Introduction

Type I interferons (IFN-Is) play a key role in the innate immune response to viral infections. under viral stimulations, cells produce and release interferons, which subsequently induce the transcription of interferon-stimulated genes ^1,2. Besides their critical role in antiviral immune responses, growing evidence suggests that type I interferons (IFNs) produced by malignant tumor cells or infiltrating immune cells also influence the effectiveness of cancer immunotherapies^3–5. Many traditional chemotherapeutic drugs, targeted anti-cancer drugs, immunoadjuvants, and oncolytic viruses require intact type I IFN signaling to exert their full effects ^6,7. Furthermore, studies have shown that high intratumoral expression levels of type I IFN or IFN-stimulated genes are associated with favorable disease outcomes in cancer patients.⁸

In response to viral RNA molecules, RLRs (RIG-I-like receptors) exposed its CARD domain and then cooperate with mitochondrial antiviral signaling protein (MAVS) and TANK-binding kinase1(TBK1) to promote the production of type I interferon and transcription of different interferon-stimulated genes^9,10. Thus, targeting RLRs can provoke anti-infection activities, moreover, RLRs also play an important role in anti-tumor immunity,for example, targeting RLRs sensitize “immune-cold” tumors to “immune hot” tumors¹¹. DNA methyltransferase inhibitors facilitates upregulation of endogenous retroviruses in tumor cells, whch induce the activation of the RLR RNA recognition pathway that potentiates immune checkpoint therapy^12,13. SB 9200, also referred to as inarigivir soproxil or GS-9992 is a dinucleotide agonist of RIG-I and nucleotide binding oligomerization domain-containing protein 2 (NOD2)¹⁴, is in clinical trials to treat chronically infected HCV patients¹⁵. Another RIG-I agonist MK-4621 appears to be safe and tolerable for patients with advanced or recurrent tumors, with no dose-limiting toxicities¹⁶.

The post-transcriptional modifications (PTMs) of RIG-I is vital for its activation and stability. Several E3-ligases have been reported for K63- or K48-linked polyubiquitination of RIG-I and regulate RLR pathway. K63-linked ubiquitination mediated by TRIM25¹⁷ and Mex-3 RNA binding family member C (MEX3C) in CARD region of RIG-I^18,19, or mediated by RNF135 in RIG-I C-terminus^20,21, facilitates RLR signal transduction. In addition to K63 ubiquitination that usually associates with signal transduction pathways. classical degradative K48-linked polyubiquitylation also regulates RIG-I’s stability. Several E3 ligases such as Cbl²², ring finger protein 122 (RNF122)²³, RNF125²⁴ and TRIM40²⁵. Conversely, the expression of RIG-I is also regulated by several deubiquitylating enzymes. For instance, ubiquitin specific peptidase 3 (USP3), USP21, and CYLD lysine 63 deubiquitinase (CYLD), RIG-I K63-polyubiquitin chains were removed by them and thus regulates RLR signaling pathway. ^26,27, Deubiquitinase USP4 and USP15 can increase the stability of RIG-I and TRIM25 by removing K48 ubiquitination from them^28,29. Discovering new protein machines regulating the activity or stability of RIG-I will provide new insights and targets for antiviral and anti-tumor therapies.

ORMDL3 is part of the three-member ORMDL gene family, which also includes ORMDL1 and ORMDL2. It encodes a 153-amino acid transmembrane protein that is primarily located in the endoplasmic reticulum (ER) ³⁷. Genetic variants in ORMDL3 is associated with sphingolipid synthesis and altered metabolism,which contributing to asthma³⁰. Recent evidence has elucidated that eosinophil trafficking, recruitment, and degranulation was regulated by ORMDL3, This regulation may contribute to the development of allergic asthma and potentially other eosinophilic disorders³¹. Additionally, ORMDL3 polymorphisms also contribute to a diverse set of inflammatory disorders that include bronchial asthma, inflammatory bowel disease³², ankylosing spondylitis³³, atherosclerosis³⁴, SLE³⁵ and cholangitis^36,37. However, the role of ORMDL3 in innate immunity remains unknown.

In this study, we illuminate ORMDL3 as a pivotal negative regulator of the type I interferon (IFN) signaling pathway. ORMDL3 forms a complex with MAVS and subsequently directs RIG-I toward degradation. ORMDL3 amplifies the K48-linked ubiquitination of RIG-I by disrupting the interaction between RIG-I and UPS10. Animal experiments showed that inhibiting ORMDL3 enhances anti-tumor activity, demonstrated by an augmented proportion of activated CD8+ T cells and increased interferon production within the tumor microenvironment (TME). Collectively, our results unveil the critical role of ORMDL3 in maintaining the homeostasis of antiviral innate immune responses and suggesting ORMDL3 as a candidate target for cancer immunotherapy.

Results

ORMDL3 negatively regulates RLR induced type I IFN signaling pathway

In order to investigate the potential role of ORMDL3 in the antiviral response, HEK293T cell overexpression ORMDL3 was stimulated with polyI:C or VSV infection. The result showed that ORMDL3 significantly inhibited polyI:C and VSV stimulated transcription of IFNB1 (Figure 1A). Western blots demonstrated a marked reduction in the phosphorylation level of IRF3 when ORMDL3 was overexpressed (Figure 1B). Ectopic expressed ORMDL3 in A549 cells attenuated IFNB1 expression induced by polyI:C but not polyG:C (Figure 1C). This phenomenon was also observed in parallel experiments using primary mouse BMDM cells (Figure 1D). These findings highlight ORMDL3 as a repressor of RNA-induced type I IFN expression. To unravel the molecular mechanism underlying the suppression of type I IFN signaling by ORMDL3, luciferase reporter assays were performed. ORMDL3 was found to decrease the luciferase reporter activity induced by RIG-I, while showing no effect on cGAS/STING or TRIF (Figure 1E). The ISRE luciferase reporter assay also showed similar result (Figure 1F). We constructed an ORMDL3 stable knockdown cell line of A549 to examine the role of ORMDL3 on viral replication. We found that ORMDL3 knockdown strikingly suppressed the replication of vesicular stomatitis virus (VSV), and overexpression ORMDL3 enhanced the replication of VSV (Figure 1G). We also infected the A549 stable knockdown cell line with herpes simplex virus-1 (HSV-1), and there is no significance between shNC and shORMDL3 cell lines (Figure 1H). These results suggest that ORMDL3 only facilitates RNA virus replication but not DNA virus, which coincides with the finding that ORMDL3 specifically represses RNA but not DNA induced type I interferon expression (Figure 1D).

Figure 1.

We next evaluated the influence of VSV, HSV-1 and RIG-I agonist SB9200 on ORMDL3 expression. Given the single nucleotide polymorphism (SNP) site rs7216389 at ORMDL3 locus is associated with the susceptibility of childhood asthma³⁸ and virus-induced respiratory wheezing illnesses ³⁹, we took the genotype of this SNP into account. Upon these stimulations, HSV-1 does not obviously alter the abundance of ORMDL3 (Figure S1A). For VSV and SB920, the expression of ORMDL3 is downregulated in some cell lines and is independent of the SNP (Figure S1B,S1C). Taken together, these results suggest that ORMDL3 is a negative regulator of RLR RNA sensing pathway, and its expression is reciprocally repressed by this pathway.

ORMDL3 regulates the protein abundance of RIG-I

Further RT-PCR results indicated that ectopic expression of ORMDL3 inhibited IFNB1 mRNA expression and transcription of downstream genes CCL5 and CXCL10 induced by RIG-I and MAVS but not TBK1 or IRF3-5D (Figure 2A,2B,S2A). Additionally, MDA5-induced IFN upregulation was also inhibited by ORMDL3 (Figure S2B). These results revealed that ORMDL3 negatively regulates RLR pathway. Owing to ORMDL3 was down-regulated in response to VSV stimulation in HEK293T, so we firstly transfected cells with siORMDL3 followed by secondary transfection with RIG-I-N (an active form of RIG-I) in HEK293T, and we found that siORMDL3 significantly increase the expression of IFNB1,CCL5 and ISG54 (Figure 2C) as well as the protein abundance of RIG-I (Figure 2D). Subsequent experiments involving various signaling proteins such as RIG-I (WT/N), MDA5, TBK1, and IRF3 indicated a negative correlation between ORMDL3 levels and RIG-I/RIG-I-N protein expression, with maximal degradation observed in RIG-I-N (Figure 2E). In addition, we also tested whether overexpressing mice Ormdl3 will also lead to mice Rig-i degradation, Interestingly we discovered that mice Rig-I and human RIG-I both can be degraded upon ORMDL3 overexpression, implying that ORMDL3’s function is conservative in human and mice (Figure S2C,D). In addition, ORMDL3 overexpression also eliminated endogenous RIG-I protein abundance (Figure S2E).

Figure 2.

Based on these obervations, we focus on the relationship between RIG-I and ORMDL3. We ectopically expressed an increasing amount of Flag-ORMDL3 with the RIG-I-N (harbors two CARD domains) and the RIG-I-C truncated form (Figure S2F), and found that ORMDL3 only decreased protein abundance of RIG-I-N (Figure 2F). We co-transfected ORMDL3 and RIG-I with or without polyI:C and found that RIG-I was degraded upon the stimulation of polyI:C, suggesting that ORMDL3 degrades RIG-I only when it was activated and the CARD domain was exposed (Figure 2G). Further examination showed that co-expression of ORMDL3 suppressed RIG-I-N induced expression of IFNB1 and CCL5, as well as pro-inflammatory cytokines IL-6 and TNF (Figure 2H), suggesting its role on both NF-κB and type I interferon pathways. Given the regulation of ORMDL3 on NF-κB has been reported, we focused on its role in the type I interferon pathway.

ORMDL3 promotes the proteasome degradation of RIG-I

Two major protein degradation pathways including the ubiquitin proteasome pathway and lysosoml proteolysis system. We next identified which degradation system dominantly mediates the degradation of RIG-I by ORMDL3. We co-expressed ORMDL3 and RIG-I and treated cells with proteasome inhibitor MG132, and lysosome inhibitor CQ. We found the degradation of RIG-I mediated by ORMDL3 could be blocked by proteasome inhibitor MG132 but not lysosome inhibitor CQ (Figure 3A). To rule out the possibility of transcriptional down-regulation of RIG-I, RT-PCR analysis was performed, confirming that the decrease in RIG-I protein was a post-transcriptional event (Figure S3A). To investigate the mechanism, we co-transfected RIG-I-N, ORMDL3 and plasmids encoding different form of ubiquitin. The results indicated an increase in K48-linked ubiquitin chains on RIG-I-N, implicating ORMDL3 in promoting proteasomal degradation of RIG-I (Figure 3B). To pinpoint the lysine residues crucial for RIG-I ubiquitination, we engineered a mutant version of RIG-I-N in which all lysines were mutated to arginines, denoted as RIG-I-N-KR. Intriguingly, the degradation-promoting effect of ORMDL3 on RIG-I-N-KR was nullified (Figure 3C). Given there are 18 lysine residues in RIG-I-N, we generated two mutants, mutant1 and mutant2, each mutating the last nine lysines and the first nine lysines (Figure S3B). Remarkably, the results showed that mutant1 was resistant to degradation by ORMDL3 (Figure 3D), suggesting that the last nine lysines on RIG-I-N mediated its degradation induced by ORMDL3.

Figure 3.

To delve deeper into the intricate mechanism of ORMDL3-induced degradation of RIG-I, we initially introduced single-point mutations, specifically K146R, K154R, K164R, and K172R ⁴⁰, which have been reported important for the function and stability of RIG-I. Co-transfection with ORMDL3 revealed that these individual mutations did not impede the degradation process, hinting at potential cooperation of lysine residues (Figure 3E). We then mutated all four lysine residues and assessed ORMDL3-induced RIG-I-N degradation. Strikingly, the RIG-I-N-4KR mutant, in which K146, K154, K164, and K172 were simultaneously mutated to arginines, displayed resistance to degradation by ORMDL3 (Figure 3F). At the meantime, the 4KR mutant failed to exhibit the upregulation of K48-linked ubiquitination induced by ORMDL3 overexpression, reinforcing the pivotal role played by K146, K154, K164 and K172 in mediating RIG-I ubiquitination and subsequent degradation (Figure 3G). In addition, we found that in mice primary BMDM when ORMDL3 was overexpressed, endogenous RIG-I was downregulated (Figure 3H).

ORMDL3 interacts with the signaling adaptor MAVS

Next, we sought to determine the binding partner of ORMDL3 in the type I interferon pathway. Co-immunoprecipitation(co-IP) and immunoblot analysis showed that only Flag-tagged MAVS interacted with ORMDL3-GFP (Figure 4A). To delineate the requisite domains of MAVS facilitating this interaction, various MAVS truncations were co-transfected with ORMDL3. Notably, deletion of the transmembrane domain (TM) of MAVS abrogated the interaction, while deletion of the caspase activation and recruitment domain (CARD) had no discernible impact (Figure 4B,S4A). It has been reported that ORMDL3 contains four TM segments (TM1−TM4) ⁴¹.

Figure 4.

To map the essential domains of ORMDL3 that mediate its association with MAVS, we generated different truncations of ORMDL3 based on the structure, which includes four truncations 1-42, 43-82, 83-118, 119-153 (Figure S4B). Intriguingly, we found that all these four ORMDL3 truncations interact with MAVS (Figure 4C) and impede RIG-I-N induced transcription of IFNB1 and ISGs (Figure 4D). In addition, co-transfection of RIG-I-N-Myc with individual ORMDL3 truncations showed that each domain of ORMDL3 is favorable to RIG-I-N degradation (Figure 4E). Moreover, inspired by Guo et al.’s discovery of a naturally occurring short isoform of ORMDL3⁴², we engineered N- and C-terminal truncations of ORMDL3 to mimic this isoform (Figure S4B), results revealing that both truncations retained the ability to interact with MAVS (Figure S4C). Luciferase assays and RT-PCR affirmed the inhibitory efficacy of each domain (Figure S4D, E). we also tested whether these different domains can promote the degradation of RIG-I-N, results revealed that every domain can amplify the degradation of RIG-I (Figure S4F). To further validate the association between ORMDL3 and MAVS, we did FRET experiment in Hela cells, we overexpressed YFP-MAVS(donor) and CFP-ORMDL3(acceptor), when we bleached YFP-MAVS, and we noticed that the fluorescence of CFP-ORMDL3 enhanced (Figure 4F).

USP10 deubiquitinates and stablizes RIG-I

To identify the E3 ligase or deubiquitinase involved in ORMDL3-mediated RIG-I ubiquitination, we conducted immunoprecipitation-mass spectrometry (IP-MS) analysis using Flag-ORMDL3 as bait and identified USP10 as a potential candidate (Figure 5A). Subsequent co-IP validation demonstrated the interaction between ORMDL3 and USP10 (Figure 5B), Subsequent co-IP experiment showed the interaction between USP10 and RIG-I (Figure 5C). Interestingly, we found that the RIG-I level is decreased in USP10 stable knockdown 293T cells while overexpression of USP10 promotes the accumulation of RIG-I (Figure 5D,5E). As USP10 is a deubiquitinase, we investigated its impact on RIG-I ubiquitination and observed a decrease in K48 ubiquitination of RIG-I upon USP10 overexpression (Figure 5F). Co-expression RIG-I-N or its 4KR mutant with USP10 showed that USP10 failed to increase the RIG-I-N-4KR level, underscoring the indispensability of these residues (Figure 5G). Upon overexpressing RIG-I-N and ORMDL3 in USP10 knockdown cells, ORMDL3’s ability to degrade RIG-I was markedly compromised, emphasizing the indispensable role of USP10 in this degradation process (Figure 5H). This further validates that ORMDL3 disturbs the USP10’s function on RIG-I.

Figure 5.

ORMDL3 disturbs USP10 induced RIG-I stabilization

Co-immunoprecipitation experiments unveiled robust interactions between USP10 and both RIG-I and ORMDL3, with ORMDL3 demonstrating the ability to disrupt the RIG-I-USP10 interaction (Figure 6A). Crucially, USP10 exhibited a specific role in stabilizing RIG-I, but not other innate proteins such as MAVS, MDA5 and IRF3, and this effect can be reversed by ORMDL3 (Figure 6B). Further investigations showed that the function of ORMDL3 in disturbing USP10-mediated RIG-I stabilization could be rescued by the proteasome inhibitor MG132 but not the lysosome inhibitor CQ (Figure 6C). Subsequent co-transfection experiments delineated that mutations affecting all lysines (KR) or the last nine lysines (mutant1) of RIG-I-N were necessary to prevent USP10-induced accumulation and ORMDL3-mediated degradation (Figure 6D). Notably, single-point mutation of the K146, K154, K164, and K172 residues on RIG-I-N does not affect the regulation of USP10 and ORMDL3 (Figure 6E), while the 4KR mutation abolished this process (Figure 6F). These findings underscored the importance of these four lysine residues in both ORMDL3-mediated degradation and USP10-stabilization of RIG-I. Building upon these observations, we sought to elucidate whether USP10 stabilizes RIG-I through these four sites. Co-expression of HA-K48Ub and RIG-I-N-GFP with or without USP10 revealed a decrease in K48 ubiquitination of RIG-I by USP10, while this effect was nullified in the presence of the 4KR mutant, consistent with ORMDL3-mediated regulation (Figure 6G). Additionally, we verified the functional consequences of USP10-induced RIG-I stabilization by assessing the mRNA levels of IFNB1, CCL5, and ISG54, which were increased upon enforced USP10 expression and reduced upon co-expression with ORMDL3 (Figure 6H).

Figure 6.

Knock down of ORMDL3 enhance anti-tumor immunity

To assess the impact of ORMDL3 on anti-tumor activity, we conducted knockdown experiments targeting ORMDL3 in LLC and MC38 murine cancer cell lines, followed by subcutaneous inoculation into C57BL/6 mice. Remarkably, the deficiency of ORMDL3 significantly suppressed LCC tumor growth and reduced the tumor formation rate compared to the control group (Figure 7A-C). This tumor growth inhibition by targeting ORMDL3 was further validated in the MC38 cancer model (Figure 7G-I). Moreover, both in LLC and MC38 knocked down cell lines, the protein level of RIG-I was significantly upregulated (Figure S5D-G), and this RIG-I upregulation was further verified by westernblots in LLC tumors (Figure S5C) and immunohistochemistry (IHC) in MC38 tumors (Figure 7K). Moreover, investigations revealed that in the LLC tumor model, the knockdown of ORMDL3 led to a significant increase in the expression of ISGs, including CCL5, CXCL10, TNF, and IL-6, compared to the control group (Figure 7D). This upregulation of ISGs upon ORMDL3 knockdown was consistent in the MC38 cancer model, where IFNB1, CCL5, and CXCL10 mRNA levels were significantly elevated (Figure 7J). Flow cytometry analysis demonstrated an increase in CD3⁺ T cell infiltration percentage in LLC tumors with ORMDL3 knockdown (Figure 7E). Notably, although CD8 T cell levels showed no significant change among groups (Figure S5A), activated CD8 T cells (CD8⁺ CD107a⁺ and CD8⁺ CD44⁺) exhibited a remarkable increase in the ORMDL3 knockdown group (Figure 7F,S5B). In addition, IHC assays revealed that more CD8 T cells were infiltrated in ORMDL3 knockdown MC38 tumors (Figure7K). Collectively, these findings suggest that inhibition of tumor-intrinsic ORMDL3 amplifies anti-tumor immunity by increasing ISG expression in the tumor microenvironment (TME) and promoting cytotoxic CD8⁺ T cell activation.

Figure 7.

We further analyzed ORMDL3 expression in the TCGA-pan-cancers cohort. We observed higher expression of ORMDL3 in lung adenocarcinoma (LUAD), colon adenocarcinoma (COAD), and lung squamous cell carcinoma (LUSC) compared to their corresponding normal samples (Figure S6A). In LUAD cohorts, high ORMDL3 expression was associated with poor prognosis, as indicated by overall survival (OS), progression-free survival (PFS), and disease-specific survival (DSS) analyses (Figure S6B-D). Analysis of LUAD cohorts also revealed enrichment of stromal scores in tumors with low ORMDL3 expression, Additionally, we found a negative correlation between ORMDL3 expression and the ESTIMATE score, indicating a potential association between ORMDL3 and immune cell infiltration (Figure S6E). Interestingly, ORMDL3 expression showed a negative correlation with CD8 T cell activation markers such as PRF1, GZMA, GZMB, as well as with ISGs such as CCL5 and CXCL10 (Figure S6F), validating our finding that ORMDL3 serves as a negative regulator of the IFN signaling pathway and anti-tumor immunity.

Discussion

The RIG-I MAVS pathway is essential for the early detection of viral infections and the initiation of an effective antiviral immune response, There are mainly two downstream signaling events of the RIG-I MAVS pathway including interferon signaling pathway and proinflammatory cytokine signaling pathway⁴³. During the process of producing type I interferons, MAVS recruit TBK1 amd then phosphorylate IRF3 and IRF7 and leading to the production of type I interferons.

And the pro-inflammatory cytokine signaling pathway mainly through the activation of NF-κB, resulting in the production of pro-inflammatory cytokines, such as IL-6,TNF etc⁴⁴. RIG-I’s activation is vital fo innate immunity, and its post-translational modification is important, for example,TRIM25,TRIM4, RNF135,RNF194, which facilitates RIG-I activation by mediating RIG-I’s K63-linked ubiquitination, meanwhile, there are also some E3 ligases mediate K48 ubiquitination of RIG-I, such as RNF125, RNF122, RNF55 and carboxyl terminus of HSC70-interacting protein (CHIP)⁴⁵, promote its degradation through ubiquitin proteasome pathway, thus attenuates cascade activation. Researchers found that some deubiquitylating enzymes also play an important role in mediating RIG-I activity, for example USP3,USP21 and CYLD,they regulate RIG-I activity by removing K63-linked polyubiquitin chains, In our study, we uncovered that USP10 stablize RIG-I by decreasing its K48 ubiquitination on lysine 146,154,164,172.

Research on ORMDL3 mainly focus on exploring its relationship with asthma and its exacerbations, initially,it was acknowledged that it is associated with rhinovirus infection, mechanism investigation recovered that ORMDL3 regulates intercullular adhesion molecule 1 (ICAM1) expression and regulates ceramide and sphingolipid metabolism³⁰. However, the effects of ORMDL3 proteins on human innate immunity have rarely been reported. In our study, we found that the mRNA level of IFNB1 and ISGs was severely impaired in ORMDL3-overexpressing cells in response to viral infection (Figure 1A) and significantly increased when ORMDL3 was knocked down and co-express with RIG-I-N (Figure 2C). These data confirmed that ORMDL3 acts as a negative regulator of antiviral innate immune responses. ORMDL3 is a multiple transmembrane structural protein located in the center of the SPT complex, serving to stabilize the SPT assembly⁴¹. Co-IP experiments showed that the ER protein ORMDL3 interacts with mitochondrial protein MAVS, suggesting that there may exist scaffold protein to mediate their interaction. ORMDL3 is reported to associate with calcium transportation^46,47, in the meantime the calcium transfer between ER and mitochondria plays an important role in protein synthesis, so perhaps some ERMCs proteins mediate the interaction between ORMDL3 and MAVS. Furthermore, We discovered that the deubiquitinating enzyme USP10 stabilizes RIG-I and ORMDL3 disturbs this process to negatively regulates IFN production. When USP10 was knockdown, ORMDL3 overexpression could not facilitate RIG-I-N degradation anymore, suggesting that USP10 plays an indispensable role in ORMDL3 mediating RIG-I degradation.

Collectively, we identified ORMDL3 as a negative regulator of type I interferon pathway and anti-cancer immunity. The working model is that ORMDL3 forms a complex with MAVS and promotes the degradation of RIG-I thus attenuating the transcription of type I IFN, In addition, constraining ORMDL3 can enhance IFN signaling and the proportion of cytotoxic CD8 T cell (Figure 7). The negative regulatory loop of antiviral innate immunity and anti-tumor activity involving ORMDL3 could offer insights that contribute to the development of therapeutics targeting viral infections and tumors.

Materials and Methods

Cell lines

HEK293T cell lines (from embryonic kidney of female human fetus), were cultured at 37°C under 5% CO2 in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum (ExCell, FSP500), and A549 cell lines (from lung of a 58 years old male human) were cultured in Roswell Park Memorial Institute (RPMI) 1640 medium. LLC and MC38, HCT15, DLD1, SW480, SW620 cell lines were obtained from American Type Culture Collection (ATCC) cultured in Roswell Park Memorial Institute (RPMI) 1640 medium. The cell lines used in this study have been authenticated. Mycoplasma contamination was routinely checked by PCR analysis and eliminated by treatment with PlasmocinTM (ant-mpt). The primers were as follows: Myco forward 5’-GGGAGCAAACAGGATTAGATACCCT-3’; Myco reverse 5’-GCACCATCTGTCACTCTGTTAACCTC-3’.

Viruses

VSV-GFP was provided by Prof. Rongfu Wang (Zhongshan School of Medicine, Sun Yat-sen University, China) and amplified in Vero cells. HSV-1-GFP was provided by Prof. Musheng Zeng (Sun Yat-sen University Cancer Center, China) and amplified in Vero cells. Cell lines were infected with VSV (0.01 MOI), HSV-1 (0.1MOI) for various times, as indicated in the Figures.

Plasmid and transfection

Expression plasmids for RIG-I, MDA5, MAVS, TBK1, TRIF, IKKɛ IRF3 and IFN-β-luc,ISRE-luc were provided by Prof. Xin Ye (Microbiology, Chinese Academy of Sciences). Plasmid encoding ORMDL3 was cloned in pCMV-HA/pCMV-Myc/Pcmv-flag vector, and ORMDL3 truncations ORMDL3(1-42), ORMDL3(43-82), ORMDL3(83-118) and ORMDL3(119-153) were constructed into the pEGFP-N1 vector (CLONTECH Laboratories). USP10 was obtained from prof. Tan (Sun Yat-sen University Cancer Center), and cloned into pCMV-Myc vector. For transfection of plasmids, polyI:C and polyG:C (InvivoGen) used in this study into HEK293T, A549 and BMDM cells, DNA Transfection Reagent B35101 (Bimake), PEI MW40000, pH 7.1 (Yeasen Biotechnology), Lipofectamine 2000 (ThermoFisher Scientific) or Lipofectamine 3000 (ThermoFisher Scientific) RNAimax (ThermoFisher Scientific) were used according to the manufacturer’s protocol.

Flow cytometry

Single-cell suspensions were prepared from the tumor tissues of mice, Tumor tissues were cut into small pieces and washed with PBS containing 2% FBS. The tumors were digested in 15 ml RPMI supplemented with 2% FBS, 50 U/ml Collagenase Type IV(Invitrogen, California, USA), 20 U/ml DNase (Roche, Indianapolis, IN) and incubated at 37 °C for 30min to 1 h while gently shaking. Digested tumors were then filtered through a 70 µm strainer after washed three times with PBS. Spleens were mechanically dissociated with a gentle MACS dissociator in RPMI-1640 medium supplemented with 2% FBS. Dissociated spleens were passed through a 70 µm strainer and washed three times with PBS. Red blood cells were lysed for 3 to 5 min with ACK lysis buffer and then washed with PBS containing 2% FBS. Single cells were stained with the appropriate antibodies to surface markers at 4°C for 30 minutes in the dark.The following fluorescent dye-labeled antibodies purchased from BD Biosciences, Biolegend or Invitrogen were used in this study: CD3ε-APC (145-2C11), CD4-Pacific blue (GK1.5), CD8-PE-cy7 (KT15), CD45-APC-cy7 (30-F11), CD44-FITC (IM7), CD107a-PE (1D4B). All flow cytometric data were collected on BD Fortessa X20 (BD Biosciences, San Jose, CA) and performed using Flow-Jo analysis software v10.4.while LLC tumor tissue is grinded into single cell suspension and treat as above described.

Tumor models

1×10⁶ LLC tumor cells were implanted s.c. into the flanks of mice. 8×10⁵ MC38 were implanted the same as LLC tumors, after the tumor was established, measure the volume of tumor once every two days.

Mass spectrometry and coimmunoprecipitation

1×10⁷ HEK293T cells transfected with flag-vector or flag-ORMDL3 were prepared by washing with cold PBS and then lysed with 1× lysis buffer (Cell Signaling Technology) and incubated on ice for 30 minutes. Supernatants were collected and immunoprecipitated with the indicated antibodies for 4 h at 4 °C, recovered by adding protein A/G Sepharose Beads (Santa Cruz Biotechnology, CA, USA, #sc-2002) overnight. After incubation, beads were washed with wash buffer and immersed in PBS then subjected to mass spectrometry. Immunoblot assays were performed with specific antibodies to identify the proteins interacting with ORMDL3. The following antibodies were used for Co-IP or immunoblot assay: ORMDL3 (abcam,107639) (abcam 211522) myc (60003-2-Ig) HA (RM1004) HA (Ray antibody) GFP (Proteintech 66002-1-Ig) and Flag (Sigma, St. Louis, USA, #F1804).

Dual-luciferase reporter assay

Cells were transfected with plasmids encoding IFN-β or ISRE luciferase reporter and RIG-I(N), MDA5, MAVS, TBK1, IRF3-5D together with pRL-TK and the plasmids encoding ORMDL3. Cells were collected and lysed 24 h post-transfection. Subsequently, the luciferase activities were measured using a Dual-luciferase Reporter Assay System (Promega, Madison, USA, #E1910). Normalization of data by the ratio of firefly luciferase activity to renal luciferase activity. Each group was measured in triplicate.

RNAi

All the siRNA oligonucleotides containing 3′dTdToverhanging sequences were chemically synthesized in genepharma (Suzhou, China) and transfected into cells using Lipofectamine ™ RNAiMAX Transfection Reagent (Thermo Fisher).The siRNAs corresponding to the target sequences were synthesized in RIBOBIO (Guangzhou, China). In this study, the siRNAs sequences were designed as follows: ORMDL3 si #1, 5′-GCAUCUGGCUCUCCUACGUTTdTdT 3′; ORMDL3si #2, 5′ - GGCAAGGCGAGGCUGCUAATTdTdT 3′; ORMDL3 si #3, 5′-CCCUGAUGAGCGUGCUUAUTTdTdT 3′. For transfection of siRNAs used in this study into HEK293T cells, Transfection Reagent Lipofectamine RNAiMAX (ThermoFisher Scientific) was used according to the manufacturer’s protocol.

RNA extraction and quantitative real-time PCR

Total RNA from cells was extracted with Trizol reagent (Vazyme R711) according to the manufacturer’s instructions. The quantity and quality of RNA were measured by Nanodrop.cDNA was synthesized using the StarScript Ⅲ All in one RT Mix with gDNA remover(Genstar). Quantitative real-time PCR was performed in a 96 well format or 384-well format on a Real-Time PCR Detection System (Bio-Rad) 2x Real Star Fast SYBR Qpcr Mix (Genstar). Relative quantification was performed with the 2^(-ΔΔCT) method using 18S (for human cells) or Actb (β-Actin, for mouse cells) for normalization. The Specific qRT-PCR primers are listed in Supplementary Table 1.

Quantitative RT-PCR

Total RNA was extracted with Trizol reagent (Thermo Fisher Scientific) according to the manufacturer’s instruction. Reverse-transcription products of samples were amplified by the One-step gDNA Removal and cDNA Synthesis kit (TransGen Biotech) using the SYBR Green SuperMix (Bio-Rad). Primers used for RT-PCR assays are listed in Table S1. All target gene expression was normalized to the control gene encoding GAPDH in each individual sample and the 2-DDCt method was used to calculate relative expression changes.

Establishment of overexpressed stable cells and knock down cell lines

ORMDL3 cDNA was constructed into the pCDH-CMV-MCS-EF1 vector. A549 and HEK293T cells which stably overexpress plasmid encoding ORMDL3 were generated by lentivirus-mediated gene transfer. HEK293T cells were co-transfected with lentiviral expressing plasmid, lentiviral packaging plasmid psPAX2 (Addgene, Cat#12260) and VSV-G envelope expressing plasmid pMD2.g (Addgene, Cat#12259). After 48 hours, the lentiviruses were used for infecting A549 cells and then selected cells with puromycin (ThermoFisher Scientific). Human ORMDL3 knockdown cell line:shORMDL3 −1 and shORMDL3-2.Human USP10 knockdown cell line: shUSP10-1 and shUSP10-2, shUSP10-3.Mice Ormdl3 knockdown cell line shOrmdl3-1 and shOrmdl3-2.annealing oligos were ligated into PLKO.1 vector and after virus package infected target cell and then selected with puromycin. the shRNA sequences are listed as follows. shORMDL3-1: CCGGCCCACAGAATGTGATAGTAATCTCGAGATTACTATCACATTCTGTGGGTTTTTG; shORMDL3-2: CCGGCATGGGCATGTATATCTTCCTCTCGAGAGGAAGATATACATGCCCATGTTTTTG; shUSP10-1: CCGGCCTATGTGGAAACTAAGTATTCTCGAGAATACTTAGTTTCCACATAGGTTTTTG; shUSP10-2: CCGGCCCATGATAGACAGCTTTGTTCTCGAGAACAAAGCTGTCTATCATGGGTTTTTG; shUSP10-3: CCGGCGACAAGCTCTTGGAGATAAACTCGAGTTTATCTCCAAGAGCTTGTCGTTTTTG; shOrmdl3-1: CCGGCCAAGTATGACCAAGTCCATTCTCGAGAATGGACTTGGTCATACTTGGTTTTTG; shOrmdl3-2: CCGGGCCGACTTGGAGTAGCTTGTACTCGAGTACAAGCTACTCCAAGTCGGCTTTTTG.

BMDMs

Macrophages were differentiated from the bone marrow of wild-type (WT) C57BL/6 mice All bone marrow cells were flushed out and filtered through a 70-µm cell strainer. After centrifugation, red blood cells were lysed. The resultant bone marrow cells were resuspended in RPMI 1640 (Gibco) supplemented with 10% FBS (Gibco), 1% penicillin/streptomycin (Gibco), and 50 μM 2-mercaptoethanol (Sigma) in the presence of 20 ng /ml macrophage colony-stimulating factor (M-CSF; PeproTech) for 7 d. and mature BMDMs were stimulated with indicated stimulation polyI:C or polyG:C.

AAV virus production

All AAV vectors were produced in HEK293 cells via the triple plasmid transient transfection methods as pAdltea:Paav2/1:target gene=750ng:450ng:375ng. For small-scale preps, HEK293T cells were seeded in 10-cm dishes and grown to 80% confluence in Dulbecco’s modified Eagle’s medium (DMEM) containing 10% fetal bovine serum (FBS) (Gibco, 26140079) and 1% PenStrep (Thermo FisherScientific, 15140122). Cells were then triple transfected with the vector pscAAV-CAG-GFP (Addgene, 83279) or pscAAV-CAG-Ormdl3, AAV1 Rep/Cap (Addgene, 112862), and Ad helper plasmid (pAddelta F6 from Addgene, 112867) at a ratio of 1:1.2:2 (3.75:4.5:7.5 μg per 10-cm dish) using PEI MW40000, pH 7.1 (Yeasen Biotechnology, 40816ES03 at a ratio 4:1 of PEI/total DNA. Cells were harvested 3 days post transfection by scraping cells off the plate in their conditioned medium and lysing cells through 3× freeze-thaw cycles between 37°C and - 180°C. Preps from three replicate plates were then pooled, incubated with 25 U/mL of benzonase (Millipore Sigma, 20 E8263-25KU) at 37°C for 1 h to remove plasmid and cell DNA, centrifuged at 4°C and 1 4,000 × g for 30 min, and the supernatant filtered through a 0.22-μm polyethersulfone (PES) bottle-top filter (Corning, 431097). The filtered lysate was Purificated by iodixanol gradient ultracentrifugation. For AAV collection, the fractions obtained from the 40% phase were analyzed by measuring absorbance at 20-fold dilution at 340 nm to identify the main contaminating protein peak, as previously described. For ultrafiltration/concentrated AAV, 0.001% Pluronic F68 +200mM NaCl PBS was added to the pool to reach a total volume of 15 ml, using Amicon Ultra-15 centrifugal filter units (MWCO, 100 kDa; Merck Millipore). After concentration to a minimum of 500 µl, the product was aliquoted and stored at −80°C.

AAV titration

Prepare a plasmid stock of 2×10 molecules/μl to generate a standard curve, and then treat the puri¦ed AAV samples with DNase I to eliminate any contaminating plasmid DNA carried over from the production process (DNase does not penetrate the virion). Make 6 serial dilutions of reference sample and DNase-treated and AAV samples and detect with RT-QPCR. And then Perform data analysis using the instrument’s software. Determine the physical titer of samples (viral genomes (vg)/mL) based on the standard curve and the sample dilutions.

Immunofluorescence labeling and confocal microscopy For FRET assay

YFP-MAVS and CFP-ORMDL3 expressing plasmids were co-transfected into HeLa cells and incubated for 24h. Cells were fixed with 4% paraformaldehyde for 30 min, Images were observed on laser confocal fluorescence microscopy (Zeiss, LSM880), we bleached YFP-MAVS and measured the MFI of YFP-MAVS and CFP-ORMDL3.

Co-immunoprecipitation and immunoblot analysis

For immunoprecipitation (IP) experiments, cells were lysed with lysis buffer (Cell Signaling Technology) supplemented with protease inhibitor for 30 min. After centrifugation at 4°C, 12,000 rpm for 10 min, supernatants were collected and incubated with appropriate antibodies for 4 h and protein G beads (Santa Cruz Biotechnology) overnight. Thereafter, the beads were washed four times with cold PBS, followed by SDS-PAGE and immunoblot analysis. For immunoblot analysis, cells or tissues were lysed with RIPA buffer (Cell Signaling Technology). Protein concentrations were measured with Bradford Protein Assay Kit (Beyotime), and equal amounts of lysates were used for SDS-PAGE. The samples were eluted with SDS loading buffer by boiling for 10 min and then performed SAS-PAGE. The proteins were transferred onto PVDF membrane (Roche), and immunoblot analysis was performed with appropriated primary antibodies at 4°C overnight (Geng et al., 2017) and horseradish peroxidase (HRP) conjugated secondary anti-mouse or anti-rabbit antibodies for 1 h at room temperature. ChemiDoc Touch (Bio-Rad) achieved visualization.

Statistical analysis

The data were analyzed with GraphPad Prism 5. For two independent groups, the student’s t test was used to determin statistical significance. Statistical details for individual experiments can be found in the Figure legends. Statistical significance was two-tailed and p < 0.05 is considered statistically significant P values are indicated by asterisks in the Figures as follows: *p < 0.05, **p < 0.01, ***p < 0.001, and n.s. indicates non-significant.

Acknowledgements

This project was supported by grants from the Guangdong Basic and Applied Basic Research Foundation (2022A1515011930) and the National Natural Science Foundation of China (82273045).

Author Contribution

Q.Z performed most of the experiments and analyses. C.Y and Q.Z performed the mouse experiments. S.C conceived the study. C.S, S.Z, Y.M, J.W and Z.W provided technical assistance. S.C and Q.Z wrote the manuscript.

Data Availability Statement

Raw data that support the findings of this study has been deposited in Research Data Deposit database (http://www.researchdata.org.cn) with the Approval Number available upon acceptance of the manuscript. Any reasonable requests for this study are available from the corresponding author.

Disclosure and competing interests statement

The authors declare no competing interests.

Supplementary materials

This supplementary materials includes

• 1) Seven supplementary Figures

• 2) One supplementary Table

Supplementary Figure 1.

Supplementary Figure 2.

Supplementary Figure 3.

Supplementary Figure 4.

Supplementary Figure 5.

Supplementary Figure 6.

Supplementary Figure 7.

Supplementary Table 1.