Introduction

Visible light is crucial for image formation and regulating various physiological processes through the visual system, yet how animals respond to ambient light independently of sight remains poorly understood. Recent studies have uncovered diverse non-visual photoreception mechanisms that modulate a range of biological processes, from circadian rhythms to stress responses and metabolic homeostasis (Andrabi et al., 2023; Cronin and Johnsen, 2016; Do and Yau, 2010; Van Gelder, 2008). These mechanisms often involve specialized light-sensitive proteins, such as opsins and cryptochromes, widely expressed in body locations, including the skin, brain, and peripheral organs. For example, mammalian melanopsin-expressing retinal ganglion cells play critical roles in systemic light responses largely independent of image formation (Berson et al., 2002; Hattar et al., 2003; Lucas et al., 2003; Shi et al., 2024). In the nematode roundworm C. elegans, blue light photoreception requires the light-activated ion channels LITE-1 and GUR-3 in specific neurons, influencing aversive behaviors and cellular physiology (Bhatla and Horvitz, 2015a, 2015b; Edwards et al., 2008; Gong et al., 2016; Hanson et al., 2023). Visible light irradiation can also generate photo-oxidative reactive oxygen species in animals (De Magalhaes Filho et al., 2018; Liebel et al., 2012; Mahmoud et al., 2010). Despite these advances, the molecular pathways and physiological outcomes of non-visual light sensing and responses remain understudied, raising intriguing questions about the mechanistic basis and functional implications of light as an environmental cue beyond vision.

We previously studied how genes encoding cytochrome P450 (CYP) proteins respond to and mediate effects of exposure to environmental stresses in C. elegans (Keller et al., 2014; Ma et al., 2013). Among various transcriptional reporters we generated for CYP-encoding genes to monitor environmental regulation, we serendipitously discovered that the cyp-14A5 promoter-driven GFP expression is particularly sensitive to ambient visible light exposure. Building upon this initial finding, we conduct transcriptome profiling to identify light-inducible genes in addition to cyp-14A5, determine key transcriptional regulators of cyp-14A5, and show that the light-inducible CYP-14A5 promotes behavioral plasticity and olfactory memory in C. elegans. The findings also provide a genetic tool to use light-inducible cyp-14A5 promoter to flexibly and ectopically drive gene expression.

Results

Light activates expression of cyp-14A5 and other genes in C. elegans

Cytochrome P450 proteins comprise a highly conserved superfamily of heme-containing monooxygenases critical for metabolizing endogenous and xenobiotic compounds (Denisov et al., 2005). We constructed transcriptional reporters for genes encoding CYPs in C. elegans and found that cyp-14A5p::GFP was drastically up-regulated by bright-field transmission light from a microscope inadvertently left on overnight. Using controlled light versus dark conditions, we confirmed the finding from an integrated cyp-14A5p::GFP reporter and observed its robust widespread GFP expression in many tissues induced by moderate-intensity (500-3000 Lux, 16-48 hr duration) LED light exposure (Fig. 1A). The level of GFP expression increased proportionally with both light intensity and duration (Fig. 1B), the condition of which does not impact ambient temperature (Fig. S1A-S1D). Other common stresses, including transient 32 °C heat shock, constant 24-hr hypoxia or starvation did not apparently induce cyp-14A5p::GFP (Fig. S1E-S1H). Together, these data suggest that cyp-14A5p::GFP induction is finely tuned to ambient light conditions.

Figure 1

To determine CYP-14A5 protein expression pattern, we constructed a translational GFP reporter (cyp-14A5p::cyp-14A5::GFP) and observed robust light-induced expression of CYP-14A5::GFP in many of the non-neuronal tissues, including the pharynx, hypoderm and intestine (Fig. 1C). The transcriptional reporter exhibited similar patterns of non-neuronal GFP induction by light (Fig. 1A). The translational reporter reveals the CYP-14A5::GFP pattern indicative of the endoplasmic reticulum structure (Fig. 1C), consistent with the known subcellular localization of most CYPs to ER membranes (Neve and Ingelman-Sundberg, 2010).

To explore how eyeless C. elegans responds to ambient visible light independently of a visual system, we conducted transcriptomic profiling by RNA-seq in C. elegans exposed to controlled light or dark conditions. We found that defined visible light exposure (1500 Lux, 24 hr duration) to a synchronized population of young adults (24 hrs post L4) triggered a robust genome-wide transcriptional response, including 7902 genes differentially regulated (adjusted P value < 0.05, Fig. 1D and Table S1). Among these, cyp-14A5 was one of the most strongly upregulated genes (Fig. 1E). Gene ontology (GO) analysis of the light-induced transcriptome reveals their significant enrichment in several pathways, including transmembrane signaling, pathogen and stress responses, protein phosphorylation, cellular homeostasis and metabolisms (Fig. S2).

ZIP-2 and CEBP-2 are essential for light-induced transcriptional responses

We next investigated the molecular regulators driving cyp-14A5 activation in response to light. To test if it requires previously identified blue-light receptors LITE-1 or GUR-3, we crossed the cyp-14A5p::GFP reporter with lite-1 and gur-3 double loss-of-function mutants. Surprisingly, light-induced GFP expression was preserved in lite-1gur-3 double mutants, indicating that cyp-14A5 activation operates through an alternative, non-visual light-sensing mechanism (Fig. 2A). Prolonged photonic light exposure may also cause photo-oxidation of DNA and genotoxicity, leading to DNA damage and ATM protein-dependent check points and transcriptional responses (Ciccia and Elledge, 2010; De Magalhaes Filho et al., 2018; Schuch et al., 2017). However, loss of the DNA damage sensor ATM-1 did not apparently affect light-induced cyp-14A5p::GFP (Fig. 2A). These findings underscore the existence of a novel light-responsive pathway in C. elegans, distinct from previously characterized photoreceptive systems.

Figure 2

To identify transcriptional regulators driving cyp-14A5 activation in response to light, we adopted an RNAi-based screening strategy, focusing initially on approximately 400 genes encoding transcription factors, including those responding to various types of stresses. Knockdown of the expression of genes encoding TF from a previously assembled RNAi library or selected for mediating various common stress responses (hypoxia, oxidative stress, heat shock etc.) did not appear to affect cyp-14A5 activation in response to light (Fig. 2B). Interestingly, we identified from such screen two bZIP-type transcription factors, ZIP-2 and CEBP-2, as critical mediators of light-induced cyp-14A5 transcription (Fig. 2B). Knockdown or genetic ablation of either zip-2 or cebp-2 abolished light-induced cyp-14A5p::GFP expression (Fig. 2B, 2C). ZIP-2 and CEBP-2 have been previously identified (Dunbar et al., 2012; Estes et al., 2010; Kniazeva and Ruvkun, 2025; Reddy et al., 2016) to cooperate in a regulatory complex and mediate transcriptional responses to translational inhibition caused by the bacterial pathogen Pseudomonas aeruginosa PA14. In these studies, the irg-1p::GFP transcriptional reporter was robustly activated by PA14 as a well-established target for ZIP-2 and CEBP-2. Interestingly, we found irg-1p::GFP was not activated by the same light condition (1500 Lux, 24 hrs) that reliably induced cyp-14A5p::GFP (Fig. 2D). Although ZIP-2 can be activated by pathogen stresses through ribosomal inhibition and subsequent selective ZIP-2 translation (Dunbar et al., 2012; Estes et al., 2010; Kniazeva and Ruvkun, 2025; Reddy et al., 2016), our results suggest the specific roles of ZIP-2 in mediating light-induced cyp-14A5 but not irg-1 reporter expression, suggesting the involvement of additional stress context-specific factors in these processes.

We further explored conditions and mechanisms leading to light-induced cyp-14A5p::GFP. To test potential effects of ultraviolet (UV) irradiation from our visible light LED, we used a UV-masking shield to block UV irradiation. However, this did not affect visible LED light-induced cyp-14A5p::GFP expression (Fig. 2E). In addition, we found that the LED light exposure of equal intensities (1500 Lux, 24 hrs) but at different wavelengths (red, green, blue) led to differential cyp-14A5p::GFP expression (Fig. 2F, 2G), showing stronger effects of shorter wavelengths in the visible-light spectrum. A pseudo-open reading frame (uORF) in the 5’ untranslated region (UTR) of zip-2 mRNA inhibits the ribosomal translation of the ZIP-2 main open reading frame (mORF) in the context of PA14 pathogen exposure (Dunbar et al., 2012). However, constitutive expression of zip-2 uORF by the rpl-28 promoter did not affect light-induced cyp-14A5p::GFP (Fig. 2H). Furthermore, a CRISPR phospho-site knock-in mutation of eif-2alpha(S49A) did not affect global translation (Ma et al., 2023), yet abolished light-induced cyp-14A5p::GFP (Fig. 2I). As the eukaryotic eIF2alpha complex facilitates translational switch from uORF to mORF upon stress-induced ribosomal stall at uORF (Brito Querido et al., 2024; Costa-Mattioli and Walter, 2020; Mir et al., 2024), these results suggest that it is the zip-2 uORF translational inhibition, not the uORF protein product function, that mediates visible light-increased ZIP-2 translation and cyp-14A5p::GFP expression (Fig. 2J).

Light-induced CYP-14A5 enhances behavioral memory

Although EIF-2alpha and ZIP-2/CEBP-2 functions appear essential for light-induced up-regulation of cyp-14A5, the zip-2 or cyp-14A5 loss-of-function null mutants show no apparent body-size, morphological, feeding, defecation or developmental defects under dark or LED light treatment (1500 Lux for 16 or 24 hrs) conditions (Fig. S3). These data suggest that transient visible light exposure or light-induced cyp-14A5 activation by ZIP-2 does not broadly impact development, aging or physiology, unlike long-term visible light exposure, which has been shown to robustly shorten lifespans in C. elegans (De Magalhaes Filho et al., 2018).

The lack of obvious morphological and basal behavioral defects led us to explore whether light exposure influences other aspects of C. elegans biology, particularly behavioral plasticity and associative memory formation that might require integration of body physiology. Specifically, we chose a learning paradigm in which animals learn to avoid an innately attractive odor butanone after it is paired with aversive stimuli (Chandra et al., 2023; Kauffman et al., 2010). C. elegans can consolidate this learning into a long-lasting memory for up to 16 hours once the repetitive training is followed by sleep and recovery post learning (Chandra et al., 2023). Using this conditioning protocol (Fig. 3A), we observed that animals exposed to ambient light (approximately 500–1000 Lux) during olfactory associative learning and recovery exhibited significantly enhanced memory retention compared to those maintained in darkness (Fig. 3B). To pinpoint the critical period for light exposure, we deprived animals of light in two-hour intervals immediately post learning. Interestingly, light deprivation during the first 2–4 hours post learning resulted in markedly impaired memory retention (Fig. 3C). These results suggest that environmental light exposure enhances aversive cue association post learning and is not required for learning itself but is required post learning concurrent with sleep for consolidation of memory (Chandra et al., 2023).

Figure 3

Does the light-modulated behavioral memory consolidation require light activation of the ZIP-2 pathway? To address this question, we examined the behavioral memory of two independent zip-2 deletion mutants as compared to wild type (cebp-2 mutants are pleiotropically sick and thus not included). We found that both the ok3730 and tm4246 deletion mutations of zip-2 caused significantly impaired memory consolidation but not learning (Fig. 3D). Strikingly, the loss-of-function mutation of cyp-14A5, but not F43C1.7 (another ZIP-2 target gene induced by visible light), also impaired memory retention as zip-2 (Fig. 3E), indicating a crucial role of the ZIP-2/CYP-14A5 regulatory axis in mediating light-modulated memory consolidation. To further delineate the role of CYP-14A5, we performed tissue-specific rescue experiments in the behavioral memory assay. We found that hypoderm-specific expression of cyp-14A5 restored the behavioral memory in the cyp-14A5 mutant (Fig. 3F). We observed similar degrees of rescue by two independently derived lines expressing hypoderm-specific dpy-7p::cyp-14A5 transgenes. These findings strongly suggest that hypodermal induction of CYP-14A5 by ZIP-2 plays a central role in mediating light-modulated behavioral memory.

The cyp-14A5 promoter as a versatile tool for light-inducible gene expression

The light-responsive nature of the cyp-14A5 promoter prompted us to explore its potential as a tool for controlling gene expression. We generated synthetic constructs driving the expression of diverse effectors under the cyp-14A5 promoter to confer striking organismal phenotypes. We previously found that zip-10 expression promotes organismal phenoptosis (Pandey and Ma, 2022; Wang et al., 2023). Driven by the cyp-14A5 promoter, light-induced zip-10 expression indeed caused a robust light-dependent rapid aging or phenoptosis-like phenotype with markedly shortened median and maximal lifespans (Fig. 4A-4D). We confirmed that LED light exposure markedly induced zip-10 expression, as evidenced by robust ZIP-10-tagging mCherry fluorescence in major non-neuronal tissues of transgenic animals, only after light (1500 Lux, 24 or 48 hrs) exposure (Fig. 4C).

Figure 4

To test organismal behavioral outcomes, we expressed nlp-22 under the cyp-14A5 promoter. nlp-22 was previously identified as a sleep-promoting neuropeptide (Bringmann, 2018; Nelson et al., 2013; Van der Auwera et al., 2020), overexpression of which can cause drastic reduction of pumping and locomotion speed, characteristic of sleep behaviors in C. elegans. We found that cyp-14A5p::nlp-22 can indeed trigger striking behavioral quiescence upon light exposure (1500 Lux, 24 or 48 hrs), as quantified by pumping rates, bending frequencies and locomotion speed (Fig. 4E-4G). Quantitative analysis by WormLab reveals that the behavioral quiescence induced by nlp-22 corresponded to characteristic bouts of sleep (Fig. S4). These proof-of-concept studies demonstrate that the cyp-14A5 promoter enables light-dependent ectopic induction of gene expression, offering a flexible tool for probing gene function, studies of organismal biology, behaviors and synthetic physiology applications.

Discussion

Our findings uncover a previously unknown light-induced transcriptional pathway in C. elegans that operates independently of known visual light receptors. Our study also establishes a functional link between ambient light and behavioral plasticity through a ZIP-2/CYP regulatory axis. The discovery of this pathway and its organismal functions opens exciting avenues for understanding body-brain communication and how environmental cues such as light can shape physiological and behavioral processes.

The specificity of this pathway is particularly intriguing, as cyp-14A5 is robustly induced by light at wavelength and intensity that do not apparently alter ambient temperature (Fig. S1). Previous studies identified cyp-14A5 as one of many genes moderately regulated by bacterial pathogens (Sinha et al., 2012; Troemel et al., 2006; Wong et al., 2007), yet the classic pathogen-inducible gene reporter irg-1p::GFP was not apparently activated by light conditions that induced cyp-14A5p::GFP. This specificity raises important questions about how ZIP-2 and cyp-14A5 are selectively activated by light, or to different degrees. Given the crucial roles of ZIP-2 and eIF2alpha we discovered for light-induced expression of cyp-14A5 and the established role of the uORF at the 5’ untranslated region of zip-2 RNA in ZIP-2 regulation (Dunbar et al., 2012), it is plausible that light may regulate ZIP-2 translation by zip-2 RNA photo-oxidation at specific sites, eIF2alpha phosphorylation and specialized ribosomal signaling (D’Orazio and Green, 2021; Genuth and Barna, 2018; Sinha et al., 2024). Further investigation into the upstream signaling events and the molecular sensors linking light exposure to ZIP-2/CEBP-2 activation is warranted.

Our behavioral assays demonstrate that light exposure enhances olfactory associative memory, providing direct evidence for the functional relevance of light-induced cyp-14A5 expression. Interestingly, light exposure appears to exert its effects during a specific temporal window hours following learning, suggesting that light-induced transcriptional changes post learning play a key role in memory consolidation. The discovery of cyp-14A5 as a key effector in this pathway also provides new insights into how non-neuronal tissues contribute to behavioral plasticity. Our findings suggest that light-induced CYP-14A5 and CYP-dependent metabolic or signaling changes in the hypoderm may communicate with the nervous system to influence behavioral memory. This body-brain communication axis highlights the importance of systemic integration in mediating complex physiological and behavioral responses to environmental cues (Aghayeva et al., 2021; Fukuda et al., 2025; Liu et al., 2022; Zhang et al., 2018).

Beyond its biological significance, the light-inducible cyp-14A5 promoter offers a useful new tool for gene expression studies in C. elegans. The ability to drive ectopic gene expression in response to light provides a versatile system for temporally controlled genetic manipulations. Our demonstration of light-induced sleep and mortality phenotypes through ectopic gene expression illustrates the potential applications of this tool in studying diverse biological processes in synthetic biology and physiology.

Previous studies have used heat shock or drug-inducible promoters for temporally controlled gene expression in C. elegans (Monsalve et al., 2019; Stringham et al., 1992; Wei et al., 2012). The light-inducible cyp-14A5 promoter provides an alternative, simple-to-implement approach and might be particularly useful when the drug-inducible system is cumbersome, or heat shock effects are undesirable.

While our study uncovers a novel light-responding mechanism with functional consequences in C. elegans, several limitations exist. First, the precise molecular mechanism by which visible light activates ZIP-2 and/or CEBP-2 remains unclear, as does the upstream signaling cascade linking light exposure to transcriptional activation. Second, although we demonstrate a functional connection between light-induced cyp-14A5 expression and behavioral outcomes, the exact molecular interplay between peripheral transcriptional changes and neural plasticity requires further exploration. Finally, while the cyp-14A5 promoter serves as a useful genetic tool, it does not confer tissue specificity, and its ectopic effector expression requires control for light effects. These limitations provide fertile ground for future research to build upon our findings.

Materials & methods

C. elegans strains

C. elegans strains were grown on nematode growth media (NGM) plates seeded with Escherichia coli OP50 at 20 °C with laboratory standard procedures unless otherwise specified. The N2 Bristol strain was used as the reference wild type (Brenner, 1974). Mutants and integrated transgenes were back-crossed at least five times. Genotypes of strains used are as follows: dmaIs156 IV [cyp-14A5p:: cyp-14A5::GFP; unc-54p::mCherry], agIs17 IV [irg-1p::gfp], dmaEx [dpy-7p::cyp-14A5; myo-2p::mCherry], dmaEx [cyp-14A5p::zip-10::mCherry; myo-2p::mCherry], dmaEx [cyp-14A5p::nlp-22; myo-2p::mCherry], cebp-2 (tm5421) I, eif-2alpha(rog3) I, zip-2(tm4248) III, zip-2(ok3730) III, cyp-14A5(gk152) V.

PCR fusion constructs were used to generate transgenes (Hobert, 2002), using primer sequences:

DM1310_cyp-14A5Pro c5p TCAACCACATCTTCCGATCA;

DM1311_cyp-14A5Pro to GFP c3p

CGACCTGCAGGCATGCAAGCTgatctttgttggacagaatagtttt;

DM2857_dpy-7p to cyp-14A5 codutr Forward TGTCTCTGACGCCTGTGAGT;

DM2858_dpy-7p to cyp-14A5 codutr Reverse

GATAAAGCAACGATGAAAACGCTCATTTTGTTTTCACAGAGCGGTAGA;

DM2944_zip-2uORF to rpl-28p-GOI-mCherry-5utr fusion F

CATCATAAAATAATTTATTTCCAGGTAAAATGTATCACGCAAAGACAACCACCG;

DM2945_zip-2uORF to rpl-28p-GOI-mCherry-5utr fusion

catgttatcttcttcaccctttgaggagccAAGCTCCCGTGGGAAGCTTGTG;

DM2948_zip-10 to cyp-14A5p-GOI-mCherry-5utr fusion F

aaaactattctgtccaacaaagatcaaaATGACAACAATGACTAATTCTCTTATTTC;

DM2949_zip-10 to cyp-14A5p-GOI-mCherry-5utr fusion R

catgttatcttcttcaccctttgaggagccGGAATGGTTGATTTGATTATTGAGTTG

DM2952_nlp-22cod::3utr to cyp-14A5p-GOI fusion

aaaactattctgtccaacaaagatcaaaATGCGTTCCATAATCGTCTTCATCG;

DM2953_nlp-22cod::3utr to cyp-14A5p-GOI fusion R cggttccactttctcatgagt

Fluorescence microscopy and imaging

SPE confocal (Leica) and epifluorescence microscopes were used to capture fluorescence images. Animals were randomly picked at the same stage and treated with 1 mM levamisole in M9 solution (31742-250MG, Sigma-Aldrich), aligned on a 2% agar pad on a slide for imaging. Identical setting and conditions were used to compare experimental groups with control. For quantification of GFP fluorescence, animals were outlined and quantified by measuring gray values using the ImageJ software. The data were plotted and analyzed by using GraphPad Prism10.

For light-induced reporter imaging, reporter animals (synchronized young adults, 24 hrs post L4) were exposed to white light (1500 Lux for 16 or 24 hrs, by Viribright 12-Watt, 800 Lumen, LED Desk Lamp Dimmable Office Lamp). For blue, green (SPE confocal, Leica), and red light (HQRP 660 nm 14w LED pure red) conditions, animals of the same stage were exposed to the same intensities (1500 Lux, 16 or 24 hours). Control groups from the same batch of animals were maintained in darkness by opaque shields. Light intensities and temperature were quantitatively measured by digital light meters and thermometers.

RNA sequencing

A synchronized population of wild-type young adult (24 hrs post L4) animals were exposed to LED light (1500 lux, 24 hr duration, Viribright 12-Watt, 800 Lumen, LED Desk Lamp Dimmable Office Lamp). Control groups from the same batch of animals were maintained in darkness by opaque light shields. Four independent biological replicates were used for both light-treated and control groups. For sample collection, the animals were washed down from NGM plates using M9 solution and bacteria-cleaned with M9 washing in centrifuge tubes, homogenized by tissue disruptors and subjected to RNA extraction using the RNeasy Mini Kit from Qiagen. 1 mg total RNA from each sample was used for sequencing library construction. The libraries were constructed and sequenced for paired end 150 bp by DNBseq (Innomics). The cleaned RNAseq reads were mapped to the genome sequence of C. elegans using hisat2 and the mapped reads were assigned to the genes using featureCounts (Kim et al., 2015; Liao et al., 2014). The abundance of genes was expressed as RPKM (Reads per kilobase per million mapped reads) and identification of differentially expressed genes (Table S1) was performed using the DESeq2 package (Love et al., 2014).

C. elegans behavioral assays

The olfactory behavioral memory assay was as described previously with modification (Chandra et al., 2023; Kauffman et al., 2010). Briefly, one day old adult worms (24 hrs post L4) were washed with S basal buffer (0.1 M NaCI, 0.05 M K₃PO₄, pH 6.0) off 10 cm NGM plates and into microfuge tubes, where they were washed three times with S basal buffer. The animals were split in two groups; one group was added to a microfuge tube of S basal media and the other group was added to a microfuge tube of 1:10,000 dilution of butanone in S basal. The microfuge tubes were then rotated for 80 minutes. The odor training includes three 80-minute cycles of training with odor, or a control buffer interspersed with two 30-minute periods of feeding with OP50 E. coli bacteria. For chemotaxis assay, 1 μL of (1 M) NaN₃ was pipetted onto the odor and diluent spots in 10 cm plastic petri dishes. 1 μL of 200 proof ethanol was added to the diluent spot and 1 μL of 1:1000 butanone was added to the odor spot, while S basal or butanone-trained worms were dropped onto the middle of 10 cm plastic petri dishes. The recovery period was either under darkness or ambient light (approximately 600 Lux) for 16 hrs or were kept under darkness for 2 or 4 hr periods followed by light exposure and chemotaxis to assay behavioral memory.

For sleep analysis induced by cyp-14A5p::nlp-22, the bending angles, moving average speed, and track length of C. elegans after 48 hours of exposure to either light or dark conditions were analyzed using WormLab. In such experiment, a synchronized population of young adult (24 hrs post L4) animals of indicated genotype or transgene expression were used. After light exposure or control dark treatment, they were transferred to a fresh NGM plate seeded with a small OP50 bacterial lawn and allowed to settle for at least ten minutes to recover at room temperature. After the recovery period, a one-hour recording session was conducted using WormLab. Bending angles were calculated as described in the referenced method as a metric for sleep behaviors (Chandra et al., 2023). Moving average speed was determined by tracking the displacement of the worms over time.

Statistics

Numerical data were analyzed using GraphPad Prism 10 Software (Graphpad, San Diego, CA) and presented as means ± S.D. unless otherwise specified, with P values calculated by unpaired two-tailed t-tests (comparisons between two groups), one-way ANOVA (comparisons across more than two groups) and two-way ANOVA (interaction between genotype and treatment), with post-hoc Tukey and Bonferroni’s corrections. The lifespan assay was plotted and quantified using Kaplan–Meier lifespan analysis, and P values were calculated using the log-rank test.

Supplementary figures

Figure S1

Figure S2

Figure S3

Figure S4

Acknowledgements

Some strains were provided by the Caenorhabditis Genetics Center (CGC), which is funded by the NIH Office of Research Infrastructure Programs (P40 OD010440), and by Dr. E. Troemel. We also thank the C. elegans Reverse Genetics Core Facility (University of British Columbia), National Bioresource Project (S. Mitani, Tokyo Women’s Medical University, Tokyo, Japan), Wormbase.org (NIH grant #U24 HG002223 to P. Sternberg), Wormatlas.org (NIH grant #OD010943 to D.H. Hall.), Aging Atlas (Dr. M. Wang) and CenGen (cengen.org) for their immensely helpful resources. The work was supported by NIH grants (R35GM139618 to D.K.M.), BARI Investigator Award (D.K.M.), and UCSF PBBR New Frontier Research Award (D.K.M.)

Additional information

Author Contributions

D.K.M. designed and analyzed the C. elegans experiments, contributed to project conceptualization and wrote the manuscript. B.W. made the initial observation on cyp-14A5 induction by light and performed RNAi screens and reporter imaging. Z.J. prepared RNA-seq samples and characterized light effects on the cyp-14A5 reporter, cellular, behavioral and physiological phenotypes of various mutants with assistance from W.Y. and M.E. Y.L. analyzed the RNA-seq data. R.C. designed, performed and analyzed the behavioral memory assays. J.L. designed, performed and analyzed the light-induced sleep and phenoptotic aging assays. N.L., Y.L., B.W., Z.J., R.C., J.L. contributed to research materials, project conceptualization and editing manuscript.

Funding

National Institute of General Medical Sciences (R35GM139618)

Additional files

Supplementary Table S1