kip1 knockdown on MG proliferation suggest that both low levels of p27^Kip1 and high levels of cyclin D1 are required for postmitotic MG to re-enter the cell cycle.

MG proliferation driven by CCA is self-limiting

Concerned that p27^Kip1 suppression and cyclin D1 overexpression may lead to uncontrolled cell proliferation and retinal tumorigenesis, we analysed the proliferative capacity of MG driven by CCA. Firstly, we examined the duration of MG proliferation after CCA treatment by a time-course EdU incorporation assay. Starting on various days after the CCA treatment, mice received two injections of EdU to label the cells that were undergoing proliferation (Fig. 2A). The result revealed that MG proliferation started as quickly as the third day after CCA injection, reached its peak around the fifth day, followed by a gradual decrease (Fig. 2A). By two weeks post-CCA injection, only a few MG were observed re-entering the cell cycle. Two months post-CCA injection, MG proliferation had mostly ceased (Fig. 2A). These findings suggest that MG proliferation was largely completed within two weeks post-CCA treatment. In addition, an EdU/BrdU double-labeling assay was performed to examine whether MG undergoes one or multiple cell divisions after CCA treatment. Five injections of EdU were given from day one to five post-CCA treatment, followed by five BrdU injections from day six to ten post-CCA treatment (Fig. 2B). Retinas were collected one day after the last BrdU injection to evaluate if any MG continuously entered the S phase of the cell cycle. While there were a number of cells positive for EdU or BrdU, no cells were co-labeled with EdU and BrdU (Fig. 2B,C), indicating that no MG underwent two cell divisions. Finally, we utilized the Glast-Cre^ERT2; tdTomato mouse line to label MG sparsely with a low dose of tamoxifen induction (Fig. 2D, Supplementary Fig. 7). At four weeks post-CCA injection, we observed either single MG or pairs of MG in close proximity, but no clusters of three or more cells (Fig. 2E-F). The results of these experiments suggest that MG undergo only one cell division following CCA treatment.

Figure 2.

We asked why CCA did not drive MG to undergo multiple rounds of cell proliferation. We immunostained the retinal samples harvested for the time-course MG proliferation study (Fig. 2A). Cyclin D1 was undetectable in MG of control retinas (Fig. 2G), but it was robustly overexpressed in the majority of MG within the INL by three days post-CCA injection (Fig. 2H). By a later time point, cyclin D1 expression had disappeared in the EdU+ MG that had migrated to the ONL (Fig. 2I, arrowheads). The other EdU-MG in the ONL, which were likely the cells that have proliferated prior to EdU injections, also ceased to express cyclin D1 (Fig. 2I). In another group of mice injected with CCA on P28, we further confirmed that the levels of cyclin D1 overexpression decreased at 3 weeks post-CCA injection and diminished at 4 months post-CCA injection (Supplementary Fig. 8). In comparison, p27^Kip1 suppression by CCA lasted longer, as p27^Kip1 level remained low in some MG at 3 weeks and 4 months post-CCA injection (Supplementary Fig. 9-10). These results suggest that cyclin D1 overexpression ceased after the initial cell proliferation, thereby preventing MG from undergoing a second round of proliferation.

scRNA-seq analysis of MG shows suppression of the interferon (IFN) pathway by CCA

To identify changes in gene expression and possible changes in cell fate of MG and their daughter cells, we performed single-cell RNA-Seq (scRNA-Seq) analysis on the mouse retinas that received CCA treatment. To isolate MG in regions of the retina with high viral infection, CCA and a control virus AAV_7m8-GFAP-GFP-NT shRNA were 9:1 mixed and co-injected to 4-week-old Glast-Cre^ERT2;tdTomato mice (Fig. 3A). Three weeks post infection, the retina areas with strong GFP expression were collected by dissection, and tdTomato+ MG were isolated by fluorescence-activated cell sorting (FACS) and analysed by scRNA-seq (Fig. 3A). The majority of sorted MG should be infected by CCA. The control group was injected with the AAV_7m8-GFAP-GFP-NT shRNA virus only (the same total concentration as the CCA and CCANT groups) to account for any non-specific effect caused by virus injection and/or shRNA expression. As previous studies demonstrated that N-methyl-D-aspartate (NMDA)-induced retinal damage and histone deacetylase inhibitor Trichostatin A (TSA) improve MG proliferation and reprogramming (Hoang et al., 2020; Jorstad et al., 2017; Rueda et al., 2019), a group of CCA-treated mice also received NMDA on day 7 and TSA on day 9 post-CCA injection (CCA+NMDA+TSA, referred to as CCANT) to enhance the reprogramming effect, if any, of CCA.

Figure 3.

After quality control, 3,758 cells were profiled in the control group, 3,890 cells in the CCA group, and 3,278 cells in the CCANT group (Supplementary Fig. 11-12). Clustering analysis separated the cells into six distinct clusters (Fig. 3B), which are quiescent MG, reactivated MG, MG in G2/M phase, and MG in S phase, rods, and rod-MG, as annotated by the known retinal cell type markers (Fig. 3C). The rods and rod-MG clusters were due to tdTomato leaky expression in native rods and rod mRNA contamination during MG isolation, respectively (Supplementary Fig. 7,13-14). The vast majority of MG (>90%) in the control group are quiescent MG, which express high levels of MG genes such as Glul and Kcnj10 (Fig. 3D-G). In the CCA-treated sample, there was still a small number of proliferating MG in the G2/M or S phase at three weeks after CCA treatment, as shown by cycle state analysis (Fig. 3B-E, Supplementary Fig. 12D,E). ∼70% of MG in the CCA-treated sample formed a separate cluster, which we refer to as reactivated MG (Fig. 3C-E). Reactive gliosis genes (Gfap and Vim) were upregulated while other MG genes (Kcnj10, Glul, Rlbp1, and Aqp4) were downregulated in the reactivated MG compared with the quiescent MG (Supplementary Fig. 15). Interestingly, the top differentially expressed genes (DEGs) between reactivated MG and quiescent MG are the interferon (IFN) pathway genes, including Stat1, Stat2, Gbp6, Irgm1 and Igtp, which were downregulated in the reactivated MG (Fig. 3F-H). IFN signaling is involved in antiviral responses and usually induces cell cycle arrest in infected cells (Durbin et al., 1996; Kaplan et al., 1998). The high level of IFN signaling in the control sample likely resulted from control virus infection, while the pro-proliferative effect of the CCA vector might suppress IFN pathway to promote MG proliferation. In contrast, Stat3, which is often activated by various cytokines or growth factors to promote cell proliferation and survival (Hirano et al., 2000), was not downregulated concurrently with Stat1 and Stat2 (Fig. 3H). Activation of STAT3 signaling in the reactivated MG may also facilitate MG proliferation.

CCA causes a temporary suppression of MG genes, leading to partial dedifferentiation

Despite CCA or CCANT treatment, no neurogenic progenitor cluster or significant upregulation of neurogenic transcription factors such as Ascl1 and Neurog2 were observed (Supplementary Fig. 16), suggesting cell cycle reactivation, even with NMDA and TSA, is insufficient to drive robust neuronal reprogramming. Nonetheless, the scRNA-seq data suggest that CCA treatment led to downregulation of the MG genes, including Glul, Rlbp1, Aqp4, and Kcnj10 (Supplementary Fig. 15). To further verify the change of MG gene expression after CCA treatment, we assessed the level of Glul, the gene encoding Glutamate Synthase, which is highly expressed in the MG, by RNA in situ hybridization on retinal sections (Fig. 4A). Three weeks post-CCA treatment, there was a significant decrease of Glul mRNA level in the MG, regardless their localization in the ONL, OPL or INL (Fig. 4B-D), suggesting a partial repression of the MG gene. By four months post-CCA treatment, the Glul level increased again, suggesting that they eventually retained MG identity and functions (Fig. 4B-D).

Figure 4.

We further assessed another MG marker Sox9 in the CCA-treated retinas. Immunostaining confirmed that many MG in the ONL, which have gone interkinetic nuclear migration, decreased or even lost Sox9 expression level at 3 weeks post-CCA treatment (Fig. 5A-E). The suppression of MG gene expression was transient, as most MG had recovered high levels of Sox9 expression by 4 months (Fig. 5E). The results from both assays suggest that MG cell fate was partially suppressed in the MG daughter cells, but it recovered without further stimulus to drive neurogenesis. However, less than 1% of the GFP+ MG in the INL completely lost Sox9 between 3 weeks to 4 months post-CCA treatment (Fig. 5D-E). These Sox9 negative MG exhibited circular nuclear envelop shape and faint GFP signal (Fig. 5D, arrowhead), characteristics of the MG-derived retinal neuron-like cells observed in previous studies (Hoang et al., 2020; Le et al., 2024a, 2024b).

Figure 5.

Rare neurogenesis from MG occurs spontaneously after cell cycle reactivation

To examine whether some MG, although at a very low efficiency, give rise to neurons after CCA treatment, we performed immunostaining for the bipolar marker Otx2. We focused our analysis on EdU+tdT+ MG in the Glast-Cre^ERT2; tdTomato mice to identify de novo neurogenesis from MG (Fig. 6A). Four months post-CCA treatment, we found a small number of MG-derived cells in the INL expressing Otx2 (Fig. 6B-E). Although their proportion was low (∼1% of EdU+tdT+ cells), these were likely the genuine neuron-like cells that have differentiated from MG daughter cells over time, as these cells were not present at an earlier time point (Fig. 6A-E). Rare HuC/D+EdU+tdT+ cells were also found in the lower INL, where the amacrine cells naturally reside, only at four months post-CCA treatment (Supplementary Fig. 17). However, the HuC/D level in the MG-derived cells was lower compared to that of the native amacrine cells (Supplementary Fig. 17). Whether these cells express other bipolar or amacrine cell markers and whether they are functional interneurons that connect with the retinal circuitry needs further investigation. Nonetheless, our findings suggest that cell cycle reactivation alone allows some MG daughter cells to spontaneously become neuron-like cells.

Figure 6.

CCA does not cause retinal neoplasia or functional deficit

To assess the long-term effect of CCA treatment, a cohort of C57BL/6J mice were observed for a year following CCA injection (Fig. 7A). Visual function assessments showed no significant differences in visual acuity and electroretinography (ERG) between CCA-treated eyes and uninjected control eyes one year after CCA treatment (Fig. 7B-D). Upon examining all the harvested retinas from the CCA-treated group, no retinal neoplasia was observed. The retinal structure remained intact, with no malignancy or disruptions in the retinal layers or stratification (Fig. 7E-H). These results indicate that CCA treatment did not have a detrimental impact on retinal structure or function in mice, nor did it induce retinal tumours.

Figure 7.

We used the MG marker Sox9 to examine the MG population in the retina sections harvested at a year post-CCA treatment. In the control retina, Sox9+ MG cells were aligned in the INL (Fig. 7E-F). In the CCA-treated retinas, there was a significant expansion in the number of Sox9+ MG cells, distributed across the ONL, OPL, and INL (Fig. 7G-H). The larger population of Sox9+ MG remained to support the retinal structure and homeostasis, which explains the relatively unaffected retinal structure and function observed on the CCA-treated eyes. We further made comparison of the numbers of Sox9+ cells after one year of CCA treatment and after 2 weeks of CCA treatment. The total numbers of Sox+ cells were similar between these two time points (Fig. 7I), indicating no significant MG loss after MG proliferation. To directly assess whether CCA treatment may lead to the cell death of the MG, especially the MG displaced in the ONL and OPL, we examined the CCA-treated retinas with TUNEL assay and did not observe obvious any TUNEL+ MG at three or six weeks post-CCA injection (Supplement Fig. 18). Since we could only examine cell death at single time points, we cannot completely exclude the possibility that there were small numbers of MG-derived cells dying without being detected. The fact that the numbers of MG in the ONL and OPL did not decrease in the retinas harvested at one-year post-CCA treatment suggests that these MG-derived cells persist without dying or losing the MG identity (Fig. 7J).

Discussion

MG proliferation is a key step towards MG-mediated regeneration in the retina. Previously, it was shown that activation of the canonical Wnt pathway by AAV-mediated overexpression of β-catenin stimulates MG proliferation through the Lin28/let7 pathway (Yao et al., 2016), and cyclin D1 is a direct target gene of both Wnt signaling and Lin28/let7 (Li et al., 2012; Shtutman et al., 1999; Tetsu and McCormick, 1999). Suppression of the Hippo pathway by transgenic expression of YAP5SA induces MG proliferation, accompanied by an increase in cyclin D1 expression (Hamon et al., 2019; Rueda et al., 2019). However, the Hippo and Wnt pathways have downstream genes besides cyclin D1 and serve different cellular functions. It remains unclear whether cyclin D1 activation is necessary or sufficient to drive MG proliferation in these contexts. In this study, we demonstrate that cyclin D1 overexpression alone leads to limited MG proliferation and that the combination of cyclin D1 overexpression and p27^Kip1 knockdown is the most potent strategy to drive MG proliferation in mouse retina without injury stimulus.

Our results showed that CCA effectively promoted MG proliferation in both P6 and adult mouse retinas; however, the timing of MG proliferation differed between the two age groups. Following CCA treatment on P6, MG proliferation started as early as day 3-4 post-CCA injection and largely finished by two weeks, peaking around one week after treatment (Fig. 2A). In contrast, following CCA treatment on P28, MG proliferation started later, as not many mitotic MG had migrated to the ONL at one-week post-CCA treatment (Supplementary Fig. 8 and 10). Moreover, proliferating MG were still present three weeks post-treatment, as shown by scRNA-seq analysis (Fig. 3B-E). We speculate that the differences in MG proliferation time are due to variations in AAV transduction efficiencies of retinal cells at different ages. AAV_7m8 vectors delivered by intravitreal injections transduce MG more efficiently at P6 before the inner limiting membrane is fully developed. The level of cyclin D1 and p27^Kip1 may reach the thresholds permissive for MG cell cycle re-entry faster following CCA treatment on P6 compared to the same treatment in adult mice. This hypothesis is supported by the immunostaining results of both cyclin D1 and p27^Kip1 (Fig. 2G-I, supplementary Fig. 8-10). This finding also emphasizes the importance of using high CCA titer (>5 x 10¹³ genome copies/ml) in adult mice to effectively stimulate MG proliferation.

P27^Kip1 and cyclin D1 serve as critical regulators of cell cycle progression, and any abnormalities in their expression may impact cell division, potentially leading to tumor development. Previous studies have shown that mice lacking p27^Kip1 are approximately 30% larger and develop pituitary tumours spontaneously (Fero et al., 1996). Cyclin D1 is frequently upregulated in a significant fraction of human cancers, such as breast and respiratory tract tumours (Callender et al., 1994; Zukerberg et al., 1995). The strategy to stimulate MG proliferation for the purpose of retinal regeneration must be carefully weighed against the potential risk of tumorigenesis. In this study, we carefully evaluated the tumorigenic potential of CCA and made the following observations: First, the rate of MG proliferation gradually decreased and ceased over time (Fig. 2A). Second, MG appeared to undergo only a single round of cell division (Fig. 2B-F); and lastly, the retinal structure remained normal without signs of neoplasia even one-year post-treatment (Fig. 7). The absence of continuous MG proliferation may be partly attributed to the non-integrating nature of the recombinant AAV genomes, which become diluted after cell division, leading to reduced transgene expression. Notably, the loss of cyclin D1 overexpression and the recovery of high level p27^Kip1 did not occur simultaneously. The former was observed much earlier than the latter (Fig. 2G-I, Supplementary Fig. 8-10). This is also supported by the scRNA-seq data, which showed that Ccnd1 upregulation was lost in the MG three weeks after CCA treatment while Cdkn1b suppression was still evident (Supplementary Fig. 16). These findings suggest that the rapid cessation of cyclin D1 overexpression may be regulated by additional mechanisms. For instance, the anti-proliferative gene Btg2, known to suppress cyclin D1 expression (Wei et al., 2012), was upregulated in the proliferating and reactivated MG (Supplementary Fig. 16). In summary, the risk of tumor formation associated with CCA is minimal.

Interestingly, we observed significant downregulation of interferon (IFN) pathway genes in reactivated MG, a finding consistent with their known anti-proliferative role in immune surveillance and tumor suppression (Durbin et al., 1996; Kaplan et al., 1998). The suppression of IFN pathway may reflect a mechanism by which CCA overcomes intrinsic barriers to proliferation. Our results align with Rueda et al. (2019), who reported that forced YAP5SA expression in NMDA-treated MG similarly downregulated IFN pathway genes in the proliferative MG (Rueda et al., 2019). Given that cyclin D1, a key Hippo pathway target, is upregulated in both paradigms, we propose a shared mechanism of IFN suppression. In addition to regulating cell cycle, cyclin D1 may indirectly control the transcription of Stat1 and Stat2 and/or other IFN pathway genes by interacting with other transcriptional cofactors (Mcmahon et al., 1999; Zwijsen et al., 1998). Notably, Stat3 levels remained stable in the reactivated MG. STAT3 activation, which is primarily induced by cytokines (e.g. IL-6) and growth factors (e.g. EGF), promotes cell proliferation (Hirano et al., 2000), but it inhibits neurogenesis of mouse and avian MG (Jorstad et al., 2020; Todd et al., 2016, 2020). Sustained Stat3 level in our system could explain both the proliferative competence of reactivated MG and their failure to differentiate to neurons. The divergent regulation of Stat1/2 (suppressed) versus Stat3 (sustained) highlights that these pathways are differentially modulated by the cell cycle regulators, warranting further investigation into their different functions in MG reprogramming.

The rods and rod-MG were two unexpected clusters in the scRNA-seq analysis. Upon close examination of the retina of Glast-Cre^ERT2; tdTomato mice without Tamoxifen induction, we found that very few rods (14 tdTomato+ rods in 128 whole retinal sections of eight mouse retina samples screened) were mislabeled by leaky tdTomato expression in a Cre-independent manner (Supplementary Fig. 7). The small rod clusters are likely the native rods mislabeled by tdTomato, appearing in all three groups at similar proportions. The rod-MG cluster, which was characterized by high levels of both MG and rod genes, was located between the rod cluster and the reactivated MG cluster (Fig. 3B-E). This rod-MG cluster was enriched in the CCA and CCANT groups (Fig. 3D,E). Initially, we speculated that this rod-MG cluster might represent MG that had upregulated rod genes. To investigate this, we performed RNA in situ hybridization to assess the levels of Gnat1 and Rho mRNAs in MG freshly isolated from the mouse retina three weeks post-CCA treatment (Supplementary Fig. 14). Despite slight increases of Gnat1 and Rho mRNA signals in the CCA-treated sample compared to the untreated control retina, some MG from the control retina also exhibited some signals of both genes, suggesting that these signals resulted from rod contamination (Supplementary Fig. 14). The enrichment of rod gene expression in CCA-treated MG, as indicated by the scRNA-seq data and RNA in situ hybridization data, may result from a greater number of MG migrating to the ONL and closely contacting with surrounding rods, leading to higher levels of rod contamination. Moreover, we did not observe many cells overexpressing neurogenic genes, such as Ascl1, Neurog2 and Dll3, or rod precursor gene prdm1 (Supplementary Fig. 16). Therefore, we cautiously conclude that CCA alone does not reprogram MG toward a rod cell fate. The lack of MG reprogramming toward rod may be due to the sustained Notch signaling or Stat3 signaling in the reactivated MG (Supplementary Fig. 16).

Following cell division, the majority of the MG retained their glial identity, with around 1% of MG daughter cells expressing markers of bipolar or amacrine cells. This aligns with prior reports showing that a small subset of MG daughter cells expressed the markers of retinal interneurons after cell cycle reactivation either by inhibition of the Hippo pathway or by activation of Wnt signaling (Rueda et al., 2019; Yao et al., 2016). The rarity of neurogenesis raises critical questions about intrinsic heterogeneity within the MG population. We speculate that a small subset of MG may exist in a “primed” state, either expressing elevated levels of neurogenic factors or having a more permissive chromatin state for neurogenic gene expression, which predispose them to differentiate to neurons. However, the inefficiency of neurogenesis driven solely by cell cycle reactivation underscores a key translational barrier. To achieve functional regeneration, future strategies should combine MG cell cycle activation with neurogenic reprogramming factors (e.g. ASCL1) and/or suppression of anti-neurogenic pathways (e.g. Notch, STAT3). Such combinatorial approaches could redirect MG daughter cells from a default glial fate toward neuronal differentiation, offering a viable path for treating retinal degenerative diseases.

Materials and Methods

Animals

Wild type mice (strain C57BL/6J), Rosa26-tdTomato reporter mice (strain B6.Cg-Gt(ROSA)26Sor^{tm14(CAG-tdTomato)Hze}/J), Rosa26-Sun1:GFP reporter mice (Strain B6.129-Gt(ROSA)26Sor^{tm5.1(CAG-Sun1/sfGFP)Nat}/MmbeJ), and Glast-Cre^ERT2 reporter mice (strain Tg(Slc1a3-cre/ERT)1Nat/J) were purchased from the Jackson Laboratory and were kept on a 12 hour light/12 hour dark cycle. All animal procedures performed were approved by the Hong Kong Department of Health under Animals Ordinance Chapter 340 and City University of Hong Kong animal ethics committee, and animal care was carried out in accordance with institutional guidelines.

AAV plasmids and vectors

The pAAV-GFAP-GFP vector plasmid was cloned by replacing the CMV promoter with a 681bp ABC₁D region of the human GFAP gene promoter (Lee et al., 2008) into the pAAV-CMV-GFP vector (Supplementary Fig. 1A). cDNAs encoding mouse cyclin D1 were cloned into AAV plasmids by Gibson ligation. The AAV-shRNA vectors were cloned by replacing the GFP sequence with mCherry-shRNA in the pAAV-GFAP-GFP vector. Three shRNA sequences used in the study were GACTACACAAATCAGCGATTT (non-target shRNA), GCAAGTGGAATTTCGACTTTC (p27 shRNA1), and GCTTGCCCGAGTTCTACTACA (p27 shRNA2). pAAV-GFAP-cyclin D1-p27 shRNA1 and pAAV-GFAP-GFP-NT shRNA were cloned by replacing mCherry sequence with cyclin D1 or GFP from the pAAV-GFAP-mCherry-p27 shRNA1 or pAAV-GFAP-mCherry-NT shRNA, respectively (Supplementary Fig. 2A). The pAAV rep/Cap 2/2, and Adenovirus helper plasmids were obtained from the University of Pennsylvania Vector Core, Philadelphia. The pAAV7m8 plasmid (#64839) was purchased from addgene.

AAV was produced in HEK293T cells (HCL4517; Thermo Scientific) by AAV vector plasmid, rep/cap packaging plasmid, and adenoviral helper plasmid co-transfection followed by iodixanol gradient ultracentrifugation. Purified AAVs were concentrated with Amicon 100K columns (EMD Millipore) to a final titer higher than 5 x 10¹³ genome copies/ml. Protein gels were run to determine virus titers.

Tamoxifen injection

Intraperitoneal injections of tamoxifen (Sigma) in corn oil were administered to induce the expression of Cre recombinase. Tamoxifen was given at a dosage of 50 mg/kg daily from P23 to P27 to induce reporter expression in the majority of MG, and a single dosage of 15 mg/kg on P20 for sparsely labeling of MG.

AAV injection

Intravitreal injection was performed using a pulled angled glass pipette controlled by a FemtoJet (Eppendorf). The tip of the needle was passed through the sclera at the equator, near the dorsal limbus of the eyeball, and entered the vitreous cavity. The injection volume of AAV (5 x 10¹³ genome copies/ml) was 0.5μl per eye for P6 injection and 1μl per eye for adult mouse injection.

In situ RNA hybridization

In situ RNA hybridization was performed on retinal sections using the RNAscope Multiplex Fluorescent Detection Reagents V2 kit (Advanced Cell Diagnostics) following the commercial protocols. In brief, retinas were dissected, 4% paraformaldehyde (PFA) fixed, dehydrated in sucrose solution and embedded in optimal cutting temperature (OCT) medium. Retinas were cryosectioned into 20-μm-thick sections and mounted on SuperFrost Plus glass slides (Epredia). The uninjected eye and CCA-injected eye from the same animal were sectioned on the same slide and processed together. After OCT removal with PBS and further dehydration by ethanol, retinal sections were stained with GFP antibody (AB_2307313; Aves Labs) at 4 °C overnight. After three times wash with PBST (PBS with 0.1% Tween-20), retinal sections were hybridized with RNA probes (Advanced Cell Diagnostics Cat.No. 426231-C2 for Mm Glul) at 40 °C for two hours. Following in situ RNA hybridization steps, slides were stained using secondary antibodies (Jackson ImmunoResearch) and DAPI for two hours at room temperature. The fluorescent signals were visualized and captured using Nikon A1HD25 High speed and Large Field of View Confocal Microscope. The mRNA levels were quantified by measuring signal intensity level by ImageJ. Pixel intensity of MG treated with CCA was normalized to the average pixel intensity of MG in the uninjected eye of the same animal.

Immunohistochemistry

Retinas were dissected and fixed in 4% formaldehyde in PBS for 30 min at room temperature and sectioned at 20-μm thickness by cryostat. Retinal sections were blocked in 5% BSA in PBST (PBS with 0.1% Triton X-100), stained with primary antibodies at 4 °C overnight, and washed three times with PBST. Primary antibodies used in this study included rabbit anti-p27^kip1(1:200, PA5-16717; Thermo Fisher); rabbit anti-cyclin D1 antibody (1:300, 26939-1-AP; Proteintech), goat anti-Otx2 antibody (1:200, AF 1979; R&D systems), mouse anti-HuC/D antibody (1:200, A21271; Thermo Fisher), rabbit anti-GFAP antibody (1:500, Z0334, DAKO), goat anti-Sox2 antibody (1:500, AF2018, R&D systems), and rabbit anti-Sox9 antibody (1:1000, AB5535; Millipore). Sections were stained using secondary antibodies (Jackson ImmunoResearch) for two hours at room temperature. Cell nuclei were counterstained with DAPI (Sigma). TUNEL was performed using an TUNEL BrightRed Apoptosis Detection Kit (Vazyme) according to the manufacturer’s protocol.

EdU incorporation and BrdU detection assay

5’-ethynyl-2’-deoxyuridine (EdU, 50 mg/kg, Abcam ab146186) or 5-bromo-2’ deoxyuridine (BrdU,100 mg/kg, Abcam 142567) was injected intraperitoneally to label the cells in the S phase. EdU staining was performed using the Click-iT™ EdU Alexa Fluor™ Imaging Kit (C10337). For BrdU detection, the retinal sections were incubated with 2 M HCl for 1 hour at room temperature. The sections were rinsed with PBST and incubated with a blocking buffer containing 5% BSA in PBST for 2 hours at room temperature. Primary antibody mouse anti-BrdU (1:300, ab8152; Abcam) was stained overnight at 4°C, and secondary antibodies (Jackson ImmunoResearch) were stained for 2 hours at room temperature.

Single-cell RNA-seq

Library preparation and sequencing of single cells

The FACS-sorted cells from each sample were filtered through a 40-µm strainer (pluriStrainer) and processed with Chromium Next GEM Single Cell 3′ GEM, Library & Gel Bead Kit v3.1 (1000269), Chromium Next GEM Chip G Single Cell Kit (1000127) and Chromium Controller (10x Genomics) according to the manufacturer’s protocol. The constructed libraries were sent to Novogene (Beijing) for NovaSeq paired-end 150 bp sequencing and produced 330 Gb of raw data.

Preprocessing, filtering and clustering of scRNA data

Sequencing results were preprocessed with 10x Genomics Cell Ranger 6.1.1. (Zheng et al., 2017) for demultiplexing, barcode assignment, and unique molecular identifier (UMI) quantification using a standard pipeline for 10X for each of the three samples. We used indexed mouse genome mm10 with added tdTomato and GFP transgenes as a reference. Reads mapping to introns covered more than 34% of all reads. Therefore, they were included in feature counts using ‘include_introns’ option in cellranger count step of the pipeline. Cell Ranger aggregation was applied for merging runs from three samples.

Quality control, filtering, dimensional reduction, and clustering of the data were carried out using the Seurat package in R (Stuart et al., 2019). The cells with less than 2,000 expressed features, total UMI count higher than 100,000 and percentage of mitochondrial transcripts more than 15% were disregarded. Features of the Y chromosome, as well as Xist and Tsix genes of the X chromosome, were excluded to avoid confusing effects of gender.

Further filtering of cells was carried out by only including cells expressing tdTomato (Supplementary Fig. 11). Potential cell duplicates were estimated using DoubletFinder method (McGinnis et al., 2019) implemented in R (with parameter settings PC=10, pK=0.28, pN=0.3). The threshold for the expected doublet formation rate was set to 10% to reflect the assumption that cell duplicates can appear relatively commonly in the MG cells. Detected duplicates were excluded from the data (Supplementary Fig. 11G,H).

For the remaining cells, Uniform Manifold Approximation and Projection (UMAP) dimension reduction based on eight principal components (PCs) was applied, and cells were clustered using the graphical clustering method in Seurat. Cell types were identified using known marker genes (Clark et al., 2019; Hoang et al., 2020). After removing doublets, cell types in clusters 4-9 other than MG, Rod-MG, and Rod included only a few cells, and 10-30% of the cells were from the control sample, suggesting that these cells are likely to be contaminated (Supplementary Fig. 11I,J). After excluding cells in clusters 4-9, the new UMAP and clustering (Supplementary Fig. 12A) revealed two subclusters of Rod-MG cells (Clusters C3-C4, Supplementary Fig. 12A). The cells in the subcluster C4 exhibited similar proportional contributions from all three groups and expressed lower level of rod-specific genes such as Rho (Supplementary Fig. 12B,C). These cells were again defined as contaminated and excluded from the data. The final UMAP was constructed using seven PCs, and the same PCs were used for clustering of cells (Fig. 3B).

Analysis of scRNA-seq data

The cell cycle state of each cell was defined by the Cell Cycle Scoring function in the Seurat R package. The cells with G2/M and S scores lower than 0.1 were defined to be proliferating (Supplementary Fig. 12D,E). Differential gene expression analysis between different cell types or three treatment groups was performed using Deseq2 (Supplementary table 1) (Love et al., 2014). Enrichment analysis of top 200 up- and downregulated genes was performed for Gene Ontologies (GO), KEGG and Reactome pathways using Gprofiler2 R interface to g:Profiler (Raudvere et al., 2019).

The optomotor and electroretinography tests

Mouse visual acuity was measured using an Optometry System (Cerebral Mechanics Inc.) following the published protocol (Douglas et al., 2005). Testing was done with a grating of 12 degrees/second drifting speed and 100% contrast. The injected right eyes (CCA-treated) and uninjected left eyes (Ctrl) were tested independently for counterclockwise and clockwise grating rotations, respectively. A staircase procedure was used, in which the observer tested low to high visual acuity. Each animal was tested for about 10-15 minutes per session.

ERG was measured using an Espion E3 System (Diagonsys LLC Inc.) as previously described (Hoang et al., 2023). Animals were dark-adapted overnight before the test. After inducing anesthesia with a ketamine: xylazaine injection intraperitoneally, the pupils of both eyes were dilated using Mydrin®-P Ophthalmic Solution. Once the pupils were fully dilated, the eyes were maintained moist using a topical gel. The measurement electrodes were then applied to the cornea of both eyes, while the ground electrodes were attached to the mouth and tail. All these steps were performed in the darkroom under dim red light. For scotopic ERG recordings, a multiple 530nm light with different intensities (increments from 0.01 cd.s/m² to 30 cd.s/m²) were elicited to stimulate scotopic responses in a specific time interval. For photopic ERG recordings, 5 mins exposure under 10 cd.s/m² light intensity was adopted to inhibit the rod function. The photopic response was measured by multiple flashes of 30 cd.s/m² intensity in the illuminated background (10 cd.s/m²). The average amplitude and implicit time of a- and b-wave were recorded and exported for further analysis. The b-wave amplitude of the step-wise scotopic responses and that of photopic response at 30 cd.s/m² were shown in figure.

Statistics

Data were presented as mean ± SEM in all figures. Sample sizes and statistical analysis were indicated for each experiment in figure legend. ANOVA with Tukey’s test was performed to compare multiple groups, and Student’s t-test to compare two groups. A P value < 0.05 was considered statistically significant. GraphPad Prism was used to perform statistical analysis and make figures.

Acknowledgements

This research was funded by Hong Kong Research Grants Council Project (11103819, 11102922, and 11100723), Hong Kong Health and Medical Research Fund Project (05160276 and 06172466), TUNG Biomedical Sciences Foundation, and Ming Wai Lau Center for Reparative Medicine Research Associate Program.

Additional files

Supplementary figure 1-18

Supplementary Table 1_DEG

Supplementary Information