Abstract
The blood-brain barrier (BBB) protects the brain from circulating metabolites and plays central roles in neurological diseases. Endothelial cells (ECs) of the BBB are enwrapped by mural cells including pericytes and vascular smooth muscle cells (vSMCs) that regulate angiogenesis, vessel stability and barrier function. To explore mural cell control of the BBB, we investigated neurovascular phenotypes in zebrafish pdgfrb mutants that lack brain pericytes and vSMCs. As expected, mutants showed an altered cerebrovascular network with mis-patterned capillaries. Unexpectedly, mutants displayed no BBB leakage from larval through to young adult stages. This demonstrates that pericytes and vSMCs do not control BBB function in young zebrafish. Instead, we observed adult BBB disruption occurring at "hotspot" focal haemorrhages at major vessel aneurysms. ECs at leakage hotspots showed induction of caveolae on abluminal surfaces and major structural defects including basement membrane thickening and disruption. Our work suggests that capillary pericytes regulate cerebrovascular patterning in development and vSMCs of major arteries protect from haemorrhage and BBB breakdown in older zebrafish. The fact that young zebrafish can have a conserved BBB with intact barrier function in the absence of mural cells, warrants renewed interrogation of the paradigm of mural cell control of the BBB.
Main text
Neurovascular endothelial cells (ECs) have unique functional and structural properties to regulate substance exchange between blood and brain, establishing the blood-brain barrier (BBB)1,2. Loss of normal BBB function is associated with neuropathological states, including neurodegeneration, infection and cancer1,2. Mural cells are vascular support cells that include pericytes and vascular smooth muscle cells (vSMCs) and control vascular development, function and BBB permeability3–9. PDGFB/PDGFRβ signalling is required for the development of mural cells3,4,10–12 and their depletion in PdgfB or Pdgfrβ deficient rodents causes altered angiogenesis, aneurysm and vessel leakiness3–6,13. Strikingly, rodent models of pericyte loss have an open BBB, with free transport of tracer dyes from the blood stream into the brain parenchyma but an otherwise intact vasculature5,6. These and other observations, have led to a current model whereby pericytes control BBB function by suppressing EC adsorptive transcytosis. This prominent mechanism holds significant translational promise to safely open up the BBB in therapeutic settings, by discovering ways to disrupt pericyte control of ECs5,14.
Zebrafish have a highly conserved BBB15–19 with the brain endothelium expressing conserved molecular markers of a functional BBB18 and showing conserved cellular interactions with pericytes, smooth muscle cells and glial cells20,21. The zebrafish BBB becomes functional by 5 days post fertilisation (dpf)19 and as in mice, pdgfrb mutants lack brain pericytes and exhibit loss of vSMCs13,20. Thus, the zebrafish is accepted as a highly accessible model to study BBB function and mural cell control of the BBB17. To investigate the influence of mural cells upon the neurovasculature, we generated a pdgfrb mutant (pdgfrbuq30bh), which possesses an early deletion leading to a frameshift, predicted to cause a premature stop codon and a putative null allele. Using the TgBAC(pdgfrb:egfp)ncv22 line, we observed that pericytes were lost in the cerebral central arteries of pdgfrb mutants (Fig. 1a), as in previous studies13,20. To assess how brain angiogenesis occurs without pericytes, we imaged, traced and quantified blood vessel branching from the middle mesencephalic central arteries in the midbrain (Fig. 1a-c; Extended Data Fig. 1a). At 7 dpf, mutants displayed significantly reduced vascular complexity compared to siblings, with reduced vessel length and branch points (Fig. 1d-e). This was more severe at 14 dpf, demonstrating the phenotype is progressive (Fig. 1d-e). Timecourse imaging revealed the reduction in vascular complexity was apparent from 5 dpf (Extended Data Fig. 1a-b). These results suggest that pericytes (the vSMCs only begin to develop after 5 dpf22) regulate angiogenesis from early in larval development.

Pericyte-deficient larval brain vasculature displays abnormal patterning but an intact blood-brain barrier
a, Confocal projections of pericytes (TgBAC(pdgfrb:egfp)ncv22) and brain vasculature (Tg(kdrl:Hsa.HRAS-mCherry)s843) in sibling and pdgfrbuq30bh mutants at 7 dpf.
a′, Zoomed section from a (dashed rectangle) showing the midbrain central arteries.
b, Midbrain central arteries in sibling and pdgfrbuq30bh mutants at 14 dpf.
c, Representative images of vascular tracing at 7 dpf using Imaris 10.1 software. Lumenized blood vessels branching from the middle mesencephalic central arteries in the midbrain were traced.
d,e, Quantification of midbrain vessel length (d) and branching points (e). N=8 per group, unpaired t-test, *P<0.05, **P<0.01.
f, Fluorescent tracer assays in the midbrain of zebrafish larvae. 10 kDa Dextran–Cascade Blue and 70 kDa Dextran–Fluorescein were used to detect tracer extravasation to the brain parenchyma (white squares) in separate experiments and were coinjected with 2000 kDa Dextran–Tetramethylrhodamine to normalize vascular tracer intensity. Representative image of 2000 kDa Dextran was taken from 70 kDa Dextran coinjection, and 10 kDa Dextran coinjection is shown in Extended Data Fig. 1.
g, Quantification of brain parenchymal 70 kDa and 10 kDa Dextran intensity normalized to the vascular 2000 kDa Dextran intensity. N=15 in sibling and n=7 in pdgfrbuq30bh for 70 kDa Dextran intensity, n=8 in sibling, n=9 in pdgfrbuq30bh for 10 kDa Dextran intensity. Unpaired t-test, ns=not significant.
a,a′, b, c, f, Scale bars: 100 μm.
We next tested BBB function in mutants at 7 and 14 dpf. We performed intravenous injection of fluorescently conjugated tracers of various molecular weights (1 kDa NHS, 10 kDa and 70 kDa Dextran), and live imaged fish at 2 hours after injection (as in 19) (Fig. 1f; Extended Data Fig, 1c). 2000 kDa Dextran was coinjected to normalize quantification of vascular tracer dye delivery (see methods for details). We found no evidence of 10 kDa or 70 kDa Dextran tracer extravasation into the brain parenchyma of pdgfrbuq30bhmutants at either timepoint (Fig. 1g; Extended Data Fig. 1c-e). 1 kDa tracer showed no difference between genotypes but was observable in the parenchyma in both sibling and mutants, indicating the smaller cargo can pass the BBB (Extended Data Fig. 1c & e). Together, these results show that neither pericytes nor vSMCs play a role in establishment of BBB function in larval zebrafish.
To investigate how mural cells control cerebral vasculature at later stages of life, we tissue-cleared brains of adult stage pdgfrbuq30bhmutants and siblings23 and performed whole brain imaging. We confirmed loss of pericytes and vSMCs at this stage (Fig. 2a). We examined a consistent region of the left optic tectum (mid brain) and detected decreased branching of capillaries and increased diameter of major vessels (Fig. 1b-d). This vessel dilation was restricted to larger calibre arteries that would normally be invested with vSMCs and not seen in capillaries (Fig. 1c-d). This suggests vessel dilation in mutants is due to loss of vSMCs and reduced branching of capillaries to loss of pericytes.

pdgfrbuq30bh mutants develop aneurysms but display an intact blood-brain barrier at 2 months of age.
a, Confocal projections of whole brain imaging showing mural cells (TgBAC(pdgfrb:egfp)ncv22) and brain vasculature (Tg(kdrl:Hsa.HRAS-mCherry)s843) in sibling and pdgfrbuq30bh mutants at 5-months of age.
b, Restricted regions from the whole brain imaging in a (approximate location of dotted line) indicating pericyte loss and abnormal capillary network patterning. 100-µm thick maximum intensity projections (MIP) were generated using the continuation of the left middle mesencephalic central artery (arrow) as an anatomical anchor point.
c, d, Quantification of capillary branching points, large vessel and capillary diameter using the area shown in b. Large vessel diameter was quantified by averaging 5 points per vessel and the capillary diameter was quantified by averaging 10 capillary diameter per sample. N=3 per group, unpaired t-test, **P<0.01, ns=not significant.
e, Fluorescent tracer assays in the midbrain of 2-month-old zebrafish. 70 kDa Dextran– Fluorescein and 2000 kDa Dextran–Tetramethylrhodamine were co-injected to detect the tracer extravasation to the brain parenchyma and the tracer within the vasculature, respectively. Arrowheads indicate examples of aneurysms.
e′, Confocal projections zoomed in on the approximate area shown in e (dashed rectangle). 30-µm thick MIPs were generated to examine the capillary leakage, starting 30 µm below the most superficial point of the left hemisphere of the brain to prevent the potential leakage from the superficial vessels.
f, Quantification of the severity of aneurysms in sibling (n=11) or pdgfrbuq30bh(n=11). For examples of "severe" and "mild" see Extended Data Fig. 2.
g, Quantification of the brain parenchymal 70 kDa Dextran intensity normalized to the vascular 2000 kDa Dextran intensity, n=5 in sibling, n=4 in pdgfrbuq30bh mutants, unpaired t-test, ns=not significant.
a, b, e, e′, Scale bars: 250 μm.
We assessed BBB function in juvenile 2-month-old zebrafish by intravenous tracer injection (as in 24) and using a mixture of 70- and 2000 kDa Dextran. We euthanized fish 2 hours post-injection and tissue-cleared the brains. The whole brain imaging revealed that mutants displayed widespread aneurysm of major vessels (Fig. 2e-f, Extended Data Fig. 2a-a′). To quantify potential BBB leakage, we imaged a consistent region with high capillary density (Fig. 2e′), and quantified parenchymal 70 kDa Dextran intensity relative to vascular 2000 kDa Dextran intensity. Both tracers remained restricted to the vascular lumen regardless of the severity of the aneurysms (Fig. 2g). This correlates with our findings at larval stages and demonstrated that mural cells are dispensable for the establishment and early maturation of the BBB in zebrafish up to 2 months of age.
To investigate BBB integrity at later stages, we injected 3-month-old adult zebrafish with 10 or 70 kDa Dextran. Brightfield imaging of vibratome sectioned brains revealed severe aneurysms across large calibre vessels (Fig. 3a) with blood pooling that was potentially consistent with vessel ruptures (Fig. 3c). Furthermore, we detected parenchymal accumulation of tracer dye closely associated with large calibre vessel aneurysms (Fig. 3b-c; Extended Data Fig. 3a-á). To quantify the distribution of parenchymal tracer dye from deep (around major artery aneurysms) to superficial (in capillary beds) brain regions, we measured fluorescence intensity in 10 brain regions 100 microns apart from medial to lateral locations. This demonstrated accumulation of tracer dye in medial regions associated with aneurysm in mutants, with no evidence of major leakage in capillary beds (Fig. 3d-e). To better understand the extravasated tracer accumulation, we conducted whole brain imaging after 70 kDa Dextran injection. Interestingly, we observed highly localised tracer accumulated in regions that could be considered leakage "hotspots" at large calibre vessel aneurysms (Fig. 4a; Extended Data Fig. 4a; Supplementary Videos 1 and 2). Quantification of three independent whole cleared brains throughout the optic tecta revealed on average 11 hotspots occurring at major vessels in each mutant animal (Fig. 4b). To further understand the nature of these hotspots, we examined red blood cells in pdgfrb mutant adults (Crispants, validated in Extended Data Fig. 4b) using the Tg(gata1:DsRed)sd2 transgenic line together with tracer injection. These animals showed that tracer accumulation occurred concomitant with extravasated red blood cells at hotspots, identifying them as focal haemorrhages (Fig. 4c). Notably, these sites were not detected at capillaries (Fig. 4d). Taken together, this shows that in older mutants, loss of BBB integrity is associated with focal haemorrhage along aneurysmal vessels.

Adult pdgfrbuq30bh mutants display aneurysms and vascular integrity defects.
a, Representative images of coronal midbrain sections obtained from 3 month-old sibling and pdgfrbuq30bh animals.
b, Fluorescent tracer assays in 3-month-old sibling and pdgfrbuq30bhmutant animals. 10 kDa Dextran–Cascade Blue (cyan) was retro-orbitally injected, and Tg(kdrl:Hsa.HRAS-mCherry)s843 was used to label the blood vessels (magenta). Scale bar: 250 μm.
c, Zoomed regions from a and b (dotted squares) displaying blood and tracer accumulation (arrows).
d, Zoomed regions from b (dashed rectangle) displaying vasculature and tracer dye leakage from medial (large vessel) to lateral (capillary region) locations. The area was divided into 10 regions every 100 µm for tracer leakage quantification.
e, Quantification of brain parenchymal dextran intensity at medial (large vessel) to lateral (capillary region) locations shown in d. N=5 in sibling, n=4 in pdgfrbuq30bh, Two-sample Kolmogorov-Smirnov test, error bars represent SEM.

Adult pdgfrb mutants display structural endothelial cell defects, vessel rupture and tracer accumulation at aneurysm hotspots.
a, Sections from whole brain imaging showing brain vasculature (Tg(kdrl:Hsa.HRAS-mCherry)s843) and 70 kDa Dextran Fluorescein at 5-months of age. Inset images within dashed rectangle show areas of hot spot leakage sites (arrows).
b, Quantification of hotspot leakage sites per animal in the midbrain region. N=3 for each group, unpaired t-test, ***P<0.01.
c, d, High resolution imaging of large calibre vessels and capillary zones in brain regions of pdgfrb crispants and uninjected siblings at 10-week-old stage. 10 kDa Dextran–Cascade Blue (cyan) injected, blood vessels (Tg(kdrl:EGFP)s843) and red blood cells (Tg(gata1:DsRed)sd2) are shown in MIPs and single Z-sections (c). Hotspot leakage sites are indicated by arrows. Capillary zones are shown in MIPs for all three channels and the single 10 kDa Dextran channel showing a lack of hotspot leakage site (d).
e, Transmission electron microscopy images of sectioned adult zebrafish brain vessels. pdgfrbuq30bh mutants showed basement membrane thickening and breakdown (cyan, black arrow), serum accumulation outside the vessels (white arrow), increased abluminal endothelial caveolae (magenta). Pseudo colours shown are ECs (purple), basement membrane (cyan), caveolae (magenta) and vesicles larger than 100 nm (green). Scale bars: 2 µm.
f, Zoomed regions from (e) showing intact tight junctions (arrowheads) in both siblings and pdgfrbuq30bh mutants. Scale bar: 1 µm.
g, Quantification of endothelial caveolae and basement membrane thickness. Caveolae were defined as uncoated spherical profiles <100 nm in diameter and scored as luminal or abluminal (see methods). Measurements were made for n=3 vessels for each group and a total of 8 different cellular regions measured for siblings and 19 for mutants. Basement membrane thickness was scored in 6 different regions per vessel with n=8 vessels in siblings and n=4 vessels in pdgfrbuq30bh mutants. Unpaired t-test, ***P<0.001, ****P<0.0001, ns= not significant.
Pericytes are proposed to regulate the BBB by suppressing adsorptive transcytosis through brain capillary ECs5,6. This model is built on the observation by electron microscopy of the induction of caveolae in leaky pericyte deficient vessels5,6. To investigate if the loss of BBB integrity is associated with ultrastructural changes, we performed electron microscopy. We imaged large calibre vessels and capillaries (Fig. 4e; Extended Data Fig. 4c) and examined cellular junctions, basement membrane and caveolae (defined as uncoated vesicular profiles of <100nm diameter). While tight junctions between endothelial cells remained intact (Fig. 4f), Caveola density along the large vessel aneurysms in pdgfrbuq30bh mutants was significantly increased. This increase was almost exclusive to the abluminal side of the ECs (Fig. 4g). This abluminal accumulation of caveolae may be more associated with changes in the mechanical state of ECs (as caveolae are highly regulated by membrane tension25,26) than changes in intracellular transport. Furthermore, we detected thickening of basement membrane (BM) (Fig. 4g), gaps in the BM and fluid accumulation outside the vessel wall at aneurysms in mutants. We found no obvious difference in the caveolae density of capillary ECs of pdgfrbuq30bh mutants compared with siblings (Extended Data Fig. 4d). Thus, leakage hotspots at aneurysms are associated with a failure of the normal flattening of ECs, caveola induction and disruption of the BM, all factors that could contribute to or be observed concurrent with vessel wall rupture.
Brain vasculature is endowed with mural cells that control vascular development and stability3,4,13,27. Studies in rodents have shown that pericytes regulate BBB integrity5,6. This is currently thought to be caused by hotspots of increased EC transcytosis14, rather than mechanisms such as altered cell-cell adhesion (eg, Cldn514), control of Mfsd2a19,28, Netrin1- Unc5B signalling29 or vitronectin regulation of integrin receptors30. However, some studies in rodents have reported loss of pericytes without vessel leakage31. We show mural cells are involved in cerebrovascular patterning in larval, juvenile and young adult animals but these vessels maintain BBB function in the absence of mural cells. In our mutants, major arteries progressively harbour aneurysms. This aneurysm is likely associated with loss of vSMCs13. At later stages, adult mutants show leakage at hotspots distributed along aneurysms, which are focal haemorrhages. In some PDGFB/PDGFRβ mouse mutants, haemorrhages have been reported, but not in mild or hypomorphic mutants such as those used in BBB studies3,4,12. In our model, BBB leakage appears to only be observed once haemorrhage is present. Of course, these observations could represent a species-specific divergence from the mammalian BBB. However, the zebrafish BBB appears highly conserved with that of mammals17 and we would argue that the importance of BBB function for vertebrate brain physiology throughout evolution makes divergence unlikely. We suggest that a deeper analysis of the nature of hotspot leakage in mural cell deficient mammalian models is warranted. Altogether, a deeper understanding of the fundamental biology of the BBB will pave the way for increasingly sophisticated efforts to target the BBB in disease in the future.
Acknowledgements
This project was supported in part by funding from Bright focus (A2018807S) and the Australian Research Council (ARC) (DP210102712) and The Brain Cancer Centre (founded by Carrie’s Beanies for Brain Cancer). B.M.H was supported by a National Health and Medical Research Council Senior Research Fellowship (1155221). O.F.B was supported by the Brain Cancer Centre Blood-Brain Barrier Program. R.G.P was supported by an ARC Laureate Fellowship (FL210100107). We thank the Centre for Advanced Histology and Microscopy (RRID:SCR_025432) at the Peter MacCallum Cancer Centre and Microscopy Australia Research Facility at the Centre for Microscopy and Microanalysis at The University of Queensland. We also thank Kelly Smith and Marcos Sande Melon for academic discussions and technical suggestions.
Additional information
Author contributions
O.B performed, analysed experiments and co-wrote manuscript. B.M.H, _onceptualized experiments, analysed data and co-wrote manuscript. A.U.G, S.D, W.W, M.C.R.G, Y.W.L, J.R, R.P, A.L and A.F performed and analysed experiments.
Supplementary materials
Zebrafish husbandry
Zebrafish work was conducted in compliance with animal ethics committees at the Peter MacCallum Cancer Centre, The University of Melbourne and The University of Queensland. Previously published transgenic lines were TgBAC(pdgfrb:egfp)ncv22 1,Tg(kdrl:Hsa.HRAS-mCherry)s843 2, Tg(kdrl:EGFP)s843 3 and Tg(gata1:DsRed)sd24.
Genome editing and genotyping
The pdgfrbuq30bh mutant strain was generated using CRISPR/Cas9-mediated genome editing. The resulting allele carries a 39-bp deletion and a 5-bp insertion in exon 3 of pdgfrb (ENSDARG00000100897), causing a frameshift and premature stop codon.
The gRNA sequence and genotyping primers used were: gRNA binding site: 5′ GATGGTGACTAAGACGCGA 3′ Forward genotyping primer: 5′ CTTCCTTAGATCCTGACGTGTG 3′ Reverse genotyping primer: 5′ TATTGATGGGTTCGTCACCAG 3′
The pdgfrb F0 crispants used were generated as F0 Animals by CRISPR/Cas9-mediated genome editing using predesigned Alt-R CRISPR-Cas9 gRNAs (IDT). The gRNA sequence and genotyping primers used were: Dr.Cas9.PDGFRB.1.AA: 5′ GATGGTGACTAAGACGCGAG 3′
Forward genotyping primer: 5′ CTTCCTTAGATCCTGACGTGTG 3′ Reverse genotyping primer: 5′ TATTGATGGGTTCGTCACCAG 3′ Dr.Cas9.PDGFRB.1.AB: 5′ CTCGGTGCACACATAAACCC 3′
Forward genotyping primer: 5′ GACGAGAACATCCCAGACTTTC 3′ Reverse genotyping primer: 5′ GCGTGTAAACAAATCCTAACGG 3′
Tracer dye injections and imaging
For all injections at larva and juvenile stages, NHS Ester–Alexa Fluor 405 (Thermo Fisher: A30000) or 10 kDa Dextran–Cascade Blue (Thermo Fisher: D1976) or 70 kDa Dextran– Fluorescein (Thermo Fisher: D1822) were mixed and co-injected with 2000 kDa Dextran– Tetramethylrhodamine (Thermo Fisher: D7139). This allowed for the normalisation of dye signal relative to the larger molecular weight 2000 kDa tracer to ensure that the amount injected intravenously was appropriately controlled for in all imaging experiments. A final concentration of 5 mg/ml for each tracer was used in all injections.
7 dpf larvae were anesthetised with tricaine and mounted laterally with 0.5% low-melting point agarose (Bio-Rad, 1613112) in E3 embryo water on a 35-mm glass bottom dish (MatTek: P35G-1.5-20-C). 5nl of the tracer mix was injected into the posterior cardinal vein (PCV) and larvae were recovered from agarose using a glass pipette into E3 embryo water. 14 dpf larvae were anesthetised with tricaine, placed laterally on a 3% agarose injection mold. 10 nl tracer mix was injected into the PCV and larvae were recovered in E3 embryo water.
For live imaging, larvae were mounted ventrally with 0.5% low-melting point agarose in E3 embryo water on a 35-mm glass bottom dish. All larvae were carefully live imaged at 2 hours post injection, with a maximum variation in timing of 15 minutes due to the sequential imaging, using Nikon TiE with Yokogawa CSU-W1 spinning disk with Andor Sona sCMOS camera, 40X 1.15 NA water immersion objective for 7 dpf larvae and 20X 0.75 NA objective for 14 dpf (1 um z-step for each stage).
Injections at juvenile and adult stages were performed retro-orbitally using a glass capillary needle as previously described5. For juvenile stage (2-month post fertilisation), brains were extracted 2 hours post injection and whole brains were tissue-cleared using the CUBIC-based method previously described6. Briefly, brains were fixed in 2% paraformaldehyde (PFA) at 4°C overnight, washed in PBS, incubated in CUBIC-L solution at 37°C overnight, washed and incubated in PBS at 4°C overnight, then incubated in CUBIC-R solution at room temperature overnight. Brains were mounted ventrally with 2% agarose in CUBIC-R on a 35-mm glass bottom dish and imaged using Nikon TiE with Yokogawa CSU-W1 spinning disk with Andor Sona sCMOS camera, 4X 0.2 NA objective, 10X 0.45 NA objective, and 20X 0.75 NA objective. For adult stage (>2.5-months post fertilisation), Cascade Blue 10- or 70 kDa Dextran were injected as previously described5. Brains were extracted 2 hours post injection, fixed in 2% PFA overnight, washed in PBS. For vibratome sectioning, brains were embedded in 7% low- melting agarose in PBS in cryomolds (Tissue-Tek) and were sectioned coronally using a vibrating microtome (Leica VT1000 S) with 200 µm thickness setting. Selected sections were placed on a microscope slide and were incubated with RapiClear 1.52 solution (SunJin Lab, RC152201) for 3 hours at room temperature. Imaging was performed using Olympus FV3000 confocal microscope with 10X 0.4 NA objective with 5 µm step size and 40X 1.4 NA oil immersion objective with 1 µm step size. For whole brain imaging, brains were tissue cleared as described earlier and were imaged using Olympus FV3000 confocal microscope with 10X 0.4 NA objective with 5 µm step size. Videos highlighting the “hotspot” leakage sites were generated using Imaris 10.1 software (Bitplane) and Adobe Premier Pro 2024.
Live imaging of pericytes and blood vessels was conducted using Olympus FV-MPERS multiphoton microscope with 25X 1.05 NA water dipping objective with 3 µm step size. To ensure optical transparency, live imaging was conducted in F0 knockout animals for the gene slc45a2 (ENSDARG00000002593) as previously described7 or 0.003% PTU was applied to the embryo water at 1 dpf.
Transmission electron microscopy
Brains were extracted from euthanised 5-month-old zebrafish, fixed in 2.5% glutaraldehyde for 1 hour at room temperature and washed with PBS. For sectioning, the brains were embedded in 7% low-melting point agarose in PBS in cryomolds (Tissue-Tek) and were sectioned coronally using a vibrating microtome (Leica VT1000 S) with 200 µm thickness. Tissue sections were processed as described previously8.
Briefly, tissue sections were immersed consecutively in a series of aqueous solutions: 1.5% potassium ferricyanide and 2% osmium tetroxide, 1% thiocarbohydrazide, 2% osmium tetroxide, 2% uranyl acetate and 0.06% lead nitrate using a Pelco Biowave at 80W under vacuum for 3min each. Vibratome sections then underwent serial dehydration in increasing concentrations of ethanol, before serial infiltration with increasing concentrations of Procure 812 resin. Ultrathin sections were obtained using a Leica UC64 ultramicrotome and imaged on a Jeol JEM-1011 at 80kV.
Quantifications
Vessel length, diameter and branching points
Vessel length, diameter and branching points were quantified using Imaris 10.1 software (Bitplane). For larval stages, lumenized midbrain central artery (kdrl:Hsa.HRAS-mCherry) branching from the middle mesencephalic arteries was traced using the filament tool and the total filament length (µm) was plotted. The branching points within the traced blood vessels were quantified by manual scoring in 3D view. For adult stage, 100-µm thick maximum intensity projections (MIP) were generated from whole brain imaging, using the continuation of the left middle mesencephalic central artery as an anatomical anchor point as the consistent region measured. For diameter measurements, 10 capillary diameters were measured per sample. Vessel anatomy was identified using the study by Isogai et al9 as a reference.
Tracer intensity
Tracer intensity quantification was performed on genotype blinded image sets using Fiji10. For larval stage experiments, the tracer accumulation in brain parenchyma (70-or 10 kDa Dextran or 1 kDa NHS Ester) was calculated using average intensity from 4 midbrain parenchymal regions in 50-µm thick MIPs, which were generated starting from 50 µm below dorsal longitudinal vessel (DLV) to avoid detecting potential leakage from surface vessels. These measurements were normalized to the vascular tracer intensity of 2000 kDa Dextran, which was calculated using average intensity from 4 regions within the DLV lumen. As such, for each data point: intensity=parenchymal dextran (1, 10 or 70 kDa) intensity/luminal 2000 kDa Dextran intensity.
For juvenile stage experiments, 30-µm thick MIPs were generated starting from 60 µm below the most superficial vessel to potential leakage from the surface vessels. Brain parenchymal 70 kDa Dextran intensity was calculated using average intensity from 4 midbrain parenchymal regions and was normalized to vascular 2000 kDa Dextran intensity, which was calculated using average intensity from 4 regions within the lumen of superficial large calibre vessels. For adult stage experiments, 50-µm thick MIPs were generated and dextran intensity outside the vessels was measured at every 100 µm from medial to lateral direction within 1 mm. Branching point of left and right middle mesencephalic arteries was determined as the starting point.
TEM quantification
Imaged sections were quantified using Fiji10. Caveolae were defined as circular profiles of less than 100 nm in diameter and were scored as luminal or abluminal based on proximity to each surface membrane (within 500 µm of each surface or in a thin walled vessel the caveolae closest to each surface). Basement membrane thickness was scored in 6 different locations per vessel that were selected at random. N=3-8 vessels per group were analysed as indicated in the Figure legends.
Statistical analysis
Statistical analyses and graphical representations were conducted using GraphPad Prism 10 software. ns: P>0.05, *P≤0.05, **P≤0.01, ***P≤0.001, ****P≤0.0001. For Figure 3e, we applied the non-parametric two-sample Kolmogorov-Smirnov test using Python software to evaluate whether the distribution of tracer accumulation for each position differed from that of the control. Further details on statistics can be found in each figure legend.

pdgfrbuq30bh larvae exhibit decreased cerebrovascular complexity but an intact BBB.
a, Confocal projections of pericytes (TgBAC(pdgfrb:egfp)ncv22) and brain vasculature (Tg(kdrl:Hsa.HRAS-mCherry)s843) in sibling and pdgfrbuq30bh mutants at 3-5 dpf.
b, Quantification of branching points of midbrain central arteries demonstrating the first detectable vessel patterning phenotype is seen at 5 dpf. N=10 per group at 3 dpf, n=15 in sibling and n=9 in pdgfrbuq30bhat 4 dpf, n=15 in sibling and n=11 in pdgfrbuq30bh at 5 dpf. Unpaired t-test, ns=not significant, *P<0.05.
c, d, Fluorescent tracer leakage assays in the midbrain of zebrafish larvae at 7 (c) and 14 dpf (d). 70 kDa Dextran–Fluorescein, 10 kDa Dextran–Cascade Blue and 1 kDa NHS Ester–Alexa Fluor 405 were used to detect tracer extravasation to the brain parenchyma in separate experiments and were coinjected with 2000 kDa Dextran–Tetramethylrhodamine to normalize vascular tracer intensity.
e, Quantification of brain parenchymal 70- and 10- and 1 kDa tracer intensity normalized to vascular 2000 kDa Dextran intensity. N=12 for sibling and n=7 in pdgfrbuq30bh 1 kDa NHS Ester intensity at 7 dpf, n=10 in sibling and n=9 in pdgfrbuq30bh for 70 kDa intensity at 14dpf, n=6 for sibling and n=4 for pdgfrbuq30bh for 10 kDa intensity at 14 dpf. Unpaired t-test, ns=not significant.
a, c, d, Scale bars: 100 μm.

Examples of aneurysms in pdgfrbuq30bh mutants at 2-month-old stage.
a, Fluorescent tracer assays in the midbrain of 2-month-old zebrafish displaying examples of aneurysm severity in major vessels. 70 kDa Dextran–Fluorescein and 2000 kDa Dextran– Tetramethylrhodamine were co-injected to detect tracer extravasation to the brain parenchyma and tracer within the vasculature, respectively.
a′, Confocal projections zoomed in on the area shown in a (dashed square). Aneurysm (arrowheads) phenotypes were qualitatively categorised based on severity; normal, mild and severe and these categories used in Fig. 2.

Adult pdgfrbuq30bhmutant animals display leakage and tracer accumulation localised at major vessel aneurysms.
a, Fluorescent tracer leakage assays in 5-month-old sibling and pdgfrbuq30bh animals. 70 kDa Dextran–Fluorescein (green) was retro-orbitally injected, and Tg(kdrl:Hsa.HRAS-mCherry)s843 was used to label the blood vessels (magenta). Scale bar: 250 μm.
a′, Zoomed regions (dashed rectangles) from a highlighting the tracer accumulation outside the large calibre vessels with aneurysm. Scale bar: 250 μm.

Adult pdgfrb mutant rupture hotspots at aneurysms and unchanged endothelial ultrastructure in capillaries.
a, Whole brain imaging showing midbrain vasculature (Tg(kdrl:Hsa.HRAS-mCherry)s843) and 70 kDa Dextran–Fluorescein (green) in siblings and pdgfrbuq30bh mutants at 5-months of age. Hotspot leakage sites are indicated by white arrowheads.
b, Confocal projections of pericytes (TgBAC(pdgfrb:egfp)ncv22) and brain vasculature (Tg(kdrl:Hsa.HRAS-mCherry)s843) in sibling and pdgfrb crispants at 5 dpf, showing loss of pericytes in the pdgfrb crispants (phenocopying null mutants).
c, Quantification of endothelial caveolae in capillaries of siblings and pdgfrbuq30bh mutants. n=5 vessels per group, unpaired t-test ns= not significant.
References
- 1Establishment and Dysfunction of the Blood-Brain BarrierCell 163:1064–1078https://doi.org/10.1016/j.cell.2015.10.067Google Scholar
- 2Pericytes: developmental, physiological, and pathological perspectives, problems, and promisesDev Cell 21:193–215https://doi.org/10.1016/j.devcel.2011.07.001Google Scholar
- 3Mice deficient for PDGF B show renal, cardiovascular, and hematological abnormalitiesGenes Dev 8:1875–1887https://doi.org/10.1101/gad.8.16.1875Google Scholar
- 4Pericyte loss and microaneurysm formation in PDGF-B-deficient miceScience 277:242–245https://doi.org/10.1126/science.277.5323.242Google Scholar
- 5Pericytes regulate the blood-brain barrierNature 468:557–561https://doi.org/10.1038/nature09522Google Scholar
- 6Pericytes are required for blood-brain barrier integrity during embryogenesisNature 468:562–566https://doi.org/10.1038/nature09513Google Scholar
- 7Pericytes regulate VEGF-induced endothelial sprouting through VEGFR1Nat Commun 8https://doi.org/10.1038/s41467-017-01738-3Google Scholar
- 8Pericytes promote selective vessel regression to regulate vascular patterningBlood 120:1516–1527https://doi.org/10.1182/blood-2011-01-332338Google Scholar
- 9A plasticity window for blood vessel remodelling is defined by pericyte coverage of the preformed endothelial network and is regulated by PDGF-B and VEGFDevelopment 125:1591–1598https://doi.org/10.1242/dev.125.9.1591Google Scholar
- 10Role of PDGF-B and PDGFR-beta in recruitment of vascular smooth muscle cells and pericytes during embryonic blood vessel formation in the mouseDevelopment 126:3047–3055https://doi.org/10.1242/dev.126.14.3047Google Scholar
- 11TGF-beta, and heterotypic cell-cell interactions mediate endothelial cell-induced recruitment of 10T1/2 cells and their differentiation to a smooth muscle fateJ Cell Biol 141:805–814https://doi.org/10.1083/jcb.141.3.805Google Scholar
- 12Abnormal kidney development and hematological disorders in PDGF beta-receptor mutant miceGenes Dev 8:1888–1896https://doi.org/10.1101/gad.8.16.1888Google Scholar
- 13Conserved and context-dependent roles for pdgfrb signaling during zebrafish vascular mural cell developmentDev Biol 479:11–22https://doi.org/10.1016/j.ydbio.2021.06.010Google Scholar
- 14Single-Cell Analysis of Blood-Brain Barrier Response to Pericyte LossCirc Res 128:e46–e62https://doi.org/10.1161/CIRCRESAHA.120.317473Google Scholar
- 15Functional and developmental analysis of the blood-brain barrier in zebrafishBrain Res Bull 75:619–628https://doi.org/10.1016/j.brainresbull.2007.10.043Google Scholar
- 16A novel transgenic zebrafish model for blood-brain and blood-retinal barrier developmentBMC Dev Biol 10https://doi.org/10.1186/1471-213X-10-76Google Scholar
- 17Development of the brain vasculature and the blood-brain barrier in zebrafishDev Biol 457:181–190https://doi.org/10.1016/j.ydbio.2019.03.005Google Scholar
- 18CNS angiogenesis and barriergenesis occur simultaneouslyDev Biol 425:101–108https://doi.org/10.1016/j.ydbio.2017.03.017Google Scholar
- 19Suppression of transcytosis regulates zebrafish blood-brain barrier functioneLife 8https://doi.org/10.7554/eLife.47326Google Scholar
- 20Clarification of mural cell coverage of vascular endothelial cells by live imaging of zebrafishDevelopment 143:1328–1339https://doi.org/10.1242/dev.132654Google Scholar
- 21Live-imaging of astrocyte morphogenesis and function in zebrafish neural circuitsNat Neurosci 23:1297–1306https://doi.org/10.1038/s41593-020-0703-xGoogle Scholar
- 22Peri-arterial specification of vascular mural cells from naive mesenchyme requires Notch signalingDevelopment 146https://doi.org/10.1242/dev.165589Google Scholar
- 23Advanced CUBIC tissue clearing for whole-organ cell profilingNat Protoc 14:3506–3537https://doi.org/10.1038/s41596-019-0240-9Google Scholar
- 24Retro-orbital injection in adult zebrafishJ Vis Exp https://doi.org/10.3791/1645Google Scholar
- 25Cells respond to mechanical stress by rapid disassembly of caveolaeCell 144:402–413https://doi.org/10.1016/j.cell.2010.12.031Google Scholar
- 26Caveolae: Mechanosensing and mechanotransduction devices linking membrane trafficking to mechanoadaptationCurr Opin Cell Biol 68:113–123https://doi.org/10.1016/j.ceb.2020.10.008Google Scholar
- 27Dual function of perivascular fibroblasts in vascular stabilization in zebrafishPLoS Genet 16:e1008800https://doi.org/10.1371/journal.pgen.1008800Google Scholar
- 28Blood-Brain Barrier Permeability Is Regulated by Lipid Transport-Dependent Suppression of Caveolae-Mediated TranscytosisNeuron 94:581–594https://doi.org/10.1016/j.neuron.2017.03.043Google Scholar
- 29Endothelial Unc5B controls blood-brain barrier integrityNat Commun 13https://doi.org/10.1038/s41467-022-28785-9Google Scholar
- 30Pericyte-to-endothelial cell signaling via vitronectin-integrin regulates blood-CNS barrierNeuron 110:1641–1655https://doi.org/10.1016/j.neuron.2022.02.017Google Scholar
- 31Plastic roles of pericytes in the blood-retinal barrierNat Commun 8:15296https://doi.org/10.1038/ncomms15296Google Scholar
- 1Clarification of mural cell coverage of vascular endothelial cells by live imaging of zebrafishDevelopment 143:1328–1339https://doi.org/10.1242/dev.132654Google Scholar
- 2Foxn4 directly regulates tbx2b expression and atrioventricular canal formationGenes Dev 22:734–739https://doi.org/10.1101/gad.1629408Google Scholar
- 3Cellular and molecular analyses of vascular tube and lumen formation in zebrafishDevelopment https://doi.org/10.1242/dev.02087Google Scholar
- 4Transplantation and in vivo imaging of multilineage engraftment in zebrafish bloodless mutantsNat Immunol 4:1238–1246https://doi.org/10.1038/ni1007Google Scholar
- 5Retro-orbital injection in adult zebrafishJ Vis Exp https://doi.org/10.3791/1645Google Scholar
- 6Advanced CUBIC tissue clearing for whole-organ cell profilingNat Protoc 14:3506–3537https://doi.org/10.1038/s41596-019-0240-9Google Scholar
- 7Rapid Generation of Pigment Free, Immobile Zebrafish Embryos and Larvae in Any Genetic Background Using CRISPR-Cas9 dgRNPsZebrafish 18:235–242https://doi.org/10.1089/zeb.2021.0011Google Scholar
- 8Caveolae Protect Notochord Cells against Catastrophic Mechanical Failure during DevelopmentCurr Biol 27:1968–1981https://doi.org/10.1016/j.cub.2017.05.067Google Scholar
- 9The vascular anatomy of the developing zebrafish: an atlas of embryonic and early larval developmentDev Biol 230:278–301https://doi.org/10.1006/dbio.2000.9995Google Scholar
- 10Fiji: an open-source platform for biological-image analysisNat Methods https://doi.org/10.1038/nmeth.2019Google Scholar
Article and author information
Author information
Version history
- Sent for peer review:
- Preprint posted:
- Reviewed Preprint version 1:
- Reviewed Preprint version 2:
- Version of Record published:
Cite all versions
You can cite all versions using the DOI https://doi.org/10.7554/eLife.104061. This DOI represents all versions, and will always resolve to the latest one.
Copyright
© 2025, Baltaci et al.
This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.
Metrics
- views
- 1,841
- downloads
- 110
- citations
- 3
Views, downloads and citations are aggregated across all versions of this paper published by eLife.