Abstract
Aging-associated decline in brown adipose tissue (BAT) function and mass contributes to energy and metabolic homeostasis disruption. Alcohol dehydrogenase 5 (ADH5) is a major denitrosylase that prevents cellular nitro-thiol redox imbalance, an essential feature of aging. However, the functional significance of BAT ADH5 in the context of aging is largely unknown. Here, we aimed to investigate the role of BAT ADH5 in protecting against age-related metabolic dysfunction. We show that aging promotes aberrant BAT protein S-nitrosylation modification and downregulates ADH5 in mice. Furthermore, BAT ADH5-deletion accelerates BAT senescence and aging-associated declines in metabolic homeostasis and cognition. Mechanistically, we found that aging inactivates BAT Adh5 by suppressing heat shock factor 1 (HSF1), a well-recognized proteostasis regulator. Moreover, pharmacologically enhancing HSF1 improved BAT senescence, metabolic decline, and cognitive dysfunction in aged mice. Together, these findings suggest that the BAT HSF1-ADH5 signaling cascade plays a key role in protecting against age-related systemic functional decline. Ultimately, unraveling the role of thermogenic adipose nitrosative signaling will provide novel insights into the interplay between BAT nitric oxide bioactivity and metabolism in the context of aging.
Highlights
Aging elevates general protein S-nitrosylation while downregulating ADH5 expression in BAT.
Loss of thermogenic adipose tissue ADH5 accelerates BAT senescence and exacerbates aging- associated metabolic and cognitive dysfunctions.
Disruption of HSF1-activated Adh5 in BAT contributes to aging-associated metabolic and cognitive impairments.
Pharmacological targeting of BAT HSF1 alleviates aging-related BAT senescent and systemic declines.
1. Introduction
Brown adipose tissue (BAT) is essential for classical nonshivering thermogenesis by utilizing intracellular and systemic lipid and glucose fuels[1–3]. Accumulated evidence shows longer-lived mice have highly active BAT presenting increased mass and thermogenic-metabolic function[4; 5]. In humans, the beneficial effects of BAT depots have been demonstrated against deleterious outcomes of aging and age-related diseases such as cardiovascular disease (CVD)[6]. Notably, in rodents and humans, improvement of BAT activity ameliorates aging-mediated hyperglycemia and hyperlipidemia[7–12]. However, BAT mass and function decline with age leading to impaired BAT metabolic capacity, the onset of age-related diseases and, ultimately, shortened lifespan[13–16]. Therefore, it is urgent to understand the multifaceted cellular and systemic factors that promote age-associated pathologies to design new therapeutics for healthy aging.
The mechanisms underlying aging are diverse and complex involving cell autonomous as well as systemic and environmental factors. These include increased production of reactive oxygen and nitrogen species (ROS and RNS, respectively) paired with reduced antioxidant capacity, mitochondrial defects[17–19], cellular senescence, and metabolic dysfunction[19–23]. Moreover, aged and senescent cells accumulate damaged proteins leading to disrupted proteostasis[24]. Although mitochondrial dysfunction, aberrant redox network remodeling, and proteostasis are key features in aging as well as deleterious factors implicated in BAT dysfunction[25–31], the molecular mechanisms and modulators linking these signaling cascades in BAT aging are largely unknown.
Intracellularly, ROS and RNS are redox mediators that regulate diverse aspects of cellular processes including modulating protein function[32]. For example, redox modification of protein cysteine residues plays critical roles in physiology and pathologies including aging[32]. In BAT, it has been demonstrated that acute thermogenic induction generates physiologic levels of mitochondrial ROS which activates uncoupling protein 1 (UCP1) by sulfenylation[28; 33]. Furthermore, cysteine oxidation networks in BAT are selectively modified in young mice and lost in aged animals[34]. Excessive nitric oxide (NO) production and the resultant aberrant NO-mediated protein cysteine nitrosylation (S-nitrosylation, SNO) induce nitrosative stress which disrupts essential aspects of cellular function including organelle homeostasis, inflammatory responses, and metabolism, all of which decline during aging[35; 36]. However, the functional significance of RNS in aging-related BAT dysfunction remains uncharacterized. Alcohol dehydrogenase 5 (ADH5; also named S-nitrosoglutathione reductase, GSNOR) is the major cellular denitrosylase that regulates NO availability in the cell by catalyzing the breakdown of SNOs and balancing the intracellular thiol redox status[35; 37; 38]. Recently we demonstrated that BAT ADH5 protects against obesity-associated metabolic dysfunction[39]. Here we revealed the functional impact of the proteostasis master regulator, heat shock factor 1 (HSF1), on BAT ADH5 in the context of aging. Our study provides a novel insight into the BAT NO bioactivity-linked interplay between proteostasis and metabolic dysfunction in aging.
2. Materials and methods
2.1 Nanoclay-mediated drug delivery
Nanoclay (NC, Laponite XLG) was obtained from BYK Additives Inc. TX, USA. Rat tail Type I collagen (RatCol) and Neutralization solution were procured from Advanced Biomatrix, Carlsbad, CA (5153). HSF1A was bought from Millipore, Burlington, MA (1196723-93-9). For the Collagen-NC gel, 850 µL of cold collagen stock solution (4.1 mg/ml) was added to 50 µL of Nanoclay stock solution (10 mg/ml). For collagen-NC-HSF1A, 50 µL of Nanoclay stock solution (10 mg/ml) was mixed with 3.33 µL HSF1A and then mixed with 850 µL of cold collagen stock solution (4.1 mg/ml). All gels were supplemented with 90 µL neutralization buffer and kept on ice prior to sub-BAT injection.
Based on the structure of HSF1A, the concentration was determined by UV-Vis spectroscopy. Firstly, a standard curve of HSF1A was obtained by measuring the UV-Vis spectrum of different concentrations of HSF1A in PBS (1.25, 2.5, 5, 10, 20 µM). Thereby, two standard curves at 207 nm and 284 nm were generated. Next, two types of collagen gels with or without Nanoclay were fabricated to study the release profile. Briefly, 50 µL of DI water (for Col-HSF1A) or Nanoclay stock solution (for Col-NC-HSF1A) was mixed with 3.33 µL of HSF1A and the mixture was added to 850uL of cold collagen solution and mixed well with a pipette. Then 90 µL of neutralization buffer was added and mixed with a pipette. Finally, the mixed solution was divided into 3 parts and placed at 37°C for 30 min. After gelation, 1mL of fresh PBS buffer was added to each tube for HSF1A release. At each time point (1, 5, 9, 14, 21 days), the PBS buffer in each tube was collected for UV-Vis spectroscopy.
2.2 Mouse models
Animal care and experimental procedures were performed with approval from the University of Iowa’s Institutional Animal Care and Use Committee. Animals received humane care in compliance with the Guide for the Care and Use of Laboratory Animals (National Academies Press, 2011) and with the Principles of Laboratory Animal Care formulated by the National Society for Medical Research. C57BL/6J mice (The Jackson Laboratory, 000664), UCP1-cre (The Jackson Laboratory, B6.FVB- Tg(UCP1-cre)1Evdr/J, 024670), and Adh5fl [40] mice were kept on a 12-hr light/dark cycle. At 9-11 months, NC-Collagen or NC-HSF1A was interscapularly administrated at a dosage of 1 mM/mouse or 0.2 mg/kg. For indirect calorimetry analysis, 12-month-old mice were singly housed in an environmental chamber during a 12-hour light cycle (Metabowl; Jencons Scientific). Mice were given access to standard 2920X Teklad Global Diet and water ad libitum while in cages. All tissues were harvested, frozen in liquid nitrogen, and kept at −80°C until processed.
2.3 BAT explants treatment
For HSF1 inhibition, BAT explants from WT mice were exposed to 2 µM KRIBB11 (Sigma, 385770) for 24 hr. For HSF1 activation, explants were treated for 24 hr with HSF1A (20 µM). All tissues were harvested, frozen in liquid nitrogen, and kept at −80°C until processed.
2.4 Quantitative Real-time RT-PCR
Total RNA was isolated using TRIzol reagent (Invitrogen,15-596-018) and reverse transcribed into cDNA using the iScript cDNA synthesis kit (Bio-Rad, 1708890). Quantitative real-time RT-PCR analysis was performed using SYBR Green (Invitrogen, KCQS00). Primer sequences are found in Table S1.
2.5 Chromatin immunoprecipitation (ChIP) assay
The chromatin immunoprecipitation assay was performed using the SimpleChIP Enzymatic Chromatin IP Kit (Cell Signaling Technology, 9003) with some modifications. Briefly, BAT was crosslinked with 1% formaldehyde (Sigma-Aldrich, F8775), after which the reaction was stopped by washing with ice-cold PBS (Gibco, 14,190,144) containing 0.125 M glycine (americanBio, AB00730-10,000) and protease inhibitor (Sigma-Aldrich, P8849). Nuclei were then isolated, and the chromatin was immunoprecipitated with protein A/G magnetic beads (Thermo Fisher Scientific, 88,802) conjugated with anti-IgG (Cell Signaling Technology, 2729) and anti-HSF1 (Cell Signaling, D3L8I, 12972) overnight at 4°C. The DNA was eluted from the beads and subjected to PCR analysis. The primers used for ChIP assays were mouse Adh5 Forward: -1735 to -1716; TGCTCCTACTCTCTCTCCCC; mouse Adh5 Reverse: -1645 to -1624; AGCCCTTTTGTTCCTTTTCACA.
2.6 Western blot analysis
Proteins were extracted from BAT and subjected to SDS–polyacrylamide gel electrophoresis, as previously described[43]. Membranes were incubated with anti-CoxI (Santa Cruz, H-1, sc-166573), anti-CoxII (Santa Cruz, H-3, sc-376861), anti-CoxIII (Santa Cruz, N-20, sc-23986), anti-CoxIV (Santa Cruz, C-20, sc-23982) or anti-Cox5a (Santa Cruz,(A-5), sc-376907) antibodies at 1:1000 dilution and then incubated with the appropriate secondary antibody conjugated with horseradish peroxidase (1:5000, Santa Cruz, sc-2005 or 1:5000, Cell Signaling Technology, 7074S). The signal was detected using the ChemiDoc Touch Imaging System (Bio-Rad), and densitometry analyses of western blot images were performed by using the Image Lab software (Bio-Rad).
2.7 S-nitrosylation detection
In situ detection of S-nitrosylated protein: The assay was performed as described with minor modifications[44]. Briefly, frozen BAT sections were fixed with 3.5% paraformaldehyde, and then permeabilized with 0.1% Triton X-100 in PBS containing 1 mM EDTA and 0.1mM neocuproine. Biotin- switch assay was performed by first blocking free thiols using HENS buffer containing 20 mM MMTS at room temperature for 30 min. Then the S-nitrosylated proteins were labeled in HENS buffer with 0.4 mM biotin-HPDP and 10 mM ascorbic acid for 1-hr. Biotinylated proteins were labeled using streptavidin conjugated with Alexa 488 (ThermoFisher Scientific, A32731). The images were observed using a Zeiss 700 confocal or Leica fluorescence microscope and quantified using ImarisColoc (Bitplane).
Detection of S-nitrosylation proteins: Total S-nitrosylated proteins in BAT were detected by S- nitrosylation Western Blot Kit (Thermo Fisher Scientific). Briefly, BAT was lysed in HEN buffer and 500 µg protein was used for each sample. Free cysteines were first blocked with MMTS for 20 min at 50°C. Following precipitation, using 4× volume of cold acetone for 60 min at −20°C, S-nitrosylated cysteines were selectively labeled with iodoTMT reagent in the presence of 20 mM sodium ascorbate at RT for 2 hr. Samples were then separated by SDS-PAGE and blotted to the membrane for detection of SNO proteins by the anti-TMT antibody.
2.8 Immunohistochemistry, Immunofluorescence and ELISA
For immunohistochemistry, iBAT or iWAT depots were fixed with 4% PFA and sectioned at 5 μm thick, followed by deparaffinization and rehydration processes. Tissue sections were stained using H&E. The images were observed under a Nikon microscope (10x). For immunofluorescence (IF), sections were blocked and incubated overnight at 4°C with appropriate antibody including F4/80 (Cell Signaling, D4C8V, 30325), p16 INK4A (Cell Signaling, E6N8P, 18769) and HSF1 (Cell Signaling, D3L8I, 12972) at 1:100 followed by anti-rabbit (Cell Signaling, 7074) for one hour at RT (1:2000). Nuclei were stained with 4′,6-diamidino-2-phenylindole (1:2500, DAPI). Images were taken using an LSM 880 confocal microscope (Carl Zeiss) and analyzed with NIH ImageJ.
For IL 1β measurement, multiplex cytokine analysis was performed via Bio-Rad Laboratories Bio-plex Pro Mouse Cytokine 23-Plex according to the manufacturer’s instructions for plasma cytokine analysis. Samples were analyzed on a Bio-Rad Laboratories Bio-Plex (Luminex 200) analyzer in the University of Iowa Flow Cytometry Core Facility.
2.9 Transmission Electron Microscopy (TEM)
Brown adipose tissues were removed and cut into ∼1 mm3 cubes. All electron microscopy (EM)-related reagents were from Electron Microscopy Sciences. Samples were fixed in 2.5% glutaraldehyde and 4% formaldehyde cacodylate buffer overnight (16 hours) at 4°C. Tissue was postfixed in fresh 1% OsO4 for 1 hr, dehydrated using a graded alcohol series followed by propylene oxide, and embedded in Epon resin as previously described[45]. Resin blocks were trimmed with a glass knife, cut to ultrathin (50–70 nm) sections with a diamond knife, and mounted on Formvar-coated copper grids. Grids were double contrasted with 2% uranyl acetate and then with lead citrate. Images were captured by a Hitachi HT7800 transmission electron microscope. Cell area was determined using ImageJ.
2.10 Barnes maze and rotarod studies
Barnes Maze [46] testing was performed on a 91cm diameter round surface with holes of 5cm diameter equally spaced around the edge (Noldus). The escape chamber was placed randomly under one of the holes and remained in place throughout training. The maze was surrounded with white cloth baring four visual markers for orientation, and a light was placed above the maze. Each mouse was trained for four days, with four trials in each day. For mice that did not locate the escape chamber within 3 minutes, they were guided to the hole with the escape chamber. Short and long term memory based on spatial cues was measured using the Ethovision XT 11.5 video tracking software (Noldus) and confirmed by manual tracking. Rotarod testing took place after training on the Rotamex-5 rotarod (Columbus Instruments). The rotarod spun at 5 rpm, time on the rod until completely falling off was measured at regular intervals with a maximum of 60 seconds.
2.11 Metabolic Phenotyping
Whole-body energy expenditure and body composition and glucose tolerance: Whole-body energy expenditure (VO2, VCO2), food intake, and locomotor activity were monitored using a Comprehensive Lab Animal Monitoring System (CLAMS, Columbus Instruments) at the Fraternal Order of Eagles Metabolic Phenotypic Core. Body composition was measured by using Bruker Minispecs (LF50). For the Glucose tolerance test, animals were fasted for 16 hr prior to GTT. Glucose tolerance was tested by measuring glucose concentration at different time points after an intraperitoneal (IP) glucose injection (0.8-1.25 g/kg body weight, 50% dextrose, Hospra Inc, 0409-6648-02)[47].
2.12 Echocardiography
Transthoracic echocardiograms were performed on conscious mice in the University of Iowa Cardiology Animal Phenotyping Core Laboratory using a VisualSonics Imaging system using a 30 Mhz transducer. The echocardiographer was blinded to the treatments and genetic backgrounds of the animals. Short- axis images were acquired parallel to the mitral valve plane to obtain the largest cross-sectional image of the left ventricle which included papillary muscles. Long-axis views were obtained perpendicular to the mitral valve plane and were deemed optimal when the diastolic apex-to-base length was the longest including the aortic valve with ascending aorta.
2.13 Metabolomic Analysis
Tissue samples: Whole BAT tissue was homogenized in ice-cold extraction buffer containing 2 parts methanol, 2 parts acetonitrile, 1 part water with internal standards (Cambridge Isotope Laboratories). Samples were then rotated for an hour at -20°C prior to centrifugation (10 minutes, 21,000 x g). 150 µl of the cleared extracts were moved to autosampler vials and vacuum dried (SpeedVac vacuum concentrator, Thermo). Samples were then reconstituted in 30 µl of methoxyamine (MOX, 11.4 mg/ml) in anhydrous pyridine, vortexed for 5 minutes, and heated for an hour at 60°C. 20 µl of N, O- Bis(trimethylsilyl)trifluoroacetamide (TMS) was added to each sample, which were then vortexed for another minute and heated for 30 minutes at 60°C.
GC-MS method: Derivatized samples were analyzed by GC-MS. 1 μl of derivatized sample was injected into a Trace 1300 GC (Thermo) fitted with a TraceGold TG-5SilMS column (Thermo) operating under the following conditions: split ratio = 20:1, split flow = 24 μl/min, purge flow = 5 ml/min, carrier mode = Constant Flow, and carrier flow rate = 1.2 ml/min. The GC oven temperature gradient was as follows: 80°C for 3 min, increasing at a rate of 20°C/min to 280°C, and holding at a temperature of 280°C for 8-min. Ion detection was performed by an ISQ 7000 mass spectrometer (Thermo) operated from 3.90 to 21.00 min in EI mode (-70eV) using select ion monitoring (SIM).
Data analysis: Raw data were analyzed using TraceFinder 5.1 (Thermo). Metabolite identification and annotation required at least two ions (target + confirming) and a unique retention time that corresponded to the ions and retention time of a reference standard previously determined in-house. A pooled sample generated prior to derivatization was analyzed at the beginning, at a set interval during, and at the end of the analytical run to correct peak intensities using the NOREVA tool[48]. NOREVA corrected data were then normalized to the total signal per sample to control for extraction, derivatization, and/or loading effects.
2.14 Quantification and Statistical Analysis
Results are expressed as the mean ± the standard error of the mean (SEM); n represents the number of individual mice (biological replicates) or individual experiments (technical replicates) as indicated in the figure legends. We performed the Shapiro-Wilk Normality test in experiments that have a relatively large sample size (n>5) and found that these data pass the normality test (alpha=0.05). Data were further analyzed with two-tailed Student’s and Welch’s t-test for two-group comparisons or ANOVA for multiple comparisons. For both One-Way ANOVA and Two-Way ANOVA, Tukey’s post-hoc multiple comparisons were applied as recommended by Prism. In all cases, GraphPad Prism (GraphPad Software Prism 8) was used for the calculations.
3. Results
3.1 Aging elevates thermogenic adipose protein S-nitrosylation
To investigate the pathophysiological relevance of nitrosative signaling in BAT in the context of aging, we examined the general protein SNO status in BAT from young (3 and 6--month) and old mice (12 and 22-month) male C57BL/6J mice. Using both immunofluorescence (IF) and an iodoTMT-based S- nitrosylation (SNO) analysis, we found increased BAT-SNO of general proteins in older animals compared to young mice, (Fig. 1A&B). Protein S-nitrosylation is regulated by both nitric oxide synthase (NOS)-mediated NO generation and cellular denitrosylation[35] which is tightly controlled by the major denitrosylase, alcohol dehydrogenase 5 (ADH5; also named S-nitrosoglutathione reductase)[35; 38]. Here, we found that aging downregulated Adh5 in both BAT and inguinal white adipose tissue (iWAT) (Fig. 1C&D).

Age-induced BAT ADH5 reduction contributes to BAT senescence.
A. Representative images (63X) of protein S-nitrosylation staining (SNO) in BAT from young (3-month) or old mice (12- and 22-month). –AS: no ascorbate; negative control for SNO staining. Scale bar: 10 μm. B. Representative Western and densitometric analysis (normalized to ACTB input) of SNO proteins in BAT from 3- or 22-month-old wild-type mice. C&D. Adh5 expression (normalized to Gapdh) in BAT and iWAT respectively of Adh5fl and Adh5BKO mice. N= 3-7 mice/group. E. Levels of mRNAs in BAT of young (3-month) Adh5fl, Adh5BKO, or WT mice compared to 22-month-old WT by RT-qPCR. N= 3-10 mice/group. F. Representative images of H&E, IF of p16lNK4a, and β gal staining in BAT from age-matched Adh5fl and Adh5BKO mice. Scale bar: 10 μm in H&E and p16lNK4a, 50 μm in β gal staining. Right panel: quantified fluorescence intensities of p16lNK4a. 5 fields/mouse, n= 3 mice/group. Data are presented as means ± SEM. *indicates statistical significance relative to the 3-month groups, and #indicates genetic effects in mice at the same age; as determined by Student’s t-test in (B) and ANOVA followed by posthoc test in (C-E&F), p<0.05.
To determine the functional role of BAT-ADH5 in the context of aging, we next generated BAT ADH5 knockout (Adh5BKO) mice by crossing Adh5fl/fl mice (in a C57BL/6J background)[40] with a Ucp1-Cre transgenic mouse line[39]. One of the major drivers for the age-related decline is the induction of cellular senescence which is characterized by the induction of cell cycle inhibitors such as p16INK4a and Cdkn1a(p21) as well as senescence-associated secretory phenotype (SASP) markers (e.g., Il6 and Sesn1)[31; 49; 50]. As shown in Fig. 1E, BAT-ADH5 deletion increased senescence markers compared with Adh5fl mice at 3 months of age. Notably, there were comparable levels of senescent markers in BAT of young Adh5BKO mice with aged wild-type mice (Fig. 1E). Consistently, IF analysis and senescence-associated β-galactosidase (β gal) staining revealed increased p16Ink4a in Adh5BKO mice compared with its age-matched littermate controls (Fig. 1F). Collectively, these data indicate aging is associated with aberrant BAT ADH5-mediated nitric oxide activity, and loss of AHD5 accelerates BAT senescence.
3.2 BAT ADH5 deletion worsens age-associated functional decline
Redistribution of fat depots is a key feature of aging[51; 52]. Consistently, we found an age-associated increase in body weight and that loss of BAT ADH5 accelerated age-associated adiposity and lean mass loss (Fig. 2A&B). BAT is essential for maintaining whole-body energy expenditure and glucose homeostasis[53]. Therefore, we next determined the effect of BAT-ADH5 deletion on systemic energy and metabolic homeostasis in young (3 months) and aged mice (12 months). Metabolic profiling using indirect calorimetry assessment revealed that 12-month-old Adh5BKO mice had reduced heat and oxygen consumption compared with age-matched controls (Fig. 2C&D). These systemic energy balance results were further supported by worsened glucose intolerance in both young and older BAT- ADH5 deficient mice (Fig. 2E&F). Of note, the glucose intolerance in 3-month-old Adh5BKO mice was comparable to 12-month wildtype mice, indicating a potential for accelerated age-reduced metabolic function in mice with BAT Adh5 deletion.

BAT Adh5 deletion accelerates age-related functional declines.
A. Body weight, and B. Body composition of Adh5fl and Adh5BKO mice at indicated age (n= 5-22 mice/group). Inset: representative picture of Adh5fl and Adh5BKO mice at 12 months. C&D. Whole-body energy balance measured in Adh5fl and Adh5BKO mice housed within a metabolic cage (n= 5-7 mice/group). E-F. GTT and AUC from Adh5fl and Adh5BKO mice (n= 14-30 mice/group). G. Grip strength, H. Rotarod assessment, I. Barnes maze assessment of velocity, J. percent of time in target/nontarget zone and K. primary errors to escape hole in 19-month-old Adh5fl and Adh5BKO mice. N = 7-9 mice/group. L&M. Heart mass and left ventricle thickness (LV) from age-matched Adh5fl and Adh5BKO mice measured by echocardiography; n = 5-7 mice/group. Data are presented as means ± SEM. *indicates genetic effects in same-age mice, and #indicates age effects in the same type of mice; as determined by Student’s t-test (A, C, D, and G-M), and ANOVA in (B) or ANOVA of AUC in (F), p<0.05.
Aging reduces muscle quality[54], strength[55; 56] , and lower extremity performance[57]. We next compared sensorimotor changes in aged Adh5BKO mice with littermate controls. As shown in Fig. 2G&H, ADH5 deletion in the BAT significantly reduced grip strength and motor performance in 19- month-old mice compared to controls. Aging is a complex process associated with progressive cognitive impairment[58]. To answer whether and to what extent BAT ADH5 deletion alters murine neurological function, we next performed the Barnes maze test[46] in aged Adh5BKO mice and its littermate controls. Compared with controls, Adh5BKO mice exhibited reduced velocity (Fig. 2I), spatial learning, and short-term memory (decreased frequency within the target zone and increased primary errors) (Fig. 2J&K). Aging is a major risk factor for heart dysfunction whereas BAT protects against age- related diseases such as CVD[6]. Echocardiography revealed increased heart mass and LV thickness in 22-month-old Adh5BKO mice compared to age-matched controls (Fig. 2L&M). Together these data suggest that BAT ADH5 is required for maintaining metabolic, motor, cognitive, and cardiac functions in aging.
3.3 BAT ADH5 deletion augments aging-related inflammation and mitochondrial defects
Aging is characterized by chronic low-grade systemic inflammation as well as disruption of innate and adaptive immunity[59–63]. We found that BAT-specific Adh5 deletion increased proinflammatory markers in the SVF of BAT as well as serum ILIZI1β from young Adh5BKO mice compared to Adh5fl mice (Fig. 3A&B). To determine the effect of aging on ADH5-regulated BAT inflammation, we next measured F4/80 expression in BAT from aged Adh5BKO and Adh5fl mice. As shown in Fig. 3C, loss of the BAT- ADH5 increased the infiltration of F4/80-positive cells in both young and aged mice. Beige adipocytes residing in iWAT are activated by β3-adrenergic receptor stimulation leading to browning[64]. We also found an increase in F4/80-positive cell infiltration in iWAT of young and aged Adh5BKO mice compared with aged-matched controls (Fig. 3D). Together, these data imply that ADH5-deficient thermogenic adipocytes accelerate “inflammaging.”

BAT ADH5-deficiency augments age-associated BAT immuno-metabolic imbalances.
A. Gene expression of measured markers in SVF from BAT of Adh5fl or Adh5BKO mice. N= 3-5 mice/group. B. Plasma levels of IL-1β in 3-month-old Adh5fl or Adh5BKO mice measured by ELISA. N = 5-6 mice/group. C. Representative images (63X) and quantification of IF of F4/80 staining in BAT from Adh5fl or Adh5BKO mice at indicated age. N= 3 mice/group, 4-8 fields/mouse. Scale bar: 1 μm. D. F4/80 (63X, scale bar: 1 μm) staining and quantification in iWAT from Adh5fl or Adh5BKO mice at the indicated age. N= 3 mice/group, 4-8 fields/mouse. E&F. Representative Western blot and quantification of ETC proteins in BAT of 3-month-old Adh5fl or Adh5BKO mice (n= 3 mice/group). G. Representative TEM images of BAT from 3-month-old Adh5fl or Adh5BKO mice. Red arrow, the mitochondrion. Scale bar: 5 μm (I), 2 μm (II), and 1 μm (III). H. Quantification of mitochondrial area in TEM images of BAT in mice in (C). Quantification was performed using ImageJ software. I. Schematic summary of the BAT metabolomic analysis in Adh5fl or Adh5BKO mice (3-month-old) analyzed by using Metaboanalyst online software; n = 3 age-matched mice per group. Downregulated metabolites by ADH5 deletion are depicted in red; upregulated metabolites are depicted in green. Data are presented as means ± SEM. * indicates genetic effects in same-age mice as determined by Student’s t-test (A, B, F and H), and ANOVA (C&D), p<0.05.
Previously, we demonstrated that BAT-ADH5 deletion impairs BAT mitochondrial respiration in mice in response to cold and high-fat diet challenges[39]. Here, we found that BAT-ADH5-deletion decreased expression of the oxidative phosphorylation complexes I, III, and IV- key components of the mitochondrial electron transport chain (ETC) (Fig. 3E&F). Further assessment using transmission electron microscopy (TEM) analysis revealed smaller and aberrant cristae morphologies in BAT of Adh5BKO mice compared to controls (Fig. 3G&H). To determine the impact of the loss of ADH5 on BAT metabolic homeostasis, we next carried out a steady-state metabolomic analysis in BAT from age- matched Adh5BKO and Adh5fl mice using gas chromatography-mass spectrometry (GC-MS). As shown in Fig. 3I, deletion of BAT ADH5 significantly decreased glycolytic metabolites and TCA cycle intermediates, and elevated levels of branched-chain amino acids (BCAAs) in BAT of young mice. Together, these data implicate that BAT ADH5 is required to maintain mitochondrial morphology and metabolic function.
3.4 Activation of BAT-HSF1 improves aging-associated outcomes
HSF1 is the master regulator of the heat shock response (HSR), a highly conserved physiological stress response to diverse stimuli[65]. We previously showed obesity suppresses BAT HSF1 and the HSF1-induced ADH5 expression[39]. Here we found aging downregulates BAT HSF1 at both transcript and protein levels starting from 6 months of age (Fig. 4A&B). Chromatin immunoprecipitation (ChIP) assay further confirmed that HSF1 binds to the Adh5 promoter which was increased by a pharmacological HSF1 activator HSF1A (Fig. 4C)[39]. Consistently, pharmacological activation (HSF1A) or inhibition (KRIBB11) of HSF1 significantly increased or decreased the BAT Adh5, respectively (Fig. 4D&E).

HSF1 induces Adh5 and ameliorates senescence in BAT.
A. Hsf1 levels in BAT at indicated age (n= 6-12 mice/group) measured by qRT-PCR. Data were normalized to Gapdh. B. Left panel: representative HSF1 staining (63X, scale bar: 1 μm; zoomed images are on the right) from BAT of young and old wild-type mice. Right panel: quantification, n = 3-4 mice/age. 4-8 fields/mouse. C. Occupancy of Adh5 promoter regions by HSF1 from BAT treated with a pharmacological activator of HSF1 (HSF1A; Millipore, 20 μM, 24-hr) in controls or Adh5BKO mice (n= 3 mice/group). D. Levels of mRNAs encoding the indicated genes of BAT explants treated ex vivo with HSF1A (20 μM, 24-hr) or HSF1 inhibitor (KRIBB11; 2 μm, 24-hr). Data were normalized to Gapdh. N=4 mice/group. E. Levels of mRNAs of the indicated genes in SVF from 3- or 5-month-old BAT pad isolated from wild-type mice followed by treatment of HSF1A (20 μM, 24-hr). N=4 mice/age group. Data were normalized to Gapdh. Data are presented as means ± SEM. *indicates statistical significance compared to the 3-month groups (A&B), to the Adh5fl groups in (C), and to the control groups in (D-F) as determined by ANOVA in (A-D), and Student’s t-test in (E), p<0.05.
To establish the functional impact of the BAT HSF1-ADH5 axis in the context of aging, we utilized a nano clay (Nanosilicates, NS/NC)-mediated drug carrier system to ensure optimal drug-releasing efficiency, biocompatibility, and biodegradability[66–70]. Nanoclay mineral materials have excellent physicochemical characteristics necessary for drug delivery[71]. Here, collagen was used as a scaffold for NC-mediated HSF1A or vehicle delivery. As shown in Fig. 5A, compared with the collagen-HSF1A group, collagen-NC-HSF1A was effective in sustainably releasing compounds. Therefore, the collagen- NC-vehicle or collagen-NC-HSF1A formulation was injected interscapularly into the BAT of aged mice [39]. We found that one month after injection, activation of HSF1 significantly improved age-related systemic energy imbalance (Fig. 5B&C) and glucose intolerance (Fig. 5D). Moreover, these metabolic improvements were correlated with mitigated age-associated cognitive dysfunction (Fig. 5E&F), BAT morphology, as well as expression of senescent and inflammatory markers (Fig. G-J). Together, these data support the physiological relevance of BAT-HSF1 signaling in ameliorating aging-associated functional decline.

BAT HSF1 mitigates age-associated functional decline.
A. Comparison of release curves between Collogen-NC-HSF1A vs Collagen-HSF1A. B. Body weight measurement over time in 12-month-old wild-type mice after interscapular injection with Collagen-NC-Vehicle (NC-Vehicle) or Collagen-NC-HSF1A (NC-HSF1A; 0.1 mg). C. Heat, VO2, and energy expenditure (EE) in 12-month-old wild-type mice after one BAT injection of control (NC-Vehicle) or NC-HSF1A (0.1 mg; n= 5-6 mice/group). D. GTT and AUC of mice from (B). N= 19-37 mice/group. E. Latency (Barnes maze test) and F. AUC of escape measured from mice in (C) after one-month injection. N= 7-13 mice/group. G. Representative H&E (Scale bar: 20 or 10 μm) and IF of p16lNK4a (scale bar: 10 μm) in BAT from mice in (C). H. Quantitation of IF staining of p16lNK4a. N= 5 mice/group. 4-6 fields/images. I. Representative F4/80 staining of BAT from (C); quantitation is left of the image. Scale bar: 1 μm, n = 5 mice/group. 4-6 fields/images. J. Levels of mRNAs encoding genes of interest (normalized to Gapdh) in BAT from mice in (C). N = 3-9 mice/group. Data are presented as means ± SEM. *indicates statistical significance compared to the vehicle groups as determined by Student’s t-test, p<0.05.
4. Discussion
Aging is associated with a decline in thermogenic adipose tissue function and mass, contributing to disruption of energy and metabolic homeostasis as well as the prevalence of metabolic disease. Currently, several mechanisms have been implicated in age-dependent BAT decline including mitochondrial dysfunction, aberrant proteostasis, inflammation, and defective beiging[34; 72]. Here we provide the first evidence and mechanism by which nitrosative signaling links proteostasis to metabolic function in thermogenic adipose tissues in the context of aging.
In humans, aberrant nitric oxide bioactivity has been implicated in a diverse set of physiologies including aging[35; 36; 73]. It has been demonstrated that aging significantly changes BAT intracellular glutathione balance and systemic plasma nitrogen/arginine signatures[74], all of which are key components of the nitrosative signaling cascade. Notably, in humans, around 60% of plasma proteins significantly associated with aging are S-nitrosylated[75]. Specifically, in the BAT, more than 15% of protein cysteines are subject to oxidation modulating BAT physiology[28; 76]. However, the functional significance of BAT nitrosative signaling in aging remains undefined. Here we demonstrate an inverse correlation between ADH5 and aging-induced general BAT protein S-nitrosylation which is in line with previous studies demonstrating the relevance of ADH5 in aging. For example, recent studies demonstrated that AHD5 plays a critical role in DNA damage repair and chromatin architecture, and loss of this regulation leads to multisystem disorders and cancer progression[77–80]. Additionally, a genome-wide analysis has linked an ADH5-encompassing gene cluster to human longevity[81]. Finally, alterations in lifespan negatively correlate with Adh5 in senescent mouse embryonic fibroblasts, neurons, and peripheral blood mononuclear cells from aged humans[21]. We found that defective ADH5-regulated S-nitrosylation signaling accelerates BAT senescence. Future studies are needed to delineate the direct actions of ADH5 on the cellular senescence network in the BAT.
Previously, it was demonstrated that mice with germline ADH5 deletion display accelerated aging phenotypes including reduced immune responses, increased morbidity upon endotoxic shock, insulin resistance, skeletal muscle wasting, and accumulation of protein aggregates in the brain cortex which are associated with locomotor deficits[21; 73]. Systemically, we showed that mice with BAT ADH5 deletion displayed increased body weight gain, fat mass, and inflammation in aged mice compared with age-matched controls. These augmented aging-developed metabolic defects were concomitant with worsened sensorimotor and cognitive function. These results are in line with previous studies showing that dysregulation of ADH5-mediated protein S-nitrosylation compromises mitochondrial function in the heart[82] and brain[21] as well as mitochondrial dynamics in the context of aging[21]. Moreover, at the cellular level, we found that BAT ADH5 deficiency reduced ETC complex expression and disrupted mitochondrial morphology, which was associated with elevated BAT-branched chain amino acid (BCAA) levels implicating a potential defect in BAT fuel utilization in Adh5BKO mice. It is demonstrated that lactate and BCAA-derived metabolites control BAT mitochondrial redox homeostasis[83; 84] which in turn plays a key role in maintaining BAT metabolic function[85; 86]. Interestingly, recent studies in humans implicate an inverse correlation between BCAAs and longevity[87]. Furthermore, in rodents, impaired BCAA catabolism in adipose tissues promotes age-associated metabolic defects[88; 89]. Finally, in both human and animal studies, aberrant plasma levels of BCAAs serve as biomarkers for neurodegenerative diseases such as Parkinson’s and Alzheimer’s[89–92]. It is of great interest to explore to what extent BAT ADH5 regulates BCAA utilization in the future.
Excessive NO production by parenchymal cells drives immune cell infiltration and polarization in aging-associated diseases[93–95] and obesity[96]. Moreover, aberrant NO bioactivity and nitrosative stress modulate transcription factor activities that directly regulate inflammatory and adipogenic signatures[95; 97-100]. We found that loss of Adh5 in BAT elevates NO production from BAs[39] and increases proinflammatory genes in BAs and SVF (Fig. 3) suggesting that the excess NO released from Adh5 deficient BAs might serve as the signal-inducing proinflammatory mediator expression and immune cell activation leading to impaired BA mitochondrial function.
It is well recognized that heat shock factor 1 (HSF1) expression and activity decline in senescent human cells, thereby potentiating proteostasis collapse and the aging process[101; 102]. Indeed, HSF1-deficient organisms develop aging-related neurodegenerative disorders mainly caused by the accumulation of aggregates from misfolded proteins[26; 103; 104]. However, the mechanisms underlying multiple abnormalities, including developmental defects and increased expression of inflammatory cytokines, are unclear. In whole-body HSF1 KO mice, HSF1 deletion leads to cold intolerance and disrupted brown and beige function[105]. Notably, HSF1 levels are more abundant in thermogenic adipocytes[106] and restoration of HSF1 in BAT protects against obesity-associated BAT dysfunction[39; 105; 107]. Here, we showed that the age-dependent impairment of HSF1-Adh5 signaling cascades leads to disruption of BAT metabolic homeostasis. In contrast, activation of HSF1 using a novel nanoclay-mediated drug delivery system ameliorated age-associated cellular and systemic declines. Although the cause factors driving the age-suppressed HSF1 remain unknown and are of great interest for future studies, our study demonstrates a novel strategy to combat the thermogenic adipose decline in the context of aging. We recognize that nitrosative signals broadly influence cellular signaling cascades, and the functions of BAT are governed by diverse transcriptional and signaling programs, neuronal tone, as well as endocrine factors[1; 108-110]. Thus, we cannot rule out the possibility that the impact of Adh5 on mitochondrial dynamics and fuel utilization in the BAT is secondary to the disruption of other cellular functions. In future studies, we will examine the effect of Adh5 deletion on other organelle functions such as the endoplasmic reticulum and lysosomes.
Taken together, we provide the first evidence of NO bioactivity-modulated BAT immune-metabolic homeostasis as well as new mechanisms by which nitrosative signaling links proteostasis to metabolic function in thermogenic adipose tissue. Moreover, we highlight a new geroprotective strategy to counteract aging-associated cellular redox imbalance. Ultimately, this study will provide new avenues for developing novel therapeutic strategies to mitigate age-dependent loss of thermogenic adipocyte function and promote healthy aging.
Acknowledgements
We are grateful to all Yang laboratory members for supporting this project.
Additional information
Author Contributions
S.C.S., V.A.L., H.S., M.J.P., and L.Y. designed the research; S.C.S., T.N., Q.Q., A.A., Z.W., M.L. and A.B. performed experiments; S.C.S. and L.Y. analyzed the data; and S.C.S and L.Y. wrote the paper. S.C.S., M.J.P., and L.Y. are supported by R01DK126817, and T.N. was supported by NIH 5T90DE023520.
Funding
NIH (R01DK126817)
NIH (NIH 5T90DE023520)
References
- [1]Brown adipose tissue: function and physiological significancePhysiol Rev 84:277–359Google Scholar
- [2]Brown fat fuel utilization and thermogenesisTrends Endocrinol Metab 25:168–177Google Scholar
- [3]Brown adipose tissue mitochondria: modulation by GDP and fatty acids depends on the respiratory substratesBiosci Rep 32:53–59Google Scholar
- [4]Metabolic characteristics of long-lived miceFront Genet 3:288Google Scholar
- [5]Brown Adipose Tissue Function Is Enhanced in Long-Lived, Male Ames Dwarf MiceEndocrinology 157:4744–4753Google Scholar
- [6]Brown adipose tissue is associated with cardiometabolic healthNat Med 27:58–65Google Scholar
- [7]Recruited brown adipose tissue as an antiobesity agent in humansJ Clin Invest 123:3404–3408Google Scholar
- [8]Brown adipose tissue oxidative metabolism contributes to energy expenditure during acute cold exposure in humansJ Clin Invest 122:545–552Google Scholar
- [9]Brown adipose tissue regulates glucose homeostasis and insulin sensitivityJ Clin Invest 123:215–223Google Scholar
- [10]The role of brown and beige adipose tissue in glycaemic controlMol Aspects Med 68:90–100Google Scholar
- [11]The Therapeutic Potential of Brown Adipocytes in HumansFront Endocrinol (Lausanne) 6:156Google Scholar
- [12]Inflammaging: a new immune-metabolic viewpoint for age-related diseasesNat Rev Endocrinol 14:576–590Google Scholar
- [13]The Whitening of Brown Fat and Its Implications for Weight Management in ObesityCurr Obes Rep 4:224–229Google Scholar
- [14]Defective brown adipose tissue thermogenesis in obese miceInt J Obes 9:17–24Google Scholar
- [15]Mapping of human brown adipose tissue in lean and obese young menProc Natl Acad Sci U S A 114:8649–8654Google Scholar
- [16]Selective Impairment of Glucose but Not Fatty Acid or Oxidative Metabolism in Brown Adipose Tissue of Subjects With Type 2 DiabetesDiabetes 64:2388–2397Google Scholar
- [17]Oxidative stress, mitochondrial dysfunction, and agingJ Signal Transduct 2012:646354Google Scholar
- [18][Biology of aging]Rev Med Chil 137:296–302Google Scholar
- [19]The Good, the Bad, and the Ugly of ROS: New Insights on Aging and Aging-Related Diseases from Eukaryotic and Prokaryotic Model OrganismsOxid Med Cell Longev 2018:1941285Google Scholar
- [20]Free radical theory of aging: an update: increasing the functional life spanAnn N Y Acad Sci 1067:10–21Google Scholar
- [21]S- nitrosylation drives cell senescence and aging in mammals by controlling mitochondrial dynamics and mitophagyProc Natl Acad Sci U S A 115:E3388–E3397Google Scholar
- [22]Denitrosylate and live longer: how ADH5/GSNOR links mitophagy to agingAutophagy 14:1285–1287Google Scholar
- [23]The hallmarks of agingCell 153:1194–1217Google Scholar
- [24]Proteostasis and agingNat Med 21:1406–1415Google Scholar
- [25]Increased inflammation, oxidative stress and mitochondrial respiration in brown adipose tissue from obese miceSci Rep 7:16082Google Scholar
- [26]Regulation of HSF1 function in the heat stress response: implications in aging and diseaseAnnu Rev Biochem 80:1089–1115Google Scholar
- [27]Brown adipose tissue thermogenic adaptation requires Nrf1-mediated proteasomal activityNat Med 24:292–303Google Scholar
- [28]Mitochondrial ROS regulate thermogenic energy expenditure and sulfenylation of UCP1Nature 532:112–116Google Scholar
- [29]Mitochondrial (dys)function in adipocyte (de)differentiation and systemic metabolic alterationsAm J Pathol 175:927–939Google Scholar
- [30]Targeting the NO/superoxide ratio in adipose tissue: relevance to obesity and diabetes managementBr J Pharmacol 174:1570–1590Google Scholar
- [31]Mechanisms of Cellular Senescence: Cell Cycle Arrest and Senescence Associated Secretory PhenotypeFront Cell Dev Biol 9:645593Google Scholar
- [32]Role of ROS and RNS Sources in Physiological and Pathological ConditionsOxid Med Cell Longev 2016:1245049Google Scholar
- [33]Crucial yet divergent roles of mitochondrial redox state in skeletal muscle vs. brown adipose tissue energeticsFASEB J 26:363–375Google Scholar
- [34]A Quantitative Tissue-Specific Landscape of Protein Redox Regulation during AgingCell 180:968–983Google Scholar
- [35]Protein denitrosylation: enzymatic mechanisms and cellular functionsNat Rev Mol Cell Biol 10:721–732Google Scholar
- [36]Protein S-nitrosylation in health and disease: a current perspectiveTrends Mol Med 15:391–404Google Scholar
- [37]The role of S-nitrosoglutathione reductase (GSNOR) in human disease and therapyCrit Rev Biochem Mol Biol 52:340–354Google Scholar
- [38]A metabolic enzyme for S-nitrosothiol conserved from bacteria to humansNature 410:490–494Google Scholar
- [39]ADH5-mediated NO bioactivity maintains metabolic homeostasis in brown adipose tissueCell Rep 37:110003Google Scholar
- [40]Targeted deletion of GSNOR in hepatocytes of mice causes nitrosative inactivation of O6-alkylguanine-DNA alkyltransferase and increased sensitivity to genotoxic diethylnitrosamineCarcinogenesis 32:973–977Google Scholar
- [41]Isolation, Primary Culture, and Differentiation of Preadipocytes from Mouse Brown Adipose TissueMethods Mol Biol 1566:3–8Google Scholar
- [42]UCP1- independent signaling involving SERCA2b-mediated calcium cycling regulates beige fat thermogenesis and systemic glucose homeostasisNat Med 23:1454–1465Google Scholar
- [43]METABOLISM. S-Nitrosylation links obesity-associated inflammation to endoplasmic reticulum dysfunctionScience 349:500–506Google Scholar
- [44]S- nitrosylation of beta-catenin by eNOS-derived NO promotes VEGF-induced endothelial cell permeabilityMol Cell 39:468–476Google Scholar
- [45]Abeta-induced Golgi fragmentation in Alzheimer’s disease enhances Abeta productionProc Natl Acad Sci U S A 111:E1230–1239Google Scholar
- [46]Evaluation of spatial memory of C57BL/6J and CD1 mice in the Barnes maze, the Multiple T-maze and in the Morris water mazeBehav Brain Res 198:58–68Google Scholar
- [47]S-Nitrosoglutathione Reductase Dysfunction Contributes to Obesity-Associated Hepatic Insulin Resistance via Regulating AutophagyDiabetes 67:193–207Google Scholar
- [48]NOREVA: normalization and evaluation of MS-based metabolomics dataNucleic Acids Res 45:W162–W170Google Scholar
- [49]Growth hormone in adipose dysfunction and senescenceOncotarget 6:10667–10668Google Scholar
- [50]Targeting senescent cells enhances adipogenesis and metabolic function in old ageeLife 4:e12997https://doi.org/10.7554/eLife.12997Google Scholar
- [51]Anthropometric assessment of 10-y changes in body composition in the elderlyAm J Clin Nutr 80:475–482Google Scholar
- [52]Effects of age on body fat distribution and cardiovascular risk factors in womenAm J Clin Nutr 66:111–115Google Scholar
- [53]Brown adipose tissue improves whole-body glucose homeostasis and insulin sensitivity in humansDiabetes 63:4089–4099Google Scholar
- [54]Aging of the human neuromuscular systemMuscle Nerve 25:17–25Google Scholar
- [55]A 3-year longitudinal study on body composition changes in the elderly: role of physical exerciseClin Nutr 25:573–580Google Scholar
- [56]Attenuation of skeletal muscle and strength in the elderly: The Health ABC StudyJ Appl Physiol Google Scholar
- [57]Total body mass, fat mass, fat-free mass, and skeletal muscle in older people: cross-sectional differences in 60-year-old personsJ Am Geriatr Soc 49:1633–1640Google Scholar
- [58]Age-related changes in behavior in C57BL/6J mice from young adulthood to middle ageMol Brain 9:11Google Scholar
- [59]Global Transcriptome Analysis of Brown Adipose Tissue of Diet-Induced Obese MiceInt J Mol Sci 19Google Scholar
- [60]Toward an Understanding of How Immune Cells Control Brown and Beige AdipobiologyCell Metab 27:954–961Google Scholar
- [61]Aging and Immunometabolic Adaptations to ThermogenesisAgeing Res Rev 63:101143Google Scholar
- [62]T Cells in Adipose Tissue in AgingFront Immunol 9:2945Google Scholar
- [63]Long-term caloric restriction ameliorates deleterious effects of aging on white and brown adipose tissue plasticityAging Cell 18:e12948Google Scholar
- [64]Distinct cellular and molecular mechanisms for beta3 adrenergic receptor-induced beige adipocyte formationeLife 6Google Scholar
- [65]Regulation of aging and age-related disease by DAF-16 and heat-shock factorScience 300:1142–1145Google Scholar
- [66]Nanoclay Promotes Mouse Cranial Bone Regeneration Mainly through Modulating Drug Binding and Sustained ReleaseAppl Mater Today 21Google Scholar
- [67]Nanoclay-functionalized 3D nanofibrous scaffolds promote bone regenerationJ Mater Chem B 8:3842–3851Google Scholar
- [68]The osteogenic differentiation of SSEA-4 sub-population of human adipose derived stem cells using silicate nanoplateletsBiomaterials 35:9087–9099Google Scholar
- [69]Bioactive silicate nanoplatelets for osteogenic differentiation of human mesenchymal stem cellsAdv Mater 25:3329–3336Google Scholar
- [70]Bioactive nanoengineered hydrogels for bone tissue engineering: a growth-factor-free approachACS Nano 9:3109–3118Google Scholar
- [71]Clay nanoparticles as pharmaceutical carriers in drug delivery systemsExpert Opin Drug Deliv 18:695–714Google Scholar
- [72]ComBATing aging-does increased brown adipose tissue activity confer longevity?Geroscience 41:285–296Google Scholar
- [73]When S-Nitrosylation Gets to Mitochondria: From Signaling to Age-Related DiseasesAntioxid Redox Signal 32:884–905Google Scholar
- [74]Identification of biomarkers of brown adipose tissue aging highlights the role of dysfunctional energy and nucleotide metabolism pathwaysSci Rep 11:19928Google Scholar
- [75]Plasma proteomic biomarker signature of age predicts health and life spaneLife 9Google Scholar
- [76]Mitochondrial reactive oxygen species and adipose tissue thermogenesis: Bridging physiology and mechanismsJ Biol Chem 292:16810–16816Google Scholar
- [77]Endogenous aldehyde-induced DNA- protein crosslinks are resolved by transcription-coupled repairNat Cell Biol 26:784–796Google Scholar
- [78]Analysis of disease model iPSCs derived from patients with a novel Fanconi anemia-like IBMFS ADH5/ALDH2 deficiencyBlood 137:2021–2032Google Scholar
- [79]Defective chromatin architectures in embryonic stem cells derived from somatic cell nuclear transfer impair their differentiation potentialsCell Death Dis 12:1085Google Scholar
- [80]S-nitrosylation from GSNOR deficiency impairs DNA repair and promotes hepatocarcinogenesisSci Transl Med 2:19ra13Google Scholar
- [81]A genome-wide scan for linkage to human exceptional longevity identifies a locus on chromosome 4Proc Natl Acad Sci U S A 98:10505–10508Google Scholar
- [82]Nitrosative stress drives heart failure with preserved ejection fractionNature 568:351–356Google Scholar
- [83]Brown Adipose Tissue Heterogeneity, Energy Metabolism, and BeyondFront Endocrinol (Lausanne) 12:651763Google Scholar
- [84]BCAA catabolism in brown fat controls energy homeostasis through SLC25A44Nature 572:614–619Google Scholar
- [85]Mitochondrial pathways in human health and agingMitochondrion 54:72–84Google Scholar
- [86]Mitochondrial dysfunction plays an essential role in remodeling aging adipose tissueMech Ageing Dev 200:111598Google Scholar
- [87]Branched chain amino acids, aging and age-related healthAgeing Res Rev 64:101198Google Scholar
- [88]Impaired BCAA catabolism in adipose tissues promotes age-associated metabolic derangementNat Aging 3:982–1000Google Scholar
- [89]BCAA- nitrogen flux in brown fat controls metabolic health independent of thermogenesisCell Google Scholar
- [90]Branched-Chain Amino Acids Are Linked with Alzheimer’s Disease-Related Pathology and Cognitive DeficitsCells 11Google Scholar
- [91]Branched-chain amino acids and the risks of dementia, Alzheimer’s disease, and Parkinson’s diseaseFront Aging Neurosci 16:1369493Google Scholar
- [92]Plasma branched-chain and aromatic amino acids correlate with the gut microbiota and severity of Parkinson’s diseaseNPJ Parkinsons Dis 8:48Google Scholar
- [93]Oxidative stress and vascular inflammation in agingFree Radic Biol Med 65:380–401Google Scholar
- [94]Role of Nitric Oxide in Neurodegeneration: Function, Regulation, and InhibitionCurr Neuropharmacol 19:114–126Google Scholar
- [95]Hallmarks of Aging in the LiverComput Struct Biotechnol J 17:1151–1161Google Scholar
- [96]Regulation of obesity and insulin resistance by nitric oxideFree Radic Biol Med 73:383–399Google Scholar
- [97]S-nitrosylation of fatty acid synthase regulates its activity through dimerizationJ Lipid Res 57:607–615Google Scholar
- [98]S-nitrosylation: physiological regulation of NF- kappaBProc Natl Acad Sci U S A 101:8841–8842Google Scholar
- [99]Inflammatory stimuli induce inhibitory S-nitrosylation of the deacetylase SIRT1 to increase acetylation and activation of p53 and p65Sci Signal 7:ra106Google Scholar
- [100]Increased adipocyte S-nitrosylation targets anti-lipolytic action of insulin: relevance to adipose tissue dysfunction in obesityJ Biol Chem 286:30433–30443Google Scholar
- [101]Cellular proteostasis decline in human senescenceProc Natl Acad Sci U S A 117:31902–31913Google Scholar
- [102]Stress- inducible regulation of heat shock factor 1 by the deacetylase SIRT1Science 323:1063–1066Google Scholar
- [103]Regulation of heat shock transcription factors and their roles in physiology and diseaseNat Rev Mol Cell Biol 19:4–19Google Scholar
- [104]Repression of the Heat Shock Response Is a Programmed Event at the Onset of ReproductionMol Cell 59:639–650Google Scholar
- [105]Celastrol Protects against Obesity and Metabolic Dysfunction through Activation of a HSF1-PGC1alpha Transcriptional AxisCell Metab 22:695–708Google Scholar
- [106]The mRNA levels of heat shock factor 1 are regulated by thermogenic signals via the cAMP-dependent transcription factor ATF3J Biol Chem 295:5984–5994Google Scholar
- [107]Local hyperthermia therapy induces browning of white fat and treats obesityCell 185:949–966Google Scholar
- [108]An immune-beige adipocyte communication via nicotinic acetylcholine receptor signalingNat Med 24:814–822Google Scholar
- [109]Brown Adipose Crosstalk in Tissue Plasticity and Human MetabolismEndocr Rev 41Google Scholar
- [110]Inflammation of brown/beige adipose tissues in obesity and metabolic diseaseJ Intern Med 284:492–504Google Scholar
Article and author information
Author information
Version history
- Sent for peer review:
- Preprint posted:
- Reviewed Preprint version 1:
Cite all versions
You can cite all versions using the DOI https://doi.org/10.7554/eLife.108145. This DOI represents all versions, and will always resolve to the latest one.
Copyright
© 2025, Sebag et al.
This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.
Metrics
- views
- 474
- downloads
- 13
- citations
- 0
Views, downloads and citations are aggregated across all versions of this paper published by eLife.