Abstract
The neuromuscular junction (NMJ) of larval Drosophila is widely used for studying synaptic transmission. Larval body wall muscles express five ionotropic glutamate receptor (iGluR) subunits that assemble into two tetrameric complexes, with subunit composition determining the strength and plasticity of synaptic transmission. Because NMJ function has been extensively characterized in larvae, it is often assumed that adult fly NMJs have similar molecular composition, despite substantial differences between life stages. Here, we systematically compare glutamate receptor expression across larval and adult Drosophila muscles. We find that adult leg and flight muscles exhibit different iGluR expression than larvae, lacking several receptors previously considered essential for viability and NMJ function. Adjacent muscles within the adult femur express distinct iGluRs, suggesting specialization of flexor and extensor muscles. Finally, the glutamate-gated chloride channel (GluClα) is expressed extrasynaptically in adult but not larval muscle fibers. Our results reveal unexpected heterogeneity in glutamate receptor expression across muscles and developmental stages, challenging assumptions about the uniformity of neuromuscular function and demonstrating the need for muscle-specific analyses in flies and other animals.
Introduction
Body movement relies on the release of chemical neurotransmitters from motor neurons onto muscles at the neuromuscular junction (NMJ). In vertebrate animals, most motor neurons release the excitatory neurotransmitter acetylcholine (Dale et al., 1936), which acts on nicotinic receptors to elicit contraction of skeletal muscle. In contrast, most invertebrate motor neurons release glutamate (Takeuchi and Takeuchi, 1964, 1963), which binds to ionotropic glutamate receptors (iGluRs) expressed in muscle (Schuster et al., 1991). However, muscles are not uniform effectors; they are highly specialized to control distinct body parts and behaviors ranging from walking to flight (Hooper and Thuma, 2005; Schiaffino et al., 2025). Given this functional specialization, how is the expression and subunit composition of postsynaptic neurotransmitter receptors regulated to support the function of diverse muscles? Determining how receptors are tailored to the specific biophysical demands of individual muscles, and how this tuning shifts during development, is essential for understanding the molecular mechanisms that underlie adaptive motor control.
A powerful experimental system to investigate molecular, developmental, and physiological mechanisms of neuromuscular signaling is the larval NMJ of the fruit fly, Drosophila, which enables high-resolution analysis of identified motor neurons and muscles with electrophysiology and immunohistochemistry (He and Dickman, 2025). Flies, like humans, encode 16 GluR genes (Figure 1A; Li et al., 2016). Five ionotropic receptor (iGluR) subunits are expressed in larval muscle, where two subtypes mediate excitatory synaptic transmission (DiAntonio, 2006; Thomas and Sigrist, 2012). Similar to vertebrate AMPA-type receptors, fly iGluRs function as tetrameric complexes that require three obligate subunits (GluRIIC, GluRIID, and GluRIIE) along with a fourth, either GluRIIA or GluRIIB (Figure 1B; Han et al., 2024, 2015). The specific subunit composition dictates synaptic efficacy: GluRIIA-containing receptors generate large, stable synaptic currents, while GluRIIB complexes desensitize rapidly (DiAntonio, 2006; Thomas and Sigrist, 2012). Synaptic transmission at the larval NMJ is also regulated homeostatically: when postsynaptic GluRs are genetically or pharmacologically suppressed, the presynaptic motor neuron increases neurotransmitter release to maintain stable postsynaptic responses (He and Dickman, 2025). Distinct from this excitatory machinery, the inhibitory glutamate-gated chloride channel (GluClα) functions presynaptically in larval motor neurons to mediate presynaptic homeostatic depression, a mechanism that adaptively dampens neurotransmitter release at the NMJ (Li et al., 2021). Due to the extensive characterization of these mechanisms in the larva, it is often tacitly assumed that this canonical molecular architecture is preserved in the adult fly. This extrapolation overlooks the profound reorganization of the neuromuscular system during metamorphosis.

Glutamate receptors at Drosophila neuromuscular junctions (NMJs).
(A) Phylogeny of 16 glutamate receptors in the Drosophila genome and their reported expression at the larval NMJ (based on Li et al., 2016). (B) Schematic of the larval Drosophila fly NMJ (top) and composition of glutamate receptors (bottom). Larval GluRs occur as two distinct tetrameric complexes, each with the same auxiliary subunit (Neto). (C) Example fluorescence images of larval and adult NMJs. Motor neurons are labeled by driving GFP with vGlut-Gal4 (green). Active zones are labeled with an antibody against Brp (magenta). Muscle is labeled with phalloidin (blue).
Compared to the NMJ of Drosophila larva, the physiology and molecular architecture of adult fly NMJs remain largely unexplored (with one notable exception, Rivlin et al., 2004). This gap is significant because the biomechanical context of movement changes fundamentally during metamorphosis (Agrawal and Tuthill, 2022). Larval body wall muscles mediate slow, rhythmic peristaltic locomotion by pulling against a hydraulic skeleton. In contrast, adult muscles drive a rigid exoskeleton to produce rapid behaviors such as flight and walking. Given these varied biophysical demands, it may be advantageous for specialized muscles to adapt the molecular composition of their synapses. Furthermore, with the emergence of comprehensive connectomes of the adult fly nervous system (Bates et al., 2025; Berg et al., 2025) and biomechanical body models (Vaxenburg et al., 2025; Wang-Chen et al., 2024), defining the molecular identity of neuromuscular synapses is a critical missing link required for integrative modeling of how the nervous system actuates the body.
Here, using genetic reporter lines, immunohistochemistry (IHC), and analysis of single-cell RNA sequencing data, we find that GluR expression in Drosophila is substantially more diverse than previously appreciated. We find that the receptor landscape in adult leg and flight muscles diverges radically from the larval pattern; unexpectedly, these muscles lack expression of GluR subunits that were previously considered essential for NMJ function and viability. In contrast, adult abdominal muscles retain the canonical larval receptor complement, consistent with the fact that the larval musculature is transformed into the abdominal musculature during metamorphosis (Currie and Bate, 1991; Kimura and Truman, 1990). We also identify an extrasynaptic population of glutamate-gated chloride channels (GluClα) specific to adult muscle, a molecular architecture that explains the hyperpolarizing glutamate response described in classical locust studies (Cull-Candy, 1976; Dudel et al., 1989; Lea and Usherwood, 1973). Collectively, these results overturn the assumption of NMJ uniformity, suggesting that synaptic composition is specialized to match the functional requirements of specific muscles.
Results
Larval and adult muscles express distinct GluRs
Consistent with past literature, GAL4 expression patterns and antibody labeling confirmed that all five GluRII subunits are expressed at NMJs throughout larval body wall muscle (Figures 2C, s1). We observed a similar expression pattern in the adult abdomen (Figure 2C, s2), although the labeling of GluRIIB and GluRIIE was weaker than in the larva. As expected, all larval and adult muscles expressed Neto-β, the primary auxiliary subunit required for iGluR receptor trafficking and function (Figure 2D). Expression of other Kainate-type receptors (Grik, KaiR1D, Ukar, Ekar), as well as AMPA, NMDA, and the sole metabotropic GluR were absent in all larval and adult muscles.

GluR subunit expression mapping in larval and adult muscles.
(A) Representative confocal images showing GFP expression driven by a GAL4 reporter line (GluRIIC-GAL4) in larval and adult muscles. (B) Representative images showing antibody staining of GluRIIC at larval and adult neuromuscular junctions. (C) Summary table of Gal4 expression/antibody staining for all GluRs in larval and adult muscles. Note that antibodies and tagged proteins are combined in a single immunohistochemistry (IHC) column. Note that this initial screen focused on the coxa segment of the adult leg. See supplemental figures for representative images and methods for a complete list of reagents screened. (D) Representative images showing the GluR auxiliary subunit Neto-β tagged with GFP at larval and adult neuromuscular junctions.
Surprisingly, we found that none of the primary GluRII subunits was strongly expressed in adult indirect flight muscles (Figures 2C, s2-s3, s5-s8). Leg coxa muscles expressed subsets of GluRII subunits that varied across specific muscle subtypes (Figure 2C, s5-8), though this expression was consistent across flies (Figure s9). Interestingly, the one iGluR that was broadly expressed throughout the adult (e.g., leg, proboscis, neck, haltere and indirect/direct flight muscles) was the kainate-type iGluR Clumsy (Figures 2C, s10). Larval muscles lacked Clumsy expression, and it was expressed only weakly in abdominal muscles. The Clumsy gene is phylogenetically related to GluRIIA/B/C (Li et al., 2016), but its function is poorly understood compared to the other GluRII subunits expressed in larval muscle.
Different leg muscles express distinct iGluRs
Our screen revealed that the expression patterns of iGluR-specific Gal4 lines in the adult leg were often patchy: different muscles appeared to express different iGluR subunits (Figures 2A, s5-s8). These expression patterns were consistent across flies (Figure s9). To examine muscle-specific iGluR expression in more detail, we focused on the femur of the fly’s front leg (Figure 3A-B), for which we have previously characterized motor neuron physiology, muscle innervation, and muscle force production (Azevedo et al., 2020). Based on motor unit organization and tendon attachment, muscle fibers in the tibia can be grouped into four groups: a long tendon muscle, a tibia extensor, and two tibia flexors (Azevedo et al., 2024; Lesser et al., 2024).

Differential GluRIIB vs GluRIIC subunit expression in adult muscle subtypes.
(A) Schematic of the fly’s front leg with annotations of three key muscle groups in the femur. (B) Femur with Netoβ::sfGFP (green) in NMJs (Brp, magenta) in all femur muscle types (phalloidin, blue). (C) 3D rendering of a confocal stack of femur muscles (phalloidin, blue) and GluRIIB GAL4> UAS-GFP (green). GFP is expressed specifically in tibia extensor muscle fibers. (D) Representative antibody staining images showing presence of GluRIIB in a tibia extensor muscle (left) and absence of GluRIIB in an accessory tibia flexor muscle (right). (E) 3D rendering of a confocal stack of femur muscles (phalloidin, blue) and GluRIIC GAL4> UAS-GFP (green). GFP is expressed specifically in accessory tibia flexor muscle fibers. (F) Representative antibody staining images showing absence of GluRIIC in a tibia extensor muscle (left) and presence of GluRIIC in an accessory tibia flexor muscle (right).
To examine differences in iGluR expression between muscles, we compared Gal4 reporter expression and antibody labeling at NMJs in the femur for two GluR subunits: GluRIIB and GluRIIC. We chose these two subunits because their GAL4 expression was restricted to distinct muscle fibers (Figure 3C, E). We found that protein labeling was consistent with GAL4 expression: GluRIIB was expressed at NMJs of tibia extensor muscles but absent from other muscles, including the accessory tibia flexors (Figure 3C-D). In contrast, GluRIIC was expressed at NMJs of the more distal accessory tibia flexor muscles but was absent from the more proximal muscles (Figure 3E-F). The distal accessory tibia flexor fibers are innervated by the slow motor neurons that control slow, postural movements of the tibia (Azevedo et al., 2020).
We also observed differences in iGluR expression within a single muscle. For example, GluRIIB is expressed in proximal fibers of the tibia extensor but is absent from the more distal fibers (Figure 3C-D). Prior work has shown that the more proximal fibers are innervated by the fast extensor motor neuron (FETi), while the more distal fibers are innervated by the slow extensor motor neuron (SETi; Azevedo et al., 2024). These differences in GluRIIB expression within the tibia extensor muscle may reflect specialization of fast vs. slow twitch muscle fibers.
Overall, our results show that different muscles in the fly leg express different ensembles of GluR subunits. We also confirmed that all femur NMJs express the obligatory GluR accessory protein Neto (Figure 3B), affirming that all femur motor neurons are glutamatergic, despite their otherwise unexpected receptor expression. Given what is known about larval GluR subunit composition, this implies that at least some adult GluRs are composed of non-canonical GluR subunits. Further, the difference in GluR expression is interesting because our prior work has demonstrated major differences in the physiology and force production of different muscle groups, and even different fibers within the same muscle (Azevedo et al., 2020). Thus, GluR subunit composition may be specialized to support diverse functions, even within a muscle.
RNA-seq data are consistent with adult muscle expression patterns
We next analyzed transcriptomic data of muscle cells from an existing single-nuclei RNA-seq dataset of adult Drosophila tissues (Li et al., 2022). Consistent with our results from GAL4 reporters and antibody staining, transcription of all GluRII genes was relatively low in clusters annotated as adult leg (Figures s11, s12) and indirect flight muscle (Figure s12), and only slightly higher in a cluster annotated as abdominal muscle. In comparison, and consistent with our results using GAL4 reporter lines, GluClα and Clumsy were both highly expressed in all three muscle clusters. One discrepancy was that Ukar and Grik had elevated transcription in multiple muscle clusters, which we did not observe with GAL4 lines. The Ukar GAL4 line had no detectable expression in any tissue, so this reporter line may not be functional. Overall, however, expression patterns from adult RNA-seq data were largely consistent with our main conclusions from GAL4 reporters and antibody staining.
Motor neurons express a distinct set of GluR genes compared to muscle
To determine whether GluR localization at the neuromuscular junction could be due to presynaptic expression, we also screened for GluR expression in motor neurons. We expressed GFP under the control of GluR-specific GAL4 lines and examined whole-mount expression in the central nervous system, as well as axons projecting to the legs, indirect flight muscles, and abdomen (Figure s13). As expected, we found that motor neurons expressed GluClα, which mainly functions as an inhibitory neurotransmitter in the Drosophila central nervous system (Liu and Wilson, 2013). We also observed that motor neurons expressed a subset of kainate, AMPA, NMDA, and mGluR receptors that was nonoverlapping with the expression patterns we observed in muscle. Overall, these results confirm that the patterns of GluR expression we document at neuromuscular junctions are not due to expression in presynaptic motor neurons.
Extrasynaptic glutamate-gated chloride channels in adult muscle
One surprising result from our survey of GluR expression was the broad expression of the glutamate-gated chloride channel, GluClα, in adult leg and flight muscles, but not in larval body wall or adult abdomen (Figure 2C). GluClα was also the GluR gene with the highest level of expression in leg muscles based on the single nuclei RNA-seq data (Figure 4A). Although GluClα has been shown to function presynaptically in larval motor neurons (Li et al., 2021), its presence and function in Drosophila muscle has not previously been investigated.

GluClα is expressed extrasynaptically in adult fly muscles.
(A) Single-nuclei RNA-seq data shows strong expression of GluClα in adult leg muscles. (B) A Gal4 reporter for GluClα labels muscles in adult legs but not larval muscles. Expression in the larva is mainly in the nervous system, as expected. (C) Representative images showing antibody staining of endogenously-tagged GluClα:V5 in larval and adult muscles. Co-staining with an antibody against Brp reveals that GluClα does not co-localize with active zones. Labeling in larval muscle is likely from motor neurons (Li et al., 2021). (D) Labeling of GluClα protein with a V5 tag shows extrasynaptic expression throughout the muscle fiber, whereas active zones (magenta) are localized.
Whole-mount expression of GFP driven by two GluClα-Gal4 lines showed broad labeling of muscles throughout the flight and leg musculature (Figure 4B). However, using higher resolution imaging of an antibody against an endogenously-tagged GluClα:V5 protein (Sanfilippo et al., 2024), we found that puncta in leg and flight muscle did not cluster at synaptic active zones (Figure 4C). Rather, co-staining with phalloidin (Figures 4D, s14) revealed that the protein is distributed around the edges of the muscle fibers. Thus, unlike the other GluRs, GluClα localizes extrasynaptically in leg and indirect flight muscles. Although the function of extrasynaptic GluClα in muscle remains unclear, this result is consistent with classical electrophysiological studies in other invertebrates (e.g., locust, beetle, lobster) that described hyperpolarizing responses to extrasynaptic glutamate application (see Discussion).
Discussion
Here, we describe unexpected complexity in the molecular composition of glutamate receptors at neuromuscular junctions in Drosophila melanogaster. Our work suggests that glutamate receptor expression at Drosophila NMJs is far more heterogeneous than previously appreciated, with adult leg and flight muscles exhibiting receptor subunit combinations that diverge from the canonical expression patterns previously observed in larvae. Adult indirect flight muscles lack the five GluRII subunits considered essential for larval NMJ function, suggesting these specialized muscles rely on alternative receptor combinations for neuromuscular transmission. Conversely, adult abdominal muscles mostly retain larval-like receptor expression, reflecting their shared developmental lineage. The identification of extrasynaptic GluClα in adult muscles establishes the molecular identity of inhibitory glutamate responses described decades ago in other insects and suggests novel mechanisms for regulating muscle excitability.
Adult leg and wing muscles lack canonical larval glutamate receptors
Perhaps the most striking finding of our study is that some adult leg and flight muscles lack expression of the GluR subunits that have been characterized as essential for larval NMJ function. For example, we observed an absence of GluRIIA-E subunits in indirect flight muscles across multiple experimental approaches: GAL4 reporter expression, antibody staining, and single-cell RNA-seq. These iGluR subunits were previously identified through genetic studies showing that mutations disrupting GluRIIC (Marrus et al., 2004), GluRIID (Featherstone et al., 2005), or GluRIIE (Qin et al., 2005) cause lethality in larvae, while double mutants lacking both GluRIIA and GluRIIB are similarly nonviable (DiAntonio et al., 1999; Petersen et al., 1997). Our observation that adult indirect flight muscles seem to function without these “essential” subunits redefines what constitutes the minimal receptor complement for glutamatergic neuromuscular transmission in the fly.
We found that Neto, the obligate auxiliary subunit required for GluR receptor function (Han et al., 2024; Kim et al., 2012), is expressed in all larval and adult muscles, including the indirect flight muscles. This result suggests that glutamate is indeed the primary neurotransmitter at all adult NMJs, consistent with extensive evidence that Drosophila motor neurons release glutamate (i.e., they express the vesicular glutamate transporter, vGlut (Baek and Mann, 2009; Brierley et al., 2012; Daniels et al., 2008)). Thus, some adult muscles may use an alternative glutamate receptor composition that has yet to be characterized. Functional glutamate receptors without the previously assumed “essential” GluRIIC subunit have not been previously described. One past study (Han et al., 2015) explored many combinations of GluR subunits through functional reconstitution in a heterologous expression system, but they did not directly test many of the combinations we describe here, such as GluRIIB/IID/IIE in the tibia extensor muscles.
One possibility is that adult muscles express novel or uncharacterized glutamate receptor subunits from among the 16 iGluR genes encoded in the Drosophila genome, several of which have not been functionally characterized. A candidate that stands out is Clumsy. Our results showed that Clumsy is broadly expressed throughout the adult fly, including in muscles controlling the legs, wings, halteres, proboscis, and neck (Figure s10). In comparison, Clumsy is completely absent from larval muscle. Clumsy was originally identified as a mutant with impaired adult locomotion (Berger, 2008; Huen et al., 2001), though this work was never published in a peer-reviewed journal. The gene is phylogenetically related to the GluRIIs (Li et al., 2016), but its function is poorly understood compared to the other subunits expressed in larval muscle. For example, it is not known whether Clumsy interacts with Neto-β. More work is needed to understand the function of Clumsy at the neuromuscular junctions of adult Drosophila.
Adult abdominal muscles are similar to larvae
Our observation that adult abdominal muscles largely maintain the canonical larval GluRII receptor composition provides important developmental context for understanding receptor diversity. Adult abdominal muscles derive directly from larval body wall muscles through remodeling during metamorphosis, rather than through complete de novo muscle formation (Currie and Bate, 1991; Kimura and Truman, 1990). This developmental continuity is reflected in the persistence of the larval receptors, suggesting that the molecular identity established during larval stages is maintained through metamorphosis into muscles that mediate slower abdominal movements (e.g., abdominal pumping during flight (Lehmann and Heymann, 2005)).
In contrast, adult leg and flight muscles arise through de novo myogenesis during pupal development (Gunage et al., 2017), providing an opportunity for the developmental program to specify alternative receptor compositions tailored to the biomechanical demands of adult locomotion. The correlation between developmental origin and receptor composition suggests that muscle lineage may contribute to determining synaptic molecular architecture, with metamorphically-remodeled muscles maintaining larval characteristics and newly formed muscles adopting novel molecular identities.
Extrasynaptic glutamate-gated chloride channels in adult muscle
We identified robust expression of GluClα in adult leg and flight muscles, where the channels localize extrasynaptically along muscle fiber edges rather than at neuromuscular junctions. This finding provides molecular support for classical electrophysiological studies in locusts that described glutamate-gated hyperpolarizing responses (H-receptors) in leg muscles that were functionally and pharmacologically distinct from excitatory D-receptors at the NMJ (Cull-Candy, 1976; Dudel et al., 1989; Lea and Usherwood, 1973). These studies demonstrated that locust leg muscles exhibit two types of glutamate responses: fast depolarizing currents with 1-2 ms kinetics mediated by cation channels at synaptic sites, and slower hyperpolarizing currents with 20-50 ms kinetics mediated by chloride channels distributed extrasynaptically across the muscle surface. Similar observations were made in other invertebrate preparations, including yellow mealworm beetle coxa muscles (Saito and Kawai, 1985) and lobster gastric muscles (Lingle and Marder, 1981), suggesting that extrasynaptic inhibitory glutamate receptors may be a widespread feature of invertebrate muscle physiology. Our identification of GluClα in adult Drosophila muscles extends these findings to a genetically tractable organism and raises important questions about the functional role of extrasynaptic inhibitory receptors in motor control.
We hypothesize that ambient glutamate in the hemolymph, released either from synaptic spillover or from non-neuronal sources, could activate these channels to modulate muscle excitability and tone. By providing tonic hyperpolarization, extrasynaptic GluClα could increase the threshold for muscle activation, potentially preventing inappropriate or excessive contraction. GluClα could also function as a negative feedback controller, in the sense that excess glutamate built up during periods of intense motor activity could activate GluClα to reduce muscle excitability. Ambient glutamate levels in the hemolymph of Drosophila larvae are quite high (1-3 mM (Augustin et al., 2007)), while GluClα is fully saturated in oocytes at a glutamate concentration of ∼100 μM (Kane et al., 2000). This feedback mechanism would be particularly important in adult muscles that must sustain precise force control during complex, energetically demanding behaviors like flight and walking.
Comparison to other animals
Our finding of muscle-specific and developmental regulation of postsynaptic receptor composition parallels glutamatergic synapse heterogeneity in the mammalian brain (Wichmann and Kuner, 2021) and neuromuscular system (Sanes and Lichtman, 1999). During mammalian development, fetal acetylcholine receptors containing the γ subunit are replaced by adult receptors containing the ε subunit at the neuromuscular junction, resulting in altered conductance and channel kinetics (Cetin et al., 2020). Similarly, the distribution of acetylcholine receptors shifts from diffuse expression across the muscle surface to tight clustering at synaptic sites (Sanes and Lichtman, 1999).
While our results reveal that Drosophila muscles express extrasynaptic GluClα, mature vertebrate skeletal muscle fibers are not known to express inhibitory neurotransmitter receptors. Instead, they rely on the voltage-gated chloride channel ClC-1 to stabilize the resting membrane potential and prevent hyperexcitability (Pedersen et al., 2016). In vertebrate muscle, extrajunctional acetylcholine receptors are upregulated after injury (Hartzell and Fambrough, 1972), which is thought to increase muscle excitability and facilitate motor neuron reinnervation. Excitatory glutamate receptors are also upregulated after injury in locust leg muscles, while the inhibitory receptors remain unchanged (Cull-Candy, 1975).
Muscle-specific receptor tuning correlates with biomechanical demands
The heterogeneity in glutamate receptor expression we observed across different muscle types may reflect adaptation to specific biomechanical requirements. Larval body wall muscles mediate slow, rhythmic peristaltic waves against a hydrostatic skeleton, requiring sustained contractions with relatively slow temporal dynamics (0.5-2 Hz, (Heckscher et al., 2012)). In contrast, walking requires precise, graded force control to move jointed limbs against a rigid exoskeleton at higher frequencies (5-20 Hz, (Pratt et al., 2024)). As in other animals, different motor neurons and muscles within the fly leg are specialized for controlling rapid and powerful ballistic movement vs. slow postural stabilization (Azevedo et al., 2020). Different iGluR subunits exhibit a wide range of desensitization kinetics (DiAntonio et al., 1999). Our results raise the possibility that the expression of specific postsynaptic neurotransmitter receptors is tailored to the biomechanical function of different muscles and even fibers within a muscle (e.g., slow vs. fast-twitch).
Fly flight demands even higher frequency muscle contraction. To achieve this, the indirect flight muscles are asynchronous: the motor neurons spike at ∼6 Hz while the stretch-activated muscles contract at >200 Hz (Dickinson and Tu, 1997). In contrast, direct flight muscles at the base of the wing hinge provide fine-tuned steering control through synchronous contraction with motor neuron spiking. While we found that the indirect flight muscles lack expression of canonical GluRs, the direct flight muscles do faintly express GluRIIA. The differential receptor expression between direct and indirect flight muscles may reflect their distinct functional roles: power production vs. steering may require unique receptor kinetics, conductances, and desensitization properties.
Another major finding from larval NMJ studies is presynaptic homeostasis, wherein reduction of postsynaptic GluRs triggers compensatory increases in presynaptic neurotransmitter release. Our discovery that adult leg and flight muscles lack canonical postsynaptic GluRII receptors raises critical questions about whether and how homeostatic mechanisms operate at these specialized synapses. Do muscles lacking canonical iGluR receptors retain the capacity for presynaptic homeostatic potentiation? If so, what postsynaptic sensors and retrograde signals mediate this plasticity? Alternatively, do highly specialized muscles trade plasticity for precision, relying on fixed synaptic properties that are established during development and remain relatively stable throughout adult life?
Limitations
Our study employed multiple complementary approaches to characterize receptor expression patterns. The convergence of results across GAL4 reporter expression, antibody staining, endogenous tagging, and single-cell RNA-seq data supports our conclusions about differences between larval and adult muscles. However, several technical limitations should be noted. GAL4 reporters may not capture all aspects of endogenous gene regulation. Antibody specificity, while validated in larval muscles, may differ in the adult. Single-cell RNA-seq provides a snapshot of the transcriptome but does not directly assess protein expression or localization. In the future, electrophysiological recordings from adult NMJs and GluR mutant characterization will be essential to more directly assess synaptic transmission properties and to confirm the functional consequences of the receptor expression patterns we describe.
Conclusions
Our findings challenge the assumption that insights from larval NMJs generalize to adult flies and highlight the importance of examining neuromuscular function in appropriate developmental and anatomical context. More broadly, our results emphasize that developmental stage and tissue identity shape synaptic molecular architecture. As the field moves toward comprehensive, multi-scale models of motor control that integrate connectomics, biomechanics, and neural dynamics, it will be important to define the molecular and functional properties of synaptic transmission for different muscles. Understanding neuromuscular diversity and the principles that govern it will be essential for building accurate models of motor control and for understanding how the nervous system adapts its output to match the mechanical properties of the effectors it must control.
Materials and Methods


Sample preparation for confocal imaging of GAL4/UAS in hemisected adult flies
For imaging GFP expression in hemisected adult flies, we fixed whole female flies in fixative (4% paraformaldehyde in PBS). Next, flies were one by one transferred to a small drop of Tissue-Tek O.C.T., frozen on a glass slide on dry ice for 15 seconds, sliced along the anterior-posterior axis with a fine razor blade and transferred to a well with fixative for one minute, until the O.C.T. melted and dissolved. The tissue was then washed 3 times in PBS containing 0.2% Triton-X (PBST) over one hour. Tissue was cleared in FocusClear for 20 minutes and mounted in Mount Clear on a slide with four layers of 3M double-stick tape for spacers. Preps were imaged on a Confocal Olympus FV1000.
For imaging of whole larvae, we transferred larvae to a drop of Vectashield on a glass slide with double-stick tape spacers. We froze the larvae in Vectashield for 5 minutes to immobilize them, then covered the larvae with a coverslip, and immediately imaged them on a Leica DMI6000 widefield microscope (UW Keck Imaging Center). Images were processed in FIJI (Schindelin et al., 2012).
Immunohistochemistry and NMJ imaging
The tissue was fixed in the same manner as above. Femurs were bisected longitudinally in O.C.T. to allow reagent penetration. All fixing and staining steps were at room temperature with gentle nutation. Tissue was put into a blocking solution (5% goat serum, PBS, 0.2% Triton-X) for 1 hour, then primary antibody solution for 24 hours. Tissue was washed three times in PBST and incubated in blocking and secondary antibody solution (see concentrations in the table below). Finally, tissue was incubated overnight in Alexa Fluor 647-nm Phalloidin in a PBS solution with the following reagents to improve tissue penetrance: 1% triton X-100, 0.5% DMSO, 0.05 mg/ml escin, and 3% normal goat serum. Tissue was washed three times with PBST over three hours, once in PBS for one hour, and mounted on a slide in Vectashield. NMJ images were collected on a Leica SP8 confocal (UW Keck Imaging Center). Images were processed in FIJI (Schindelin et al., 2012).
Quantification of GAL4/UAS and IHC expression for tables in Figures 2 and s13
For characterizing GAL4/UAS expression in whole larva and whole flies, we fixed and mounted a minimum of six animals per genotype. For each tissue type, we collected two 20x confocal stacks from two representative flies per genotype. (In no cases did expression patterns vary significantly; see Figure s9.) We examined the confocal stacks in FIJI and quantified the expression intensity and fraction of muscles qualitatively: three levels for intensity (undetected, weak, strong) and five levels for approximate fraction of muscles (0, 25%, 50%, 75%, or 100%).
For quantifying protein expression at neuromuscular junctions, we stained and mounted a minimum of six animals per genotype. We used a low power objective to identify general muscle regions (e.g. coxa, indirect flight muscle). We then zoomed in with a 60x microscope objective to find and collect images where an NMJ was in good view, with strong control stain (Brp) and in a focal plane close to the microscope objective for best resolution. For each staining condition and tissue type, we collected a minimum of four representative image stacks. As above, expression intensity and approximate fraction of NMJ expression was quantified qualitatively in FIJI.
To document muscle-specific GluR receptors within the femur, we mounted and collected confocal 20x stacks of ten femurs per experiment, then used the 60x objective with a 3x digital zoom to collect stacks of NMJs in specific muscle fibers. We analyzed the images qualitatively for receptor expression.
RNA-seq analysis
We accessed single-cell RNA-seq Fly Cell Atlas datasets through the SCope website (Davie et al., 2018; Li et al., 2022). Tissue types were determined based on Fly Cell Atlas annotation. Figure s11 shows the 10x Cross-tissue/Muscle system/Stringent dataset. Figure s12 shows the 10x Leg/Stringent dataset.
Tagged Neto and GluRIIB proteins
CRISPR/Cas9-mediated homology-directed repair (HDR) was performed by WellGenetics Inc. (Taipei City, 11570, Taiwan) to target the Neto (CG44328) locus to generate endogenously tagged Neto-α and Neto-β isoforms. The gRNA sequences GAACTTGAGGGGATGTACGC and GTCCCATTGACATTTAAGGA were cloned into U6 promoter plasmids to target Neto-α and Neto-β, respectively. For both isoforms, tag cassettes were inserted immediately upstream of the C-terminal stop codon via homology-directed repair using pUC57-Kan donor vectors containing flanking homology arms. The Neto-α donor contained an mScarlet-PBacGFP cassette (mScarlet, 3xGly, 3xFLAG, and a floxed 3xP3-GFP), while the Neto-β donor contained an sfGFP-3xP3-RFP cassette (sfGFP and a floxed 3xP3-RFP). These donors were microinjected into w1118 embryos alongside the respective gRNA plasmids and hs-Cas9. Successful F1 transformants were identified by marker expression (3xP3-GFP or 3xP3-RFP) and validated by genomic PCR and sequencing. Subsequently, the selection markers were excised from the confirmed lines using piggyBac transposase.
To generate the endogenously tagged GluRIIB::ALFA allele, a gRNA (TTCGACGGGTTACTCATCGC) targeting the GluRIIB C-terminus was cloned into a pU6 plasmid by GenScript (Piscataway, NJ 08854). A single-stranded DNA (ssDNA) donor template was designed to insert an ALFA tag flanked by a proline linker and homology arms. To prevent Cas9 cleavage of the donor and the re-cleavage of the edited locus, two nucleotide mutations were introduced into the left homology arm to disrupt gRNA binding. The full reverse-complement ssDNA donor sequence was synthesized (TTTTTACTCCCCTACTTTTCAATTCGCCTGGTCTTTTTTTTCTTTTTCGCACTGGAAGCAGGTTCTG TGAGCCGTCGCCTCAGCTCTTCTTCCAGCCTACTTGGACTTGTAATTTGCTCCAAGGATGAGTAAC CCGTCGAAGTTGAATCCCGACTTTGGCGATAGGTGTGCAGCGGTTTTCT) by Integrated DNA Technologies (IDT; Coralville, IA 52241). The gRNA plasmid and ssDNA donor were co-injected into vas-Cas9 embryos (BDSC #51324) by Bestgene (Chino Hills, CA 91709). Correct insertions were identified via PCR screening using the following primers: GATTCGGTGGGTGGACTGTTC (forward) and CGTATTTCACTGAATGTTCGCAAGC (reverse). Successful editing was subsequently confirmed by Sanger sequencing and immunostaining.
GluRIIE antibody
To generate the anti-GluRIIE antibody, the peptide C-SASIYSRSRQSSMSVASVAQESQ was synthesized by Bio-Synthesis, Inc. (Lewisville, TX 75057, USA). This antigen was used for rabbit immunization and subsequent affinity purification of the sera by Cocalico Biologicals (Denver, PA 17517, USA).
Table of Fly Stocks



Table of Genotypes


Data availability
All data generated or analyzed during this study are included in the manuscript and supporting files. Original confocal stacks are available from the authors upon request. Single-nucleus RNA-seq data analyzed in this study are from the publicly available Fly Cell Atlas dataset (Li et al., 2022), accessible through SCope (https://scope.aertslab.org). Fly stocks and antibodies generated for this study are available upon request from the corresponding author.
Acknowledgements
We thank members of the Tuthill and Brunton Labs for technical assistance and feedback on the manuscript, especially Tony Azevedo for his help with understanding leg musculature. We thank Himanshu Gupta for sharing unpublished results and helpful discussions about leg motor neurons. We acknowledge the UW Keck Microscopy Center and its NIH S10 funding (S10 OD016240). We acknowledge the Developmental Studies Hybridoma Bank (Iowa, USA) for antibodies used in this study, and the Bloomington Drosophila Stock Center for fly stocks (NIH P40OD018537). Financial support was provided by NIH grant R01NS128785, a Searle Scholar Award, a Klingenstein-Simons Fellowship, a Pew Biomedical Scholar Award, a McKnight Scholar Award, a Sloan Research Fellowship, the New York Stem Cell Foundation, and a UW Innovation Award to J.C.T., and NIH grant R01NS126654 and NSF grant IOS-2417451 to D.D. J.C.T is a New York Stem Cell Foundation – Robertson Investigator.
Additional information
Contributions
AS and JCT conceived the study. AS collected data, performed analyses, and drafted figures. CQ, YX, and DD generated transgenic fly stocks and antibodies. AS, CQ, DD, and JCT interpreted the results. AS and JCT wrote the paper with input from CQ and DD.
Funding
HHS | NIH | National Institute of Neurological Disorders and Stroke (NINDS) (R01NS128785)
John C Tuthill
Anne Sustar
Additional files
References
- The two-body problem: Proprioception and motor control across the metamorphic divideCurrent Opinion in Neurobiology 74:102546https://doi.org/10.1016/j.conb.2022.102546PubMedGoogle Scholar
- Nonvesicular Release of Glutamate by Glial xCT Transporters Suppresses Glutamate Receptor Clustering In VivoJournal of Neuroscience 27:111–123https://doi.org/10.1523/JNEUROSCI.4770-06.2007PubMedGoogle Scholar
- Connectomic reconstruction of a female Drosophila ventral nerve cordNature 631:360–368https://doi.org/10.1038/s41586-024-07389-xPubMedGoogle Scholar
- A size principle for recruitment of Drosophila leg motor neuronseLife 9:e56754https://doi.org/10.7554/eLife.56754PubMedGoogle Scholar
- Lineage and Birth Date Specify Motor Neuron Targeting and Dendritic Architecture in Adult DrosophilaJournal of Neuroscience 29:6904–6916https://doi.org/10.1523/JNEUROSCI.1585-09.2009PubMedGoogle Scholar
- Distributed control circuits across a brain-and-cord connectomebioRxiv https://doi.org/10.1101/2025.07.31.667571Google Scholar
- Sexual dimorphism in the complete connectome of the Drosophila male central nervous systembioRxiv https://doi.org/10.1101/2025.10.09.680999Google Scholar
- Cloning and Characterization of Clumsy (clu) a Novel Presynaptic Glutamate Receptor that Regulates Synaptic Growth at the Larval Neuromuscular Junction in Drosophila MelanogasterUniversity of Wisconsin–Madison Google Scholar
- Developmental origins and architecture of Drosophila leg motoneuronsThe Journal of Comparative Neurology 520:1629–1649https://doi.org/10.1002/cne.23003PubMedGoogle Scholar
- The Structure, Function, and Physiology of the Fetal and Adult Acetylcholine Receptor in MuscleFrontiers in Molecular Neuroscience 13:581097https://doi.org/10.3389/fnmol.2020.581097PubMedGoogle Scholar
- Two types of extrajunctional L-glutamate receptors in locust muscle fibresThe Journal of Physiology 255:449–464https://doi.org/10.1113/jphysiol.1976.sp011289PubMedGoogle Scholar
- Effect of denervation and local damage on extrajunctional L-glutamate receptors in locust muscleNature 258:530–531https://doi.org/10.1038/258530a0PubMedGoogle Scholar
- The development of adult abdominal muscles in Drosophila: myoblasts express twist and are associated with nervesDevelopment 113:91–102https://doi.org/10.1242/dev.113.1.91PubMedGoogle Scholar
- Release of acetylcholine at voluntary motor nerve endingsThe Journal of Physiology 86:353–380https://doi.org/10.1113/jphysiol.1936.sp003371PubMedGoogle Scholar
- Visualizing glutamatergic cell bodies and synapses in Drosophila larval and adult CNSJournal of Comparative Neurology 508:131–152https://doi.org/10.1002/cne.21670PubMedGoogle Scholar
- A Single-Cell Transcriptome Atlas of the Aging Drosophila BrainCell 174:982–998https://doi.org/10.1016/j.cell.2018.05.057PubMedGoogle Scholar
- Glutamate receptors at the Drosophila neuromuscular junctionInternational Review of Neurobiology 75:165–179https://doi.org/10.1016/S0074-7742(06)75008-5PubMedGoogle Scholar
- Glutamate receptor expression regulates quantal size and quantal content at the Drosophila neuromuscular junctionThe Journal of Neuroscience: The Official Journal of the Society for Neuroscience 19:3023–3032https://doi.org/10.1523/JNEUROSCI.19-08-03023.1999PubMedGoogle Scholar
- The Function of Dipteran Flight MuscleComparative Biochemistry and Physiology Part A: Physiology 116:223–238https://doi.org/10.1016/S0300-9629(96)00162-4Google Scholar
- Chloride channels gated by extrajunctional glutamate receptors (H-receptors) on locust leg muscleBrain Research 481:215–220https://doi.org/10.1016/0006-8993(89)90796-8PubMedGoogle Scholar
- An essential Drosophila glutamate receptor subunit that functions in both central neuropil and neuromuscular junctionThe Journal of Neuroscience: The Official Journal of the Society for Neuroscience 25:3199–3208https://doi.org/10.1523/JNEUROSCI.4201-04.2005PubMedGoogle Scholar
- Distinct homeostatic modulations stabilize reduced postsynaptic receptivity in response to presynaptic DLK signalingNature Communications 9:1856https://doi.org/10.1038/s41467-018-04270-0PubMedGoogle Scholar
- Drosophila adult muscle development and regenerationSeminars in Cell & Developmental Biology 72:56–66https://doi.org/10.1016/j.semcdb.2017.11.017PubMedGoogle Scholar
- Functional reconstitution of Drosophila melanogaster NMJ glutamate receptorsProceedings of the National Academy of Sciences 112:6182–6187https://doi.org/10.1073/pnas.1500458112PubMedGoogle Scholar
- The gating properties of Drosophila NMJ glutamate receptors and their dependence on NetoThe Journal of Physiology 602:7043–7064https://doi.org/10.1113/JP287331PubMedGoogle Scholar
- Acetylcholine receptors. Distribution and extrajunctional density in rat diaphragm after denervation correlated with acetylcholine sensitivityThe Journal of General Physiology 60:248–262https://doi.org/10.1085/jgp.60.3.248PubMedGoogle Scholar
- Building and modifying diverse synaptic properties: Insights from DrosophilaCurrent Opinion in Neurobiology 92:102995https://doi.org/10.1016/j.conb.2025.102995PubMedGoogle Scholar
- Characterization of Drosophila Larval Crawling at the Level of Organism, Segment, and Somatic Body Wall MusculatureJournal of Neuroscience 32:12460–12471https://doi.org/10.1523/JNEUROSCI.0222-12.2012PubMedGoogle Scholar
- Invertebrate muscles: muscle specific genes and proteinsPhysiological Reviews 85:1001–1060https://doi.org/10.1152/physrev.00019.2004PubMedGoogle Scholar
- Cloning of clumsy: a mutation affecting gait and ether sensitivity in Drosophila melanogasterIn: A. Dros. Res. Conf. :820AGoogle Scholar
- Drug-resistant Drosophila indicate glutamate-gated chloride channels are targets for the antiparasitics nodulisporic acid and ivermectinProceedings of the National Academy of Sciences of the United States of America 97:13949–13954https://doi.org/10.1073/pnas.240464697PubMedGoogle Scholar
- Drosophila Neto is essential for clustering glutamate receptors at the neuromuscular junctionGenes & Development 26:974–987https://doi.org/10.1101/gad.185165.111PubMedGoogle Scholar
- Postmetamorphic cell death in the nervous and muscular systems of Drosophila melanogasterThe Journal of Neuroscience: The Official Journal of the Society for Neuroscience 10:403–411https://doi.org/10.1523/JNEUROSCI.10-02-00403.1990PubMedGoogle Scholar
- Neurochemical Organization of the Drosophila Brain Visualized by Endogenously Tagged Neurotransmitter ReceptorsCell Reports 30:284–297https://doi.org/10.1016/j.celrep.2019.12.018PubMedGoogle Scholar
- The site of action of ibotenic acid and the identification of two populations of glutamate receptors on insect muscle-fibresComparative and General Pharmacology 4:333–350https://doi.org/10.1016/0010-4035(73)90045-1PubMedGoogle Scholar
- Unconventional mechanisms control cyclic respiratory gas release in flying DrosophilaJournal of Experimental Biology 208:3645–3654https://doi.org/10.1242/jeb.01788PubMedGoogle Scholar
- Synaptic architecture of leg and wing premotor control networks in DrosophilaNature 631:369–377https://doi.org/10.1038/s41586-024-07600-zPubMedGoogle Scholar
- Fly Cell Atlas: A single-nucleus transcriptomic atlas of the adult fruit flyScience 375:eabk2432https://doi.org/10.1126/science.abk2432PubMedGoogle Scholar
- Autocrine inhibition by a glutamate-gated chloride channel mediates presynaptic homeostatic depressionScience Advances 7:eabj1215https://doi.org/10.1126/sciadv.abj1215PubMedGoogle Scholar
- Novel Functional Properties of Drosophila CNS Glutamate ReceptorsNeuron 92:1036–1048https://doi.org/10.1016/j.neuron.2016.10.058PubMedGoogle Scholar
- A glutamate-activated chloride conductance on a crustacean muscleBrain Research 212:481–488https://doi.org/10.1016/0006-8993(81)90482-0PubMedGoogle Scholar
- Glutamate is an inhibitory neurotransmitter in the Drosophila olfactory systemProceedings of the National Academy of Sciences of the United States of America 110:10294–10299https://doi.org/10.1073/pnas.1220560110PubMedGoogle Scholar
- Differential localization of glutamate receptor subunits at the Drosophila neuromuscular junctionThe Journal of Neuroscience: The Official Journal of the Society for Neuroscience 24:1406–1415https://doi.org/10.1523/JNEUROSCI.1575-03.2004PubMedGoogle Scholar
- Role of physiological ClC-1 Cl− ion channel regulation for the excitability and function of working skeletal muscleThe Journal of General Physiology 147:291–308https://doi.org/10.1085/jgp.201611582PubMedGoogle Scholar
- Homeostatic plasticity can be induced and expressed to restore synaptic strength at neuromuscular junctions undergoing ALS-related degenerationHuman Molecular Genetics 26:4153–4167https://doi.org/10.1093/hmg/ddx304PubMedGoogle Scholar
- Genetic Analysis of Glutamate Receptors in Drosophila Reveals a Retrograde Signal Regulating Presynaptic Transmitter ReleaseNeuron 19:1237–1248https://doi.org/10.1016/S0896-6273(00)80415-8PubMedGoogle Scholar
- Miniature linear and split-belt treadmills reveal mechanisms of adaptive motor control in walking DrosophilaCurrent biology: CB 34:4368–4381https://doi.org/10.1016/j.cub.2024.08.006PubMedGoogle Scholar
- Four different subunits are essential for expressing the synaptic glutamate receptor at neuromuscular junctions of DrosophilaThe Journal of Neuroscience: The Official Journal of the Society for Neuroscience 25:3209–3218https://doi.org/10.1523/JNEUROSCI.4194-04.2005PubMedGoogle Scholar
- Morphology and molecular organization of the adult neuromuscular junction of DrosophilaJournal of Comparative Neurology 468:596–613https://doi.org/10.1002/cne.10977PubMedGoogle Scholar
- Developmental changes in the glutamate receptor at the insect neuromuscular synapseDevelopmental Brain Research 18:97–102https://doi.org/10.1016/0165-3806(85)90253-6PubMedGoogle Scholar
- Development of the vertebrate neuromuscular junctionAnnual Review of Neuroscience 22:389–442https://doi.org/10.1146/annurev.neuro.22.1.389PubMedGoogle Scholar
- Mapping of multiple neurotransmitter receptor subtypes and distinct protein complexes to the connectomeNeuron 112:942–958https://doi.org/10.1016/j.neuron.2023.12.014PubMedGoogle Scholar
- The Diversity of Skeletal Muscle Fiber TypesCold Spring Harbor Perspectives in Biology 17:a041477https://doi.org/10.1101/cshperspect.a041477PubMedGoogle Scholar
- Fiji: an open-source platform for biological-image analysisNature Methods 9:676–682https://doi.org/10.1038/nmeth.2019PubMedGoogle Scholar
- Molecular cloning of an invertebrate glutamate receptor subunit expressed in Drosophila muscleScience 254:112–114https://doi.org/10.1126/science.1681587PubMedGoogle Scholar
- The effect on crayfish muscle of iontophoretically applied glutamateThe Journal of Physiology 170:296–317https://doi.org/10.1113/jphysiol.1964.sp007332PubMedGoogle Scholar
- Glutamate-induced Depolarization in Crustacean MuscleNature 198:490–491https://doi.org/10.1038/198490a0Google Scholar
- Glutamate receptors in synaptic assembly and plasticity: case studies on fly NMJsAdvances in Experimental Medicine and Biology 970:3–28https://doi.org/10.1007/978-3-7091-0932-8_1PubMedGoogle Scholar
- Whole-body physics simulation of fruit fly locomotionNature 643:1312–1320https://doi.org/10.1038/s41586-025-09029-4PubMedGoogle Scholar
- Bruchpilot, a Protein with Homology to ELKS/CAST, Is Required for Structural Integrity and Function of Synaptic Active Zones in DrosophilaNeuron 49:833–844https://doi.org/10.1016/j.neuron.2006.02.008PubMedGoogle Scholar
- NeuroMechFly v2: simulating embodied sensorimotor control in adult DrosophilaNature Methods 21:2353–2362https://doi.org/10.1038/s41592-024-02497-yPubMedGoogle Scholar
- Heterogeneity of glutamatergic synapses: cellular mechanisms and network consequencesPhysiological Reviews https://doi.org/10.1152/physrev.00039.2020PubMedGoogle Scholar
Article and author information
Author information
Version history
- Preprint posted:
- Sent for peer review:
- Reviewed Preprint version 1:
Cite all versions
You can cite all versions using the DOI https://doi.org/10.7554/eLife.111371. This DOI represents all versions, and will always resolve to the latest one.
Copyright
© 2026, Sustar et al.
This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.
Metrics
- views
- 426
- downloads
- 21
- citations
- 0
Views, downloads and citations are aggregated across all versions of this paper published by eLife.