Abstract
The precise organization of neural circuits requires highly specific axon guidance, facilitated by cell-surface guidance receptors on axonal growth cones that help neurons reach their target destinations. Despite a limited repertoire of known guidance receptors and ligands, neural systems achieve complex axonal networks, suggesting that additional regulatory mechanisms exist. One proposed strategy is the co-expression of ligands and their receptors on the same axons, allowing modulation of receptor responsiveness to guidance cues. To investigate this mechanism, we studied the spinal lateral motor column (LMC) motor neurons, which make a binary axon pathfinding decision toward limb targets. We hypothesized that specificity protein 1 (Sp1), a transcription factor, regulates ephrin expression in LMC neurons, thereby modulating receptor functions via cis-attenuation to ensure accurate axonal pathfinding. Our results show that Sp1 is indeed expressed in LMC neurons during critical axonal extension periods. Manipulating Sp1 activity disrupted LMC axon trajectory selection, and RNA-Seq analysis indicated that Sp1 regulates genes associated with axon guidance, including ephrins. We found that Sp1 knockdown affected ephrin/Eph cis-binding and trans-signaling, highlighting Sp1’s role in controlling axonal projections through ephrin gene regulation. Additionally, coactivators p300 and CBP are essential for Sp1’s regulatory function. These findings identify Sp1 as a key transcription factor in LMC neurons, essential for ephrin expression and ephrin/Eph-mediated axon guidance, providing insights into the molecular mechanisms of neural circuit formation.
Introduction
The complex organization of neural circuits, which depends on highly specific axon guidance, is essential for forming a functional nervous system. Neuronal axonal growth cones need precise guidance to reach their correct targets, a process facilitated by the activation of cell-surface guidance receptors located on the axons. Given the relatively limited number of known protein families, especially those encoding axon guidance receptors and their ligands, questions arise about how the diversity of guidance signals is amplified to direct the intricate axonal networks within most neural circuits. One proposed solution to this challenge is the co-expression of ligands and their receptors on the same axons, a strategy that appears effective in modulating the responsiveness of growth cone receptors to specific guidance cues. However, our understanding of the molecular mechanisms underlying these processes is still limited, largely due to the complexity of most nervous systems under study.
To address the challenges posed by nervous system complexity, we examined a straightforward binary axon pathfinding decision made by spinal lateral motor column (LMC) motor axons as they extend toward the base of the limb. LMC neurons are divided into medial and lateral populations, which grow toward the limb base and then diverge to form ventral and dorsal limb nerves, respectively (Landmesser, 1978). Multiple ligand and receptor families, including ephrins/Ephs, Netrin-1/Dcc (Unc5c), and other supporting systems, have been implicated in guiding LMC axon growth into the limbs, enabling us to explore the mechanism by which receptor functions are finely regulated through receptor/ligand co-expression (Kania and Klein, 2016). Early studies have suggested that ephrins can reduce the activity of co-expressed Eph receptors (known as cis-attenuation), limiting the number of Eph receptors available for binding to ligands expressed on other cells (trans-binding), thus enhancing the accuracy of axon trajectories (Hornberger et al., 1999; Rashid et al., 2005; Carvalho et al., 2006; Kao and Kania, 2011). Despite these findings, the regulatory machinery underlying cis-attenuation remains unclear.
In the lateral motor column (LMC), the expression of Eph receptors is regulated by LIM homeodomain transcription factors Lim1 and Isl1 (Kania and Jessell, 2003; Luria et al., 2008). However, the regulatory mechanisms for co-expressed ephrin in LMC neurons remain unknown. Recently, we observed the expression of specificity protein 1 (Sp1) in the LMC during the period when spinal motor axons grow into the limbs, suggesting that Sp1 may act as a regulator for ephrin gene expression. Sp1, a member of the Sp/KLF transcription factor family, is widely expressed across various mammalian cell types (Briggs et al., 1986) and regulates genes associated with numerous cellular processes (O’Conner et al., 2016). Sp1 activates transcription by recruiting basal transcription machinery and interacting with TFIID complex members, which include the TATA binding protein (TBP) and TBP-associated factors (TAFs) (Hoey et al., 1993; Emili et al., 1994; Saluja et al., 1998). Additionally, Sp1 can associate with epigenetic modifiers such as histone deacetylase 1 (HDAC1) and DNA methyltransferase 1 (DNMT1) to suppress gene expression (Doetzlhofer et al., 1999; Song et al., 2001; Lagger et al., 2003; He et al., 2005; Li et al., 2010). Sp1 knockout in mice results in early embryonic lethality (around day e10.5) with multiple developmental abnormalities, indicating its critical role in development (Marin et al., 1997). Despite this, knowledge of Sp1’s role in central nervous system (CNS) development is still limited. Studies suggest that Sp1 enhances the expression of the NR1 gene, which encodes a key subunit of the N-methyl-D-aspartate receptor, essential for neuronal differentiation (Liu et al., 2004). Furthermore, members of the Sp family (Sp1, Sp3, and Sp4) are thought to collaborate to activate the transcription of cyclin-dependent kinase 5/p35, a protein necessary for brain function (Ross et al., 2002). Sp1 has also been implicated in regulating the expression of the axon guidance ligand Slit2 and modulating Wnt signaling via β-catenin (Mir et al., 2018). Recent studies have shown that astrocyte-expressed Sp1 supports neurite outgrowth and synaptogenesis (Hung et al., 2020), though the role of neuron-specific Sp1 in neural circuit formation remains unclear. Based on this information, we hypothesize that Sp1 regulation of ephrin expression in LMC neurons modulates guidance receptor functions through cis-attenuation, which is necessary for accurate axonal growth into the limbs.
In this study, we first demonstrate that Sp1 is expressed in LMC neurons during the period of motor axon extension into the limb. Altering Sp1 activity—either by loss or gain of function—disrupts the selection of LMC axon trajectories in opposite ways. Interestingly, our RNA-Seq analysis revealed that Sp1 likely regulates genes associated with axon guidance, including ephrins, suggesting its involvement in controlling spinal motor axon projections through the regulation of ephrin genes. We further show that Sp1 knockdown reduces ephrin/Eph cis-binding and diminishes their trans-signaling without affecting Netrin-1, Sema3F, or GDNF in vitro. Additionally, Sp1’s coactivators, p300 and CBP, are both necessary for its role in regulating ephrin expression in this context. Together, these findings indicate that Sp1 is a key transcription factor that regulates ephrin gene expression in LMC neurons and subsequently modulates ephrin/Eph cis-attenuation, allowing precise control of ephrin/Eph trans-signaling and LMC axon trajectory selection.
Results
Sp1 expression in LMC motor neurons
The transcription factor Sp1 has been implicated in several cellular processes, including neuronal differentiation, neurite outgrowth, and synaptogenesis (Liu et al., 2004; Hung et al., 2020). To explore the function of Sp1 in motor axon guidance in vivo and define its role, we first assessed Sp1 expression in the lateral motor column (LMC) at the time when motor axons invade the limb mesenchyme. This occurs between HH stage 25 and 26 in chick embryos and at e11.5 in mouse embryos (Hamburger and Hamilton, 1951; Tosney and Landmesser, 1985; Kania et al., 2000). We examined Sp1 expression in the lumbar spinal cord of HH stage 25/26 chick embryos and in both brachial and lumbar spinal cords of e11.5 mouse embryos. The dorsal and ventral limb-innervating subpopulations of LMC neurons were identified using the medial LMC marker Isl1 and the lateral LMC marker Lim1 (Fig. 1A, B, F, G, K, L). We observed strong expression of Sp1 mRNA in both medial and lateral LMC neurons in chick and mouse embryos (Fig. 1C, H, M). Additionally, Sp1 coactivators p300 and CBP were also expressed in LMC neurons (Fig. 1D, E, I, J, N, O). No significant differences in p300 and CBP expression were noted between the medial and lateral LMC or between brachial and lumbar spinal cords in chick and mouse embryos.

Expression of Sp1 and its coactivators in chick and mouse LMC motor neurons.
(A-O) mRNA detection in consecutive sections of spinal cords: all chick sections represent the HH stage 25/26 lumbar spinal cord, while all mouse sections represent the e11.5 lumbar spinal cord. (A, B) Detection of Isl1 (A) and Lim1 (B) mRNA in the chick spinal cord, marking the medial and lateral LMC neurons, respectively. (C-E) mRNA detection of Sp1 (C) and its coactivators p300 (D) and CBP (E) in both medial and lateral LMC neurons of the chick. (F, G, K, L) mRNA detection of Isl1 (F, K) and Lim1 (G, L) in mouse LMC neurons. (H-J, M-O) mRNA detection of Sp1 (H, M), p300 (I, N), and CBP (J, O) in both medial and lateral LMC neurons in the mouse.
M, medial; L, lateral. Scale bar, μm (A-O) 30 μm
Sp1 is required for limb trajectory selection by LMC axons
To investigate whether Sp1 is involved in determining whether LMC axons select dorsal or ventral limb nerves, we knocked down Sp1 expression by introducing an inhibitory siRNA targeting Sp1 mRNA ([Sp1]siRNA) into LMC neurons. We achieved this by co-electroporating the siRNA along with a GFP expression plasmid into the chick lumbar neural tube before LMC neuron specification and before axons entered the limb at HH stage 18/19. We then analyzed GFP+ motor axons in the dorsal and ventral nerve branches emerging from the crural plexus at HH stage 28/29 (Kania and Jessell, 2003). The co-electroporation of [Sp1]siRNA and GFP plasmid resulted in a significant reduction in Sp1 mRNA and protein levels, compared to embryos that were electroporated with a control GFP plasmid or scrambled [Sp1]siRNA (Fig. 2A-G). However, this reduction did not lead to noticeable changes in axon outgrowth (Fig. 2K) or in the number of LMC neurons expressing the Foxp1 marker. Additionally, there was no alteration in the proportions of lateral LMC (Foxp1+, Isl1-) versus medial LMC (Foxp1+, Isl1+) neurons when compared to embryos treated with the control GFP plasmid or scrambled [Sp1]siRNA (Fig. 2L, M). The number of electroporated neurons was also similar between the LMC divisions in both the [Sp1]siRNA and GFP co-expressing groups and the controls (Fig. 2N).

Sp1 function is required for the selection of limb axon trajectory.
All images are from chick HH st. 28/29 lumbar levels.
(A-C) Detection of Foxp1, Isl1, GFP, and Sp1 in LMC neurons of chick embryos electroporated with either GFP (A), scrambled [Sp1]siRNA and GFP (B), or [Sp1]siRNA and GFP (C).
(D-F) Detection of Foxp1, Sp1, and GFP in cultured LMC neurons from chick embryos electroporated with GFP (A), scrambled [Sp1]siRNA and GFP (B), or [Sp1]siRNA and GFP (C).
(G) Quantification of the effects of GFP, scrambled [Sp1]siRNA and GFP, or [Sp1]siRNA + GFP electroporation on Sp1 mRNA levels. The ratio of immunoreactivity signal between the LMC regions of electroporated and un-electroporated contralateral sides (e/u ratio) was measured in at least 15 sections from 5 embryos.
(H-J) Detection of Foxp1, Isl1, GFP protein, and mouse Sp1 mRNA in LMC neurons of chick embryos at HH stage 28/29 electroporated with GFP (H), Sp1 and GFP (I), or Sp1T278A, T739A and GFP (J) expression plasmids.
(K) Quantification of axon outgrowth effects following electroporation of GFP, scrambled [Sp1]siRNA and GFP, [Sp1]siRNA and GFP, Sp1 and GFP, or Sp1T278A, T739A and GFP. GFP+ LMC axon lengths were compared to the GFP control group, with measurements taken from at least 15 sections of 5 embryos.
(L) The number of LMC motor neurons was expressed as the average count of Foxp1+ LMC neurons per section (# Foxp1+ MNs/section), with 5 embryos per group.
(M, N) The number of medial (Foxp1+ Isl1+) and lateral (Foxp1+ Isl1-) LMC motor neurons in the lumbar spinal cord was expressed as a percentage of total motor neurons [Foxp1+ MNs (%)]
(M) or electroporated motor neurons [GFP+ MNs (%)] (N), with 5 embryos per group.
(O-V) Detection of neurofilament and GFP in the limb nerve branches of the crural plexus in chick embryos electroporated with different plasmids and siRNAs, including GFP (O), scrambled [Sp1]siRNA and GFP (P), [Sp1]siRNA and GFP (Q), Sp1 and GFP (R), [Sp1]siRNA, mouse Sp1 and GFP (S), Sp1T278A, T739A and GFP (T), medial LMC axonal marker, e[Isl1]::GFP (U), or [Sp1]siRNA and e[Isl1]::GFP (V). GFP fluorescence signals were quantified in dorsal and ventral limb nerves, with the percentages (GFP Fluo [%]) presented for each electroporation condition. The number of embryos was n = 5 for all groups.
d, dorsal; v, ventral; n.s. = not significant; *** = p<0.001; ** = p<0.01; * = p<0.05; statistical significance computed using Fisher’s exact test (A-N) or Mann-Whitney U test (O-U); solid lines in each scatterplot show the median difference. Scale bar: (A-C, H-J) 45 μm; (D-F) 35μm; (O-U) 150 μm
To assess whether Sp1 knockdown influences the trajectory selection of LMC axons within the limb, we quantified the proportions of GFP+ axons in the dorsal and ventral limb nerve branches by measuring the fluorescence intensities across a series of hindlimb section images from multiple embryos under each experimental condition (Kania and Jessell, 2003; Luria et al., 2008). For statistical analysis, we compared the proportions of GFP+ axons projecting dorsally or ventrally between the different experimental conditions. In embryos co-electroporated with [Sp1]siRNA and GFP, a significantly greater proportion of GFP+ axons was found in the ventral nerve branches compared to embryos electroporated with either the GFP or scrambled [Sp1]siRNA controls (Fig. 2O-Q). Notably, the axon misrouting effect was corrected by co-expressing mouse Sp1 (Fig. 2Q, S). These results suggest that Sp1 knockdown leads to a significantly higher proportion of LMC motor axons projecting into the ventral limb.
We then conducted Sp1 gain-of-function experiments by co-electroporating Sp1 and GFP expression plasmids into LMC neurons and examined motor axon trajectories in the limb. Compared to GFP controls, the axon length, specification, and survival of LMC neurons were unaffected in embryos co-expressing Sp1 and GFP (Fig. 2H, I, K-M), and the proportion of electroporated GFP+ LMC neurons was consistent across both LMC divisions (Fig. 2H, I, N). In embryos co-expressing Sp1 and GFP, a significantly higher proportion of GFP+ axons was observed in the dorsal nerves compared to GFP controls (Fig. 2O, R), suggesting that Sp1 overexpression increases the number of LMC motor axons entering the dorsal limb. To further explore the role of Sp1’s regulatory activity, we used a Sp1T278A, T739A expression plasmid, which encodes a mutant form of Sp1 that cannot be phosphorylated (Chuang et al., 2008). In comparison to GFP controls, LMC axon outgrowth, neuron specification, and survival remained normal in embryos co-expressing Sp1T278A, T739A, and GFP (Fig. 2J-N). However, similar to the effects of Sp1 knockdown, co-expression of Sp1T278A, T739A, and GFP resulted in a significantly higher proportion of GFP+ axons in the ventral nerve branches compared to GFP-only controls (Fig. 2O, T). Collectively, these results demonstrate that Sp1 expression in LMC motor neurons is crucial for accurate axon guidance in the limb.
Two potential explanations could account for the increased proportion of LMC neurons projecting into the ventral nerve branch after Sp1 knockdown: 1) some lateral LMC axons may enter the ventral limb nerve, or 2) both medial and lateral LMC axons project into both limb nerves, but a greater proportion of lateral LMC axons enter the ventral limb nerve. Regardless, Sp1 knockdown clearly results in a loss of precision in the trajectory selection of lateral LMC axons. To investigate whether Sp1 knockdown leads to medial LMC axons being misdirected into the dorsal limb mesenchyme, we co-electroporated [Sp1]siRNA with the e[Isl1]::GFP plasmid, which preferentially labels medial LMC motor neurons and their axons (Kao et al., 2009), and used e[Isl1]::GFP alone as a control. In embryos co-electroporated with [Sp1]siRNA and e[Isl1]::GFP, a significantly higher proportion of GFP+ axons were observed in the dorsal limb nerve compared to the e[Isl1]::GFP control group (Fig. 2T, U). Collectively, these results demonstrate that Sp1 is essential for ensuring accurate limb trajectory selection by both lateral and medial LMC axons.
Asymmetric Sp1 knockdown sensitivity of the LMC trajectory choice
To determine the extent to which both medial and lateral LMC divisions are affected by Sp1 loss of function, we analyzed LMC axon trajectory in Sp1 mutant mice. Since complete deletion of Sp1 results in lethality by e10.5, before LMC axons extend into the limb at e11.5-12.5 (Marin et al., 1997), we used mice with neuron-specific Sp1 deletion (Syn1-Cre:Sp1F/F) to study Sp1’s role in LMC trajectory selection (Zhu et al., 2001). In Syn1-Cre:Sp1F/Fmice, LMC neuron specification and survival were comparable to those in Sp1 floxed (Sp1F/F) littermate controls (Fig. 3A-J). To trace LMC axon trajectories, we labeled LMC neurons using HRP retrograde tracer injections into the dorsal or ventral shank muscles of e12.5 Syn1-Cre:Sp1F/Fand Sp1F/F littermate embryos and quantified the proportions of tracer-filled LMC neurons expressing Isl1 and Lim1 (Kania et al., 2000; Chang et al., 2018). In Syn1-Cre:Sp1F/F embryos, the proportion of medial LMC neurons labeled by dorsal limb HRP injection was significantly higher compared to control embryos (Fig. 3K-O). Similarly, a significantly greater proportion of lateral LMC neurons was labeled by ventral limb HRP injection in Syn1-Cre:Sp1F/F embryos than in control embryos (Fig. 3Q-U). These results indicate that Sp1 is essential for the proper selection of LMC axon trajectories and suggest that medial and lateral LMC neurons differ in their reliance on Sp1 function (Fig. 3P, V).

Sp1 is required for the fidelity of LMC motor axon trajectory selection.
Retrograde labeling of LMC neurons via HRP injections into dorsal or ventral limb muscles of mouse embryos at e12.5.
(A-H) Detection of Lim1 (green), Foxp1 (red), and Sp1 in the LMC region at the brachial level in mouse Sp1F/F (A-D) or Syn1-Cre:Sp1F/F(E-H) embryos.
(I) Quantification of LMC motor neurons as the average number of total (Foxp1+) LMC neurons per section (# FoxP1+/section). The number of embryos used: n = 5 for all groups.
(J) Quantification of total medial (FoxP1+ Lim1-) and lateral (FoxP1+ Lim1+) LMC motor neurons in the brachial spinal cord, expressed as a percentage of total motor neurons [FoxP1+ MNs (%)]. The number of embryos used: n = 5 for all groups.
(K-N) Detection of HRP (red), Isl1 (blue), and Foxp1 (green) in the LMC regions of Sp1F/F (K, L) and Syn1-Cre:Sp1F/F(M, N) embryos following HRP injection into the dorsal forelimb muscles.
(O) Quantification of retrogradely labeled medial LMC axon projections. The graph displays the percentage of HRP+ motor neurons expressing the medial LMC marker Isl1 after dorsal limb injection. The number of embryos used: n = 5 for all groups.
(P) Schematic summary showing medial LMC projections in Syn1-Cre:Sp1F/F mice, highlighting the significant misrouting of medial LMC axons into the dorsal limb.
(Q-T) Detection of HRP (red), Lim1 (blue), and Foxp1 (green) in the LMC regions of Sp1F/F (Q, R) and Syn1-Cre:Sp1F/F(S, T) embryos following HRP injection into the ventral forelimb muscles.
(U) Quantification of retrogradely labeled lateral LMC axon projections. The graph displays the percentage of HRP+ motor neurons expressing the lateral LMC marker Lim1 after ventral limb injection. The number of embryos used: n = 5 for all groups.
(V) Schematic summary showing lateral LMC projections in Syn1-Cre:Sp1F/F mice, depicting significant misrouting of lateral LMC axons into the ventral limb.
HRP, horseradish peroxidase; Syn1, Synapsin1; n.s. = not significant; ** = p<0.01; *** = p<0.001; statistical significance computed using Fisher’s exact test; solid lines in each scatterplot show the median difference. Scale bar: (A-H, K-N, Q-T) 20 μm
Sp1 regulates axonal guidance and neuronal development via ephrin signaling
To further determine Sp1 function in neural development, RNA sequencing was performed to elucidate the role of Sp1 in regulating gene expression during neuronal development by comparing Syn1-Cre:Sp1F/Fneurons from to their control counterparts. The analysis revealed significant changes in gene expression, as shown in the volcano plot, with 333 genes upregulated and 353 genes downregulated in response to Sp1 modulation (Fig. 4A). This indicates that Sp1 plays a broad and essential role in neuronal gene regulation. To understand the functional implications of these differentially expressed genes, pathway enrichment analysis using Ingenuity Pathway Analysis was conducted (Fig. 4B). The results pointed to key developmental processes, particularly highlighting pathways involved in axonal guidance and ephrin-receptor signaling, suggesting that Sp1 influences critical signaling pathways that guide neuronal connectivity and axon navigation. The network analysis of these pathways further provided insights into the molecular interactions, where transcription factors, receptors, and enzymes were mapped in relation to Sp1 activity (Fig. 4C). Upregulated genes were primarily involved in enhancing neuron signaling, while downregulated genes suggested suppression of specific pathways. Among these, genes like ephrin-B2 (Efnb2) and ephrin-A5 (Efna5), both of which play pivotal roles in axon guidance, were significantly downregulated following Sp1 knockdown (Fig. 4D). Conversely, Sema7A, another gene involved in neuronal guidance, showed increased expression, implying that Sp1 may serve as both a promoter and repressor, depending on the target gene and context (Fig. 4D).

Sp1-mediated gene expression and pathways analysis in neuronal development
(A) Volcano plot showing the differential gene expression between Syn1Tg/0/Sp1f/fand Syn1Tg/0 conditions. The x-axis represents the Log2 fold-change in gene expression, and the y-axis shows the −Log (p-value). Significantly upregulated genes (in red) and downregulated genes (in green) are displayed, with 333 and 353 genes identified as upregulated and downregulated, respectively.
(B) Pathway enrichment analysis was performed on the differentially expressed genes (DEGs) using Ingenuity Pathway Analysis, focusing on pathways related to organismal growth and development. The top 10 enriched pathways and signaling events are presented.
(C) Network representation of key pathways, including Ephrin-Receptor Signaling and Axonal Guidance Signaling. DEGs are represented, with red nodes indicating upregulated genes and green nodes showing downregulated genes. The network highlights the interactions between these genes, with different node shapes corresponding to the functional classes of the gene products (e.g., transcription factors, receptors, enzymes).
(D) RNA sequencing analysis of gene expression in primary mouse neurons revealed significant changes in genes related to axon guidance. Specifically, ephrin-B2 (Efnb2) and ephrin-A5 (Efna5) expression decreased, while Sema7A increased following Sp1 siRNA knockdown (left panel). A ChIP assay using Sp1 antibody confirmed Sp1 binding at the ephrin-B2 promoter region (right panel).
(E-G) Diagrams illustrate the predicted Sp1-binding sites on the ephrin-B2 promoter (E). Both promoter activation and protein levels were assessed in NSC-34 cells, indicating Sp1’s regulatory role (F, G).
To investigate whether Sp1 directly regulates these axon guidance-related genes, a ChIP assay was performed, which confirmed that Sp1 binds directly to the ephrin-B2 promoter, suggesting transcriptional control (Fig. 4E). This was further supported by NSC-34 cell experiments, where knockdown of Sp1 led to a notable reduction in both ephrin-B2 promoter activity and protein levels, thereby confirming Sp1’s role as a positive regulator of ephrin-B2 (Fig. 4F, G). These findings imply that Sp1 exerts a precise regulatory influence on genes involved in axonal navigation, either by directly enhancing or repressing their transcription, ultimately affecting neuronal network formation. Together, these data suggest the potential role of Sp1 to mediate a range of gene expression programs crucial for neuronal development, especially in the context of axon guidance and synaptic signaling.
Sp1 is specifically required for ephrin-mediated motor axon responses
To explore the role of Sp1 in Eph signaling, we assessed the response of LMC axons to ephrin and Eph protein stripes in the context of Sp1 loss of function (Kao and Kania, 2011). LMC explants were taken from HH stage 25/26 embryos and placed on alternating stripes: one containing a mix of ephrin-Fc and a Cy3 secondary antibody, and the other containing only Fc protein. Medial LMC axons were marked by e[Isl1]::GFP electroporation, while lateral LMC axons were identified by their EphA4 expression. Stripe preference was quantified by measuring the proportion of GFP or EphA4 signal over the respective stripes after overnight explant culture (Kao and Kania, 2011; Kao et al., 2015). Neurite growth preference in ephrin versus Fc stripes was compared statistically between different experimental conditions.
Medial LMC neurons co-electroporated with [Sp1]siRNA and e[Isl1]::GFP showed a significantly increased repulsion from ephrin-A5 stripes compared to controls expressing only e[Isl1]::GFP. This indicates that Sp1 influences ephrin-A expression, ensuring ephrin-A/EphA cis-attenuation in medial LMC axons (Fig. 5A, B). Additionally, medial LMC neurons co-electroporated with [Sp1]siRNA and e[Isl1]::GFP exhibited significantly enhanced attraction toward EphA4 stripes compared to controls, suggesting possible EphA:ephrin-A reverse signaling, potentially due to reduced ephrin-A levels following Sp1 knockdown (Fig. 5C, D). Given that previous studies have identified Netrin-1 and Semaphorin (Sema) 3F as additional regulators of medial LMC axon guidance into the limb (Poliak et al., 2015; Huber et al., 2005; Moret et al., 2007), we also tested medial LMC axon responses to Netrin-1 and Sema3F stripes under Sp1 knockdown conditions. Medial LMC neurons with Sp1 knockdown showed normal avoidance of Netrin-1 and Sema3F stripes, similar to controls expressing e[Isl1]::GFP alone (Fig. 5E-H), indicating that Sp1 does not play a significant role in Netrin-1- or Sema3F-mediated medial LMC axon guidance in vitro.

Sp1 function is specifically required for ephrin-mediated guidance of cultured LMC neurites.
Growth preference of medial or lateral LMC axons on protein stripes. Each experiment consists of three panels (left, middle, and right) and one quantification.
(A-H) Left panels: Detection of medial (GFP+) LMC neurites from explants grown on stripes of eA5/Fc (A), EA4/Fc (C), N/Fc (E), or S3F/Fc (G), and explants co-electroporated with [Sp1]siRNA on stripes of eA5/Fc (B), EA5/Fc (D), N/Fc (F), or S3F/Fc (H) stripes. Middle panels: Inverted images showing GFP signals as dark pixels overlaid on the substrate stripes. Right panels: Superimposed images of five representative explants from each experimental group, illustrating the distribution of medial LMC neurites. Quantification shows medial (GFP+) LMC neurites on the first (pink) and second (pale) stripes as a percentage of total GFP signals. A minimum of 88 neurites was analyzed. Number of embryos: n = 5 for all groups. A minimum of 3 explants per embryo was used.
(I-P) Left panels: Detection of lateral (GFP+ EphA4+) LMC neurites from explants grown on stripes of eB2/Fc (I), EB1/Fc (K), N/Fc (M), or GN/Fc (O), and explants co-electroporated with [Sp1]siRNA on stripes of eB2/Fc (J), EB1/Fc (L), N/Fc (N), or GN/Fc (P). Middle panels: Inverted images showing EphA4 signals as dark pixels overlaid on the substrate stripes. Right panels: Superimposed images of five representative explants from each experimental group, demonstrating the distribution of lateral LMC neurites. Quantification shows lateral (EphA4+) LMC neurites on the first (pink) and second (pale) stripes as a percentage of total EphA4 signals. A minimum of 85 neurites was analyzed. Number of embryos: n = 5 for all groups. A minimum of 3 explants per embryo was used.
eA5, ephrin-A5-Fc; EA4, EphA4-Fc; N, Netrin-1; S3F. Semaphorin-3F; eB2, ephrin-B2-Fc; EB1, EphB1-Fc; GN, GDNF; *** = p<0.001; ** = p<0.01; n.s. = not significant; statistical significance computed using Mann-Whitney U test; solid lines in each scatterplot show the median difference. Scale bar: (A-P) 150 μm
In contrast, lateral LMC neurons co-electroporated with [Sp1]siRNA and GFP showed significantly increased repulsion from ephrin-B2 stripes compared to controls expressing only GFP. This indicates that Sp1 regulates ephrin-B expression to ensure ephrin-B/EphB cis-attenuation in lateral LMC axons (Fig. 5I, J). Furthermore, lateral LMC neurons co-electroporated with [Sp1]siRNA and GFP displayed significantly increased attraction to EphB1 stripes compared to controls, suggesting the presence of EphB:ephrin-B reverse signaling, potentially caused by reduced ephrin-B levels following Sp1 knockdown (Fig. 5K, L). Given previous findings indicating that Netrin-1 and GDNF signaling are other pathways involved in regulating lateral LMC axon trajectory into the limb, we next tested the response of lateral LMC axons to Netrin-1 and GDNF stripes. Lateral LMC neurons co-electroporated with [Sp1]siRNA and GFP exhibited normal neurite attraction toward Netrin-1 (Fig. 5M, N) and GDNF stripes (Fig. 5O, P) compared to controls expressing only GFP. This suggests that, similar to medial LMC axons, Sp1 does not play a critical role in Netrin-1- or GDNF-mediated lateral LMC axon guidance in vitro. Taken together, these findings indicate that Sp1 is specifically required for ephrin-A- and ephrin-B-mediated responses in LMC axons.
Sp1 coactivators, p300 and CBP, are required for Sp1-regulated LMC pathfinding
Two Sp1 coactivators, p300 and CBP, are present in LMC neurons during the proper trajectory of their axons into the limb (Fig. 1). To explore the role of p300 and CBP in Sp1-regulated LMC axon pathfinding, we investigated whether their loss would reduce the enhanced growth preference of LMC neurites against ephrin stripes that occurs after Sp1 overexpression. In comparison to GFP controls, axon length, neuron specification, and survival were normal in embryos co-expressing [p300]siRNA (or [CBP]siRNA) and GFP (Fig. 6A-K). Similarly, GFP+ LMC neurons displayed comparable proportions of electroporated cells in both LMC divisions (Fig. 6L). Medial LMC neurons co-electroporated with Sp1 and e[Isl1]::GFP showed significantly increased repulsion from ephrin-B2 stripes compared to controls expressing e[Isl1]::GFP alone (Fig. 6M, N). However, when these neurons were co-electroporated with [p300]siRNA and [CBP]siRNA, the intensified repulsion effect was eliminated compared to controls expressing Sp1 and e[Isl1]::GFP only or those co-expressing scrambled [p300]siRNA and scrambled [CBP]siRNA (Fig. 6O, P), indicating that p300 and CBP are essential for Sp1’s role in ephrin-mediated medial LMC axon guidance in vitro.

Sp1 coactivators, p300 and CBP, are required for Sp1-regulated guidance of cultured LMC neurites.
(A-L) All images are from chick embryos at HH stage 28/29, lumbar levels.
(A-C) Detection of Foxp1, Isl1, GFP, and p300 in LMC neurons from chick embryos electroporated with GFP (A), scrambled [p300]siRNA and GFP (B), or [p300]siRNA and GFP (C).
(D-F) Detection of Foxp1, Isl1, GFP, and CBP in LMC neurons from chick embryos electroporated with GFP (A), scrambled [CBP]siRNA and GFP (B), or [CBP]siRNA and GFP (C).
(G, H) Quantification of the effects of GFP, scrambled [p300]siRNA and GFP, or [p300]siRNA + GFP electroporation on p300 mRNA levels (G) and the effects of GFP, scrambled [CBP]siRNA and GFP, or [CBP]siRNA + GFP electroporation on CBP mRNA levels (H). The ratio of immunoreactivity between electroporated and un-electroporated contralateral sides (e/u ratio) was measured from at least 15 sections of 5 embryos.
(I) Quantification of the effects of GFP, scrambled [p300]siRNA and GFP, [p300]siRNA and GFP, scrambled [CBP]siRNA and GFP, or [CBP]siRNA and GFP electroporation on axon outgrowth. GFP+ LMC axon lengths were compared to the GFP control group, with measurements taken from at least 15 sections of 5 embryos.
(J) The number of LMC motor neurons is expressed as the average number of total (Foxp1+) LMC neurons per section (# Foxp1+ MNs/section). Numbers of embryos: n = 5 for all groups.
(K, L) The number of total or electroporated medial (Foxp1+ Isl1+) and lateral (Foxp1+ Isl1-) LMC motor neurons in the lumbar spinal cord is expressed as a percentage of total motor neurons [Foxp1+ MNs (%)] (K) or electroporated motor neurons [GFP+ MNs (%)] (L). Numbers of embryos: n = 5 for all groups.
(M-T) Growth preferences of medial or lateral LMC axons on protein stripes. Each experiment includes three panels (left, middle, and right) and one quantification.
(M-P) Left panels: Detection of medial (GFP+) LMC neurites from explants electroporated with GFP plasmid electroporated explants (M), Sp1 expression plasmid co-electroporated explants (N), Sp1 + scrambled [CBP]siRNA + scrambled [p300]siRNA (O), or Sp1 + [CBP]siRNA + [p300]siRNA (P) on eB2/Fc stripes. Middle panels: Inverted images showing GFP signals as dark pixels overlaid on substrate stripes. Right panels: Superimposed images of five representative explants from each group, highlighting the distribution of medial LMC neurites. Quantification of medial (GFP+) LMC neurites on the first (pink) and second (pale) stripes, expressed as a percentage of total GFP signals. A minimum of 88 neurites were analyzed. Numbers of embryos: n = 5 for all groups, with a minimum of 3 explants per embryo. (Q-T) Left panels: Detection of lateral (GFP+ EphA4+) LMC neurites from explants electroporated with GFP plasmid (Q), Sp1 expression plasmid (R), Sp1 + scrambled [CBP]siRNA + scrambled [p300]siRNA (S), or Sp1 + [CBP]siRNA + [p300]siRNA stripes. Middle panels: Inverted images showing EphA4 signals as dark pixels overlaid on substrate stripes. Right panels: Superimposed images of five representative explants from each group, highlighting the distribution of lateral LMC neurites. Quantification of lateral (EphA4+) LMC neurites on the first (pink) and second (pale) stripes, expressed as a percentage of total EphA4 signals. A minimum of 85 neurites were analyzed. Numbers of embryos: n = 5 for all groups, with a minimum of 3 explants per embryo.
eB2, ephrin-B2-Fc; eA5, ephrin-A5-Fc; *** = p<0.001; ** = p<0.01; * = p<0.05; statistical significance computed using Fisher’s exact test (A-L) or Mann-Whitney U test (M-T); solid lines in each scatterplot show the median difference. Scale bar: (A-F) 45 μm; (M-T) 150 μm
Similarly, lateral LMC neurons co-electroporated with Sp1 and GFP showed significantly increased repulsion from ephrin-A5 stripes compared to controls expressing GFP alone (Fig. 6Q, R). This repulsion was abolished when [p300]siRNA and [CBP]siRNA were co-electroporated, compared to controls co-expressing Sp1 and GFP alone or those co-expressing scrambled [p300]siRNA and scrambled [CBP]siRNA (Fig. 6S, T). These findings demonstrate that Sp1 cooperates with its coactivators, p300 and CBP, to regulate ephrin gene expression and mediate LMC axon pathfinding.
Locomotor function impairment in Sp1 mutants
To investigate the role of Sp1 in regulating motor function and neuronal connectivity, we performed a series of behavioral assays on adult Sp1F/Fand Syn1-Cre:Sp1F/F mice, aiming to assess locomotor activity, cognitive function, motor coordination, and muscle strength. We first evaluated general locomotor activity and anxiety-like behavior using the open field test (Figures 7A, B). Mice were placed in an open field arena, and both total distance traveled (an indicator of overall locomotor activity) and time spent in the center (a measure of anxiety-like behavior) were recorded over 60 minutes. There were no significant differences in either total distance or center duration between Sp1F/F and Syn1-Cre:Sp1F/Fgroups, suggesting that the deletion of Sp1 in neurons does not affect basic locomotor behavior or induce heightened anxiety. To further assess the cognitive function of the mice, we performed the Y-maze test (Figure 7C), which evaluates spatial working memory by measuring the proportion of spontaneous alternation between the maze arms. This test is commonly used to assess short-term memory and cognitive flexibility. Our data showed no significant differences in alternation percentages between the groups, indicating that spatial memory and cognitive flexibility remain unaffected by Sp1 loss. These results suggest that the cognitive processes underlying basic exploratory behavior and working memory are preserved in Sp1 mutant mice.

Sp1 mutant mice exhibit muscle strength and locomotor defects due to its regulation of ephrin activity in spinal motor neurons.
(A, B) Open field test: The total distance traveled (A) and the time spent in the center (B) were recorded over a 60-minute period.
(C) Y-maze test: The percentage of alternation between the arms was measured to assess cognitive performance.
(D) Rota-rod test: Mice were tested on an accelerating rota-rod (4-40 rpm) for a maximum duration of 300 seconds. The time until the mice fell from the apparatus was recorded as a measure of motor coordination.
(E) Grip strength test: Grip strength was measured using a grip strength meter, and the value was normalized to the body weight to represent the relative grip strength of the mice.
(F) Sp1, in combination with its co-activators p300 and CBP, regulates the accurate trajectory of LMC axons into the limb by controlling ephrin gene expression. This regulation mediates ephrin/Eph cis-attenuation and ephrin:Eph trans-signaling, ensuring proper axon guidance. Numbers of embryos: n = 8 for both groups in open field, Y-maze, and grip tests; n = 7 for Sp1F/F, and 11 for Syn1-Cre:Sp1F/Fgroups in Rota-rod test.
Despite the normal performance in general locomotor and cognitive tests, Syn1-Cre:Sp1F/F mice displayed significant deficits in motor coordination and muscle strength. In the Rota-rod test (Figure 7D), which assesses motor coordination and balance, Syn1-Cre:Sp1F/F mice showed a markedly reduced latency to fall compared to controls, indicating impaired motor coordination. This suggests that Sp1 is critical for maintaining motor function, particularly in tasks that require balance and coordination. Additionally, in the grip strength test (Figure 7E), Syn1-Cre:Sp1F/F mice exhibited significantly reduced grip strength compared to controls when normalized to body weight. This decrease in muscle strength highlights that the loss of Sp1 affects not only coordination but also the physical strength of motor output.
Taken together, the combination of our in vivo and in vitro studies demonstrates that while Sp1 deficiency disrupts motor coordination and muscle strength, which are likely due to aberrant ephrin/Eph signaling in spinal motor neurons, caused by the loss of Sp1-mediated transcriptional regulation of ephrin genes. Therefore, Sp1 plays a critical role in maintaining proper motor function through its regulation of axon guidance pathways in the spinal cord (Fig. 7F).
Discussion
Sp1 has been proposed to regulate several genes essential for early neuronal differentiation, axon growth, and synaptogenesis. Consequently, we explored its potential role in axon pathfinding in vivo and found that Sp1 is crucial for the accurate selection of motor axon trajectories in the limb. In this context, we discuss Sp1’s involvement in axon outgrowth, neuronal survival, differentiation, the role of CBP/p300 as coactivators in Sp1-mediated pathfinding within the LMC, and its implications for ephrin/Eph signaling.
Sp1 is critical for motor axon guidance but is not required for axon outgrowth, neuronal survival, or migration
Sp1 participates in numerous cellular functions, including neuronal development, axon outgrowth, survival, and differentiation. Research has shown that Sp1 plays diverse roles in both early and late stages of neuronal development, particularly in axon differentiation and growth, which are crucial for establishing neuronal connections (Okamoto et al., 2002; Billon et al., 1999; Mondanizadeh et al., 2015; Hung et al., 2020). For axon outgrowth, Sp1 is thought to regulate downstream target genes essential for cytoskeletal organization and neuronal signaling. Studies indicate that Sp1 controls the expression of GAP-43 (Growth-Associated Protein 43), crucial for axonal growth and regeneration, and Tau, which stabilizes microtubule structures in developing axons (Kawasaki et al., 2023; Heicklen-Klein et al., 2000; Santpere et al., 2006; Villa et al., 2013). Additionally, Sp1 regulates the expression of axon guidance molecules like Semaphorin receptors and ephrins, which direct axon navigation through interactions with external signals (Rossignol et al., 2003; Sohl et al., 2010; Arvanitis and Davy, 2012). Sp1 is also implicated in the regulation of ROCK1, a kinase that modulates cytoskeletal reorganization.
Studies suggest that Sp1 enhances ROCK1 expression, promoting axonal extension by controlling actin filament formation in neurons (Zhang et al., 2016; Wang et al., 2020). Interestingly, we did not observe changes in limb nerve axon outgrowth in chick embryos with altered Sp1 expression in LMC neurons. Although residual Sp1 expression after siRNA knockdown may be sufficient for axon outgrowth, Sp1 appears to have a limited impact on motor axon outgrowth. This may be due to different neuronal types expressing distinct repertoires of Sp1 targets and interacting with unique kinetics and affinities.
Beyond its role in axon outgrowth, Sp1 is also thought to play a part in neuronal differentiation and survival. Research has shown that Sp1 regulates neurotrophic factors such as brain-derived neurotrophic factor (BDNF), whose expression is essential for proper neuronal differentiation into mature forms (Guida et al., 2017). Their study found that the loss of Sp1 in neuronal cultures led to reduced BDNF expression and hindered neuronal differentiation, suggesting a role for Sp1 in determining neuronal fate. Additionally, Sp1 is implicated in regulating genes involved in synaptogenesis, such as synapsin I, which is vital for synaptic vesicle transport and neurotransmitter release. Sp1 promotes synapsin I expression, indicating its function in synapse maturation and activity during differentiation (Paonessa et al., 2013).
Collectively, these studies imply that Sp1 influences not only early neuronal differentiation but also synaptic development and connectivity. Furthermore, Sp1 is crucial for neuronal survival, especially under stress conditions (Ryu et al., 2003; Yeh et al., 2011). Studies have shown that Sp1 and Sp3, which are activated by oxidative stress, promote neuronal survival (Ryu et al., 2003). Sp1 is also reported to regulate Bcl-2 transcription from the proximal P2 promoter in neurons, supporting its role in promoting survival (Smith et al., 1998). Additionally, Sp1 influences the expression of p53, a well-known tumor suppressor involved in apoptosis. By repressing p53 activity in neurons, Sp1 provides a mechanism to support neuronal survival in conditions that might otherwise lead to cell death (Vousden et al., 2009; Beckerman et al., 2010; Levine et al., 2009). This delicate balance between enhancing survival factors and suppressing apoptotic genes is crucial for neuronal longevity. However, we did not observe noticeable changes in the number or positioning of LMC neurons when Sp1 expression was altered in chick or mouse embryos. This suggests that Sp1’s role in cell survival may be redundant, at least in motor neurons, and that its role in cell differentiation might be limited or stage-specific. Further investigation into the expression patterns of other Sp1 targets during different stages of spinal motor neuron differentiation may help clarify these points.
The necessity of CBP/p300 coactivators in Sp1-mediated LMC axon guidance is evident
Sp1 is expressed in most LMC neurons and is essential for correct axon trajectory in both medial and lateral LMC divisions, indicating a unique role in axon pathfinding within the LMC. This observation raises the question of how Sp1 influences guidance signaling through gene regulation. Research suggests that Sp1 regulates gene expression in neurons by interacting with coactivators such as CBP (CREB-binding protein) and p300 (Formisano et al., 2015; Toch et al., 2019; Lipinski et al., 2019). Sp1 is critical for activating the transcription of numerous neuronal genes, particularly those associated with synaptic plasticity and neuronal differentiation (Li et al., 2010; Safe et al., 2005). Additionally, Sp1 and its coactivators play roles in neuroprotection, mainly through the regulation of antioxidant genes. For example, studies have demonstrated that Sp1 upregulates antioxidant proteins like superoxide dismutase (SOD) in response to oxidative stress (Seo et al., 1996; Chang et al., 2017). Mutations or disruptions in Sp1 or its coactivator interactions can compromise these protective mechanisms, leading to increased neuronal vulnerability and degeneration, as seen in models of Huntington’s disease (Qiu et al., 2006; Steffan et al., 2000). Moreover, CBP and p300 are essential for maintaining synaptic plasticity, a key factor in learning and memory (Muller et al., 2022). Behavioral studies on CBP mutant mice also show deficits such as reduced locomotor habituation and impaired object recognition memory (Valor et al., 2011).
Overall, the interactions of Sp1 with CBP and p300 are fundamental to numerous neuronal functions, from development and plasticity to stress protection, highlighting the importance of this regulatory network in maintaining brain health. Disruptions in Sp1 or its coactivators not only impair normal neuronal function but also play a role in neurodegenerative disease pathogenesis, making Sp1 and its coactivators promising therapeutic targets. However, the exact role of CBP and p300 in Sp1-mediated axon guidance during neural circuit formation remains unclear. A possible model is that Sp1, together with CBP and p300, regulates the expression of guidance receptors or ligands, altering the ratio of neuron-expressed receptors to ligands, which in turn influences their interaction mode. Our findings, showing the loss of ephrin-mediated attenuation of ephrin/Eph signaling when Sp1 is depleted, along with the effects of non-phosphorylatable Sp1 and CBP/p300 loss on Sp1-mediated redirection, indicate that ephrin/Eph signaling may be a target of the Sp1/CBP/p300 regulatory complex in this context.
Sp1 function in ephrin/Eph signaling
Our findings indicate that although Sp1 is expressed in most LMC neurons, its role in ensuring accurate LMC axon trajectory selection appears to vary, with lateral LMC axon guidance depending more heavily on Sp1 than medial LMC pathfinding. This differential requirement for Sp1 may arise from the need for distinct pathways in guiding each LMC division. Strong evidence supports the involvement of ephrin-A:EphA and ephrin-B:EphB forward signaling in guiding lateral and medial LMC axons, respectively (Kania and Jessell, 2003; Luria et al., 2008; Marquardt et al., 2005; Dudanova et al., 2012). Additionally, studies suggest that Eph:ephrin reverse signaling also plays a role in LMC axon pathfinding (Marquardt et al., 2005; Dudanova et al., 2012). The varying sensitivity of lateral and medial LMC neurons to Sp1 might thus reflect a differing requirement for Sp1 in the transcription of ephrin-A and ephrin-B genes. Previous research also identifies Netrin-1 as a bifunctional ligand, attracting lateral LMC axons while repelling medial ones (Poliak et al., 2015). Furthermore, other systems, such as GDNF and Semaphorin3F, are proposed to influence the correct trajectory of motor axons from LMC subpopulations (Huber et al., 2005; Moret et al., 2007; Kramer et al., 2006; Dudanova et al., 2010). Although there is limited biochemical evidence linking Sp1 with receptors like Dcc, Unc5c, c-Ret, or Neuropilin2, our in vitro data—showing no significant change in LMC neurite growth preferences towards Netrin-1, Sem3F, or GDNF stripes following Sp1 knockdown—suggests that Sp1’s role in Netrin-1, Sema3F, or GDNF-mediated LMC pathfinding is minimal, highlighting the specificity of Sp1’s function in regulating Eph/ephrin signaling in this context.
Conclusion
In this study, we demonstrated that Sp1 is essential for motor axon trajectory selection in vivo. This is the first report identifying a significant role for Sp1 in Eph/ephrin signaling and directly comparing its involvement in ephrin-A-versus ephrin-B-mediated motor axon guidance. Our findings reveal the necessity of Sp1 in distinct Eph/ephrin pathways, underscoring the value of the LMC motor axon projection system as a model for studying simple axon guidance decisions and the function of the ephrin signaling machinery.
Materials and methods
Animals
Fertilized chick eggs (JD-SPF Biotech, Miaoli, Taiwan) were stored at 18°C for no longer than one week and incubated at 38°C, with developmental stages determined according to standard protocols (Hamburger and Hamilton, 1951). B6.Cg-Tg(Syn1-cre)671Jxm/J mice (Syn1-cre) were obtained from The Jackson Laboratory (Bar Harbor, ME, USA), while C57BL/6- Sp1tm1(GEMMS)Narl mice (Sp1F/F) were provided by the National Laboratory Animal Center (NLAC) in Tainan, Taiwan. All mice were bred and housed at the NLAC until they reached 8 weeks of age. The genotypes of Syn1-cre:Sp1F/F mice were confirmed by PCR, using the following primers: Internal control (Forward): CTAGGCCACAGAATTGAAAGATCT; Internal control (Reverse): GTAGGTGGAAATTCTAGCATCATCC; Syn1-cre (Forward): CTCAGCGCTGCCTCAGTCT; Syn1-cre (Reverse): GCATCGACCGGTAATGCA; Sp1 (Forward): AACAGGGGCTGGAACAATAG; Sp1flox/flox (Reverse): CGTGAGTTCAAGGGAAGACTGG. All mice were housed in an air-conditioned vivarium with ad libitum access to food and water, under a 12-hour light/dark cycle. All animal handling protocols, including for chick and mouse embryos, were approved by the Institutional Animal Care and Use Committee at Taipei Medical University (Approval Number: LAC-2020-0549).
Molecular biology
The characterization of expression constructs, including e[Isl1]::GFP, Sp1, and Sp1T278A, T739A, has been previously described (Kao et al., 2009; Chuang et al., 2008).
In situ hybridization cDNA probes were prepared as outlined in Kao et al. (2009). Briefly, target sequence amplification primers were designed using Primer3 version 0.4.0 software (Rozen and Skaletsky, 2000), with the probe size set between 600-800 bp. One-step RT-PCR was performed using the designed primers containing T7 polymerase promoters (Invitrogen) to amplify the cDNA template from chick HH stage 25/26 or mouse embryonic day 11.5 (e11.5) pooled brain RNA. The PCR products were purified through gel electrophoresis using a 1% agarose gel, followed by extraction using the QIAquick Gel Extraction Kit (Qiagen). The purified DNA was re-amplified via PCR, and the DNA yield was estimated using a Low DNA Mass Ladder (Invitrogen) after gel electrophoresis. DIG-labeled RNA probes were synthesized by in vitro transcription with T7 RNA polymerase, using the DIG RNA Labeling Kit (Roche). All probes were verified by sequencing. The source and recognized region for each probe are as follows: chick Sp1: NM_204604, 3943-4618; chick p300: XM_004937710, 4781-5484; chick CBP: XM_015294627, 3151-3836; mouse Sp1: NM_013672, 1270-1942; mouse p300: NM_177821, 4063-4773; mouse CBP: NM_001025432, 1279-2047. Details regarding Isl1 and Lim1 probes were previously described in Tsuchida et al. (1994).
Chick in ovo electroporation
Spinal cord electroporation of expression plasmids was performed at HH stage 18/19 in embryos of either sex, as previously described (Momose et al., 1999; Kao et al., 2009; Luria et al., 2008). Briefly, a 5-8 µg/µL solution of plasmid DNA in TE buffer (pH 7.5, 10 mM Tris-HCl and 1 mM EDTA, Invitrogen) was injected into the lumbar neural tube through a small window created in the eggshell under a stereomicroscope (SAGE Vision). The lower bodies of the chick embryos were electroporated using platinum/iridium electrodes (FHC) and the TSS20 electroporator (Ovodyne) with the following settings: 30 V, 5 pulses, 50 ms pulse width, at 1-second intervals. The eggshell windows were sealed with Parafilm (Pechinery Plastic Packaging) and the embryos were incubated at 38°C until they were harvested at HH stage 28/29. The efficiency of electroporation varied between 5-30% of total LMC neurons, depending on the plasmid construct size and DNA concentration used.
When untagged expression plasmids were electroporated alongside GFP expression plasmids or GFP-fused plasmids, their concentration was at least three times higher than that of GFP-fused plasmids to ensure efficient co-expression. SiRNA duplex oligonucleotides with 3’ TT overhangs were purified using MicroSpin G-25 columns (GE Healthcare) in TE buffer containing 20 mM NaCl (Sigma). A 1 µg/µL GFP expression plasmid was co-electroporated with the siRNA solution to label motor axons. The sequences of the siRNA sense strands are as follows: [Sp1]siRNA, 1:1 mixture of GCAACATCACCTTGCTGCCTGTCAA and CCAAGCACATCAAGACCCACCAGAA; scrambled [Sp1]siRNA, 1:1 mixture of GCAACTATTCCGTCGGTCCTCACAA and CCACACCTAGAACCACACACAGGAA; [p300]siRNA, 1:1 mixture of CCTGGCACAAGATGCTGCCTCTAAA and TGGCCGAGGTGTTTGAGCAAGAAAT; scrambled [p300]siRNA, 1:1 mixture of CCTCACGAAGTAGTCTCCTCGGAAA and TGGGAGGTGTTTGAGCAAGACCAAT; [CBP]siRNA, 1:1 mixture of TCTCCGCCAGCGATAGCACAGATTT and CAACGTGCTGGAAGAAAGCATTAAA; scrambled [CBP]siRNA, 1:1 mixture of TCTACCGAGCGCGATGACAACCTTT and CAATCGTAAGGAAAGTACGTGCAAA.
HRP retrograde labeling of LMC motor neurons
Retrograde labeling of mouse motor neurons was carried out as previously described (Luria et al., 2008; Poliak et al., 2015). Briefly, e12.5 embryos of either sex were dissected at the thoracic level and incubated at room temperature in aerated DMEM/F12 medium (Invitrogen). A 20% solution of HRP (Roche) was used as the retrograde tracer, prepared by dissolving 100 mg of HRP in 450 µL of PBS and adding 50 µL of 10% lysophosphatidylcholine (Fluka) in PBS. The HRP solution was injected into either the dorsal or ventral forelimb proximal muscle group. Following injection, the embryos were incubated at 32°C under an infrared lamp, with continuous aeration using 95% air and 5% CO2. Fresh medium was added every 30 minutes for a total incubation period of 5 hours.
In vitro stripe assay
Protein carpets were generated using silicon matrices with a channel system as previously described (Knoll et al., 2007). The carpets consisted of alternating stripe patterns, where the first stripe contained a mixture of ephrin-Fc (or other ligand proteins) and Fc-specific Cy3 conjugate in a 4:1 weight ratio, and the second stripe contained only Fc reagents without the Fc-specific Cy3 conjugate. The e5 chick spinal motor column was dissected and collected as described in earlier studies (Gallarda et al., 2008; Kao and Kania, 2011). In brief, e5 chick embryos of either sex were collected in ice-cold motor neuron medium [Neurobasal (Invitrogen), B-27 supplement (1:50, GIBCO), 0.5 mM L-Glutamate (Sigma), 25 mM L-Glutamine (GIBCO), and Penicillin-Streptomycin (1:100, Wisent)]. The lumbar spinal cord was opened at the dorsal midline, allowing the excision of motor columns under a stereomicroscope. The spinal motor columns were identifiable as the bulging part of the open-book spinal cord. Sharp tungsten needles (World Precision Instruments) were used to remove the dorsal spinal cord at the lateral region, along with the floor plate and medial motor column (MMC) in the central region of the open-book spinal cord. The excised motor columns were trimmed into square-shaped explants, approximately one-fourth the width of the motor column. Between 10-20 explants were plated on laminin-coated (20 µg/mL, Invitrogen) 60-mm tissue culture dishes (Sarstedt), containing various combinations of protein stripe carpets in motor neuron medium. The cultures were incubated at 37°C in an atmosphere of 95% air and 5% CO2 for 18 hours.
In situ mRNA detection and immunostaining
Chick and mouse embryos were fixed in 4% paraformaldehyde (Sigma) in PBS, equilibrated in 30% sucrose in PBS, embedded in O.C.T. (Sakura Finetek), and stored at −80°C. Sections of 12 micrometers were prepared using a cryostat microtome (Leica).
In situ mRNA detection was performed as previously described (Schaeren-Wiemers and Gerfin-Moser, 1993; Kania and Jessell, 2003). Briefly, tissue sections were first fixed in 4% paraformaldehyde in PBS for 10 minutes at room temperature, washed three times with PBS, and then digested in Proteinase K solution [1 µg/mL Proteinase K (Roche) in 6.25 mM EDTA (pH 8.0) and 50 mM Tris (pH 7.5) (Invitrogen)]. The sections were acetylated for 10 minutes by immersion in a solution containing 6 ml triethanolamine (Sigma), 500 ml double-distilled H2O, and 1.30 ml acetic anhydride (Sigma). After PBS washes, the sections were incubated in hybridization buffer [50% formamide, 5X SSC (0.75 M NaCl, 0.075 M NaAc), 5X Denhardt’s (Sigma), and 500 µg/mL Salmon sperm DNA (Roche)] for 2 hours at room temperature, followed by overnight incubation at 72°C with DIG-labeled RNA probes (prepared as described) at a concentration of 2-5 ng/µL in hybridization buffer. After hybridization, the samples were immersed in 5X SSC at 72°C, followed by two washes in 0.2X SSC at 72°C for 45 minutes each, and finally a wash in 0.2X SSC at room temperature for 5 minutes. The tissues were then rinsed with B1 buffer (0.1 M Tris, pH 7.5, and 0.15 M NaCl) for 5 minutes, blocked in B2 buffer (10% heat-inactivated horse serum in B1) for 1 hour at room temperature, and incubated with anti-DIG antibody (1:5000 in B2, Roche) overnight at 4°C. Samples were rinsed with B1, equilibrated with B3 buffer (0.1 M Tris, pH 9.5, 0.1 M NaCl, 0.05 M MgCl2), and incubated with B4 buffer [100 mg/mL NBT, 50 mg/mL BCIP (Roche), and 400 mM Levamisole (Sigma) in B3] in the dark to detect bound anti-DIG antibodies. The reaction was stopped by immersion in water.
Immunostaining was performed as described in previous studies (Kao et al., 2009; Kao and Kania, 2011). Briefly, sectioned tissues or cultured explants were washed in PBS and incubated in blocking buffer [1% heat-inactivated horse serum in 0.1% Triton-X/PBS (Sigma)] for 5 minutes, followed by overnight incubation at 4°C in the selected primary antibodies diluted in blocking solution. After primary antibody incubation, the samples were washed with PBS and incubated with appropriate secondary antibodies for 1 hour at room temperature. Refer to Table 1 for a list of the antibodies used.

Antibodies and Fc reagents used
Image quantification
Images were acquired using either a Leica DM6000 microscope or an EVOS FL microscope (Thermo Fisher). Quantification of GFP-labeled axonal projections was performed by thresholding and counting pixels in limb section images containing limb nerves (10-15 limb sections, each with a thickness of 12 micrometers), using Photoshop (Adobe). The dorsal or ventral limb nerve was identified by selecting the neurofilament channel and using the Lasso Tool, and pixel counts were obtained from the GFP channel by measuring the pixel intensity from the threshold to the maximal level, as indicated in the Histogram window. The number of motor neurons was quantified by counting cells in a series of spinal cord section images (5-10 sections from each embryo) using Photoshop. For quantification of GFP- or EphA4-labeled neurites in cultured motor neuron explants growing on different stripe types, over-threshold pixel counts were performed for the first and second stripe types across multiple images using Photoshop. To reduce potential experimental bias, multiple limb sections were selected at intervals of 2-3 sections along the anteroposterior axis to cover the entire crural plexus of limb nerves in each embryo. Similarly, cultured LMC explants were randomly selected for quantification. Additionally, the proportions of total and electroporated motor neurons were quantified in most experimental groups to ensure that there were no significant changes in cell identity or abnormal cell death, allowing for a reliable subsequent analysis of axon growth preferences (dorsal/ventral, medial/lateral, or first stripe/second stripe).
Behavioral Experiments
For the behavioral assessments, including the open field test, Y-maze analysis, and grip strength test, the experimental mice were transported to the Taiwan Mouse Clinic at Academia Sinica, Taipei, Taiwan. The rota-rod test was conducted at the Animal Center of Taipei Medical University. An accelerating rota-rod (47650 Rota-Rod NG, Ugo Basile, VA, Italy) was used for this test, with the rotation speed gradually increasing from 4 to 40 rpm over the course of a 5-minute trial. Mice were placed on the rotating rod, and the time to fall was recorded. Each mouse underwent a training regimen consisting of three trials per day, with 30-minute intervals between trials, over the course of three consecutive days.
Statistical analysis
Data from experimental replicate sets were analyzed using Microsoft Excel. The means of combined proportions or cell counts were compared using the Fisher’s exact test to evaluate the proportions of medial/lateral LMC neurons in retrograde labeling experiments, or the Mann-Whitney U test for comparing the proportions of dorsal/ventral preferences in limb nerves or cultured LMC neurites growing on 1st stripe/2nd stripe. The threshold for statistical significance was set at p < 0.05 (Poliak et al., 2015). For behavioral experiments, a two-sample paired t-test was used to compare the means of the data (Kao et al., 2015).
Acknowledgements
This work was supported by the National Science and Technology Council, Taiwan (110-232-B-038-017-MY3), and the TMU Research Center of Cancer Translational Medicine from the Featured Areas Research Center Program within the framework of the Higher Education Sprout Project by the Ministry of Education in Taiwan. We thank Stephanie Ho for secretarial assistance. We thank the Taiwan Mouse Clinic, Academia Sinica and Taiwan Animal Consortium for the technical support in HCS, open field test, Y-maze analysis, and grip strength test. We appreciate that NLAC kindly provided the strain of C57BL/6-Sp1 tm1(GEMMS)Narl mice.
References
- Regulation and misregulation of Eph/ephrin expressionCell Adhesion & Migration 6:131–137Google Scholar
- Transcriptional regulation by p53Cold Spring Harbor Perspectives in Biology :2Google Scholar
- Cooperation of Sp1 and p300 in the induction of the CDK inhibitor p21^WAF1/CIP1 during NGF-mediated neuronal differentiationOncogene 18:2872–2882Google Scholar
- Purification and biochemical characterization of the promoter-specific transcription factor, Sp1Science 234:47–52Google Scholar
- Silencing of EphA3 through a cis interaction with ephrinA5Nature Neuroscience 9:322–330Google Scholar
- Ephexin1 is required for Eph-mediated limb trajectory of spinal motor axonsJournal of Neuroscience 38:2043–2056Google Scholar
- Specificity protein 1-modulated superoxide dismutase 2 enhances temozolomide resistance in glioblastoma, independent of O6-methylguanine-DNA methyltransferaseRedox Biology 13:655–664Google Scholar
- Phosphorylation by c-Jun NH2-terminal kinase 1 regulates the stability of transcription factor Sp1 during mitosisMolecular Biology of the Cell 19:1139–1151https://doi.org/10.1091/mbc.e07-09-0881Google Scholar
- Histone deacetylase 1 can repress transcription by binding to Sp1Molecular and Cellular Biology 19:5504–5511Google Scholar
- Genetic evidence for a contribution of EphA reverse signaling to motor axon guidanceJournal of Neuroscience 32:5209–5215Google Scholar
- Species-specific interaction of the glutamine-rich activation domains of Sp1 with the TATA box-binding proteinMolecular and Cellular Biology 14:1582–1593Google Scholar
- Sp3/REST/HDAC1/HDAC2 complex represses and Sp1/HIF-1/p300 complex activates ncx1 gene transcription in brain ischemia and ischemic brain preconditioning by epigenetic mechanismJournal of Neuroscience 35:7332–7348Google Scholar
- Segregation of axial motor and sensory pathways via heterotypic trans-axonal signalingScience 320:233–236Google Scholar
- p38/Sp1/Sp4/HDAC4/BDNF axis is a novel molecular pathway of the neurotoxic effect of methylmercuryFrontiers in Neuroscience 11:8Google Scholar
- A series of normal stages in the development of the chick embryoJournal of Morphology 88:49–92Google Scholar
- Differential intranuclear organization of transcription factors Sp1 and Sp3Molecular Biology of the Cell 16:4073–4083Google Scholar
- Tau promoter confers neuronal specificity and binds Sp1 and AP-2Journal of Neurochemistry 75:1408–1418Google Scholar
- Molecular cloning and functional analysis of Drosophila TAF110 reveal properties expected of coactivatorsCell 72:247–260Google Scholar
- Modulation of EphA receptor function by coexpressed ephrinA ligands on retinal ganglion axonsNeuron 22:731–742Google Scholar
- Sp1 in astrocyte is important for neurite outgrowth and synaptogenesisMolecular Neurobiology 57:261–277Google Scholar
- Sp1 in astrocyte is important for neurite outgrowth and synaptogenesisMolecular Neurobiology 57:261–277Google Scholar
- α2-chimaerin is required for Eph receptor-class-specific spinal motor axon guidance and coordinate activation of antagonistic musclesJournal of Neuroscience 35:2344–2357Google Scholar
- SRC family kinases are required for limb trajectory selection by spinal motor axonsJournal of Neuroscience 29:5690–5700Google Scholar
- Ephrin-mediated cis-attenuation of Eph receptor signaling is essential for spinal motor axon guidanceNeuron 71:76–91Google Scholar
- Topographic motor projections in the limb imposed by LIM homeodomain protein regulation of ephrin-A interactionsNeuron 38:581–596Google Scholar
- Coordinate roles for LIM homeobox genes in directing the dorsoventral trajectory of motor axons in the vertebrate limbCell 102:161–173Google Scholar
- Mechanisms of ephrin-Eph signalling in development, physiology and diseaseNature Reviews Molecular Cell Biology 17:240–256Google Scholar
- Analysis of medaka GAP43 gene promoter activity in transgenic linesGene 879:147590Google Scholar
- Stripe assay to examine axonal guidance and cell migrationNature Protocols 2:1216–1224Google Scholar
- The tumor suppressor p53 and histone deacetylase 1 are antagonistic regulators of the cyclin-dependent kinase inhibitor p21/WAF1/CIP1 geneMolecular and Cellular Biology 23:2669–2679Google Scholar
- The development of motor projection patterns in the chick hind limbJournal of Physiology 284:391–414Google Scholar
- The first 30 years of p53: growing ever more complexNature Reviews Cancer 9:749–758Google Scholar
- The role of Sp1 and Sp3 in normal and cancer cell biologyAnnals of Anatomy 192:275–283Google Scholar
- CBP/p300 in brain development and plasticity: disentangling the KAT’s cradleCurrent Opinion in Neurobiology 59:1–8Google Scholar
- NF-κB site interacts with Sp factors and up-regulates the NR1 promoter during neuronal differentiationJournal of Biological Chemistry 279:17449–17458Google Scholar
- Specification of motor axon trajectory by ephrin-B signaling: symmetrical control of axonal patterning in the developing limbNeuron 60:1039–1053Google Scholar
- MicroRNA-124 regulates neuronal differentiation of mesenchymal stem cells by targeting Sp1 mRNAJournal of Cellular Biochemistry 116:943–953Google Scholar
- Coexpressed EphA receptors and ephrin-A ligands mediate opposing actions on growth cone navigation from distinct membrane domainsCell 121:127–139Google Scholar
- Transcription factor Sp1 is essential for early embryonic development but dispensable for cell growth and differentiationCell 89:619–628Google Scholar
- Regulation of transcription factor SP1 by the β-catenin destruction complex modulates Wnt responseMolecular and Cellular Biology :38Google Scholar
- Efficient targeting of gene expression in chick embryos by microelectroporationDevelopment Growth & Differentiation 41:335–344Google Scholar
- CBP/p300 activation promotes axon growth, sprouting, and synaptic plasticity in chronic experimental spinal cord injury with severe disabilityPLoS Biology :20Google Scholar
- The role of the ubiquitously expressed transcription factor Sp1 in tissue-specific transcriptional regulation and in diseaseYale Journal of Biology and Medicine 89:513–525Google Scholar
- Specificity protein 1 (Sp1)- dependent activation of the synapsin I gene (SYN1) is modulated by RE1-silencing transcription factor (REST) and 5’-cytosine-phosphoguanine (CpG) methylationJournal of Biological Chemistry 288:3227–3239Google Scholar
- Synergistic integration of Netrin and ephrin axon guidance signals by spinal motor neuronseLife :4Google Scholar
- Sp1 is up-regulated in cellular and transgenic models of Huntington disease, and its reduction is neuroprotectiveJournal of Biological Chemistry 281:16672–16680Google Scholar
- Opposing gradients of ephrin-As and EphA7 in the superior colliculus are essential for topographic mapping in the mammalian visual systemNeuron 47:57–69Google Scholar
- GC box-binding transcription factors control the neuronal specific transcription of the cyclin-dependent kinase 5 regulator p35Journal of Biological Chemistry 277:4455–4464Google Scholar
- Characterization of the neuropilin-1 promoter; gene expression is mediated by the transcription factor Sp1Journal of Cellular Biochemistry 88:744–757https://doi.org/10.1002/jcb.10384Google Scholar
- Primer3 on the WWW for general users and for biologist programmersMethods in Molecular Biology 132:365–386Google Scholar
- Sp1 and Sp3 are oxidative stress-inducible, antideath transcription factors in cortical neuronsJournal of Neuroscience 23:3597–3606Google Scholar
- Sp transcription factor family and its role in cancerEuropean Journal of Cancer 41:2438–2448Google Scholar
- Distinct subdomains of human TAFII130 are required for interactions with glutamine-rich transcriptional activatorsMolecular and Cellular Biology 18:5734–5743Google Scholar
- Abnormal Sp1 transcription factor expression in Alzheimer disease and tauopathiesNeuroscience Letters 397:30–34Google Scholar
- A single protocol to detect transcripts of various types and expression levels in neural tissue and cultured cells: in situ hybridization using digoxigenin-labelled cRNA probesHistochemistry 100:431–440Google Scholar
- Sp1 and C/EBP-related factor regulate the transcription of human Cu/Zn SOD geneGene 178:177–185Google Scholar
- Translational and transcriptional control of Sp1 against ischaemia through a hydrogen peroxide-activated internal ribosomal entry site pathwayNucleic Acids Research 39:5412–5423Google Scholar
- Bcl-2 transcription from the proximal P2 promoter is activated in neuronal cells by the Brn-3a POU family transcription factorJournal of Biological Chemistry 273:16715–16722Google Scholar
- Sp1 mediates hypoxia-induced ephrinB2 expression via a hypoxia-inducible factor-independent mechanismBiochemical and Biophysical Research Communications 391:24–27https://doi.org/10.1016/j.bbrc.2009.10.146Google Scholar
- Independent repression of a GC-rich housekeeping gene by Sp1 and MAZ involves the same cis-elementsJournal of Biological Chemistry 276:19897–19904Google Scholar
- The Huntington’s disease protein interacts with p53 and CREB-binding protein and represses transcriptionProceedings of the National Academy of Sciences USA 97:6763–6768Google Scholar
- CBP and p300 coactivators contribute to the maintenance of Isl1 expression by the Onecut transcription factors in embryonic spinal motor neuronsMolecular and Cellular Neuroscience 101:103411Google Scholar
- Development of the major pathways for neurite outgrowth in the chick hindlimbDevelopmental Biology 109:193–214Google Scholar
- Topographic organization of embryonic motor neurons defined by expression of LIM homeobox genesCell 79:957–970Google Scholar
- Ablation of CBP in forebrain principal neurons causes modest memory and transcriptional defects and a dramatic reduction of histone acetylation but does not affect cell viabilityJournal of Neuroscience 31:1652–1663Google Scholar
- Expression of the transcription factor Sp1 and its regulatory hsa-miR-29b in peripheral blood mononuclear cells from patients with Alzheimer’s diseaseJournal of Alzheimer’s Disease 35:487–494Google Scholar
- Blinded by the Light: The Growing Complexity of p53Cell 137:413–431Google Scholar
- MicroRNA-135a-5p promotes the functional recovery of spinal cord injury by targeting SP1 and ROCKMolecular Therapy Nucleic Acids 22:1063–1077Google Scholar
- Transcription factor Sp1 promotes the expression of porcine ROCK1 geneInternational Journal of Molecular Sciences 17:112Google Scholar
- Ablation of NF1 function in neurons induces abnormal development of cerebral cortex and reactive gliosis in the brainGenes & Development 15:859–876https://doi.org/10.1101/gad.862101Google Scholar
Article and author information
Author information
Version history
- Sent for peer review:
- Preprint posted:
- Reviewed Preprint version 1:
Cite all versions
You can cite all versions using the DOI https://doi.org/10.7554/eLife.105518. This DOI represents all versions, and will always resolve to the latest one.
Copyright
© 2025, Liao et al.
This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.
Metrics
- views
- 175
- downloads
- 9
- citations
- 0
Views, downloads and citations are aggregated across all versions of this paper published by eLife.