Abstract
Summary
The telencephalon and eye in mammals are originated from adjacent fields at the anterior neural plate. Morphogenesis of these fields generates telencephalon, optic-stalk, optic-disc, and neuroretina along an axis. How these telencephalic and ocular tissues are specified coordinately to ensure directional retinal ganglion cell (RGC) axon growth is unclear. Here, we report the self-formation of human telencephalon-eye organoids comprising concentric zones of telencephalic, optic-stalk, optic-disc, and neuroretinal tissues along the center-periphery axis. Initially-differentiated RGCs grew axons towards and then along a path defined by adjacent PAX2+ optic-disc cells. Single-cell RNA sequencing identified expression signatures of two PAX2+ cell populations that mimic optic-disc and optic-stalk, respectively, mechanisms of early RGC differentiation and axon growth, and RGC-specific cell-surface protein CNTN2, leading to one-step purification of electrophysiologically-excitable RGCs. Our findings provide insight into the coordinated specification of early telencephalic and ocular tissues in humans and establish resources for studying RGC-related diseases such as glaucoma.
eLife assessment
The study is important as the authors successfully developed a human telencephalon-eye organoid model that exhibited remarkable pathfinding and growth of retinal ganglion cell (RGC) axons. The identification of cell-surface markers for RGCs could have significant implications for understanding the molecular mechanisms involved in RGC axon development and regeneration. While the authors' data on the developmental patterning organoid model are compelling, the reviewers had significant concerns, implying that the study could still be substantially improved.
Introduction
Our understanding of eye and brain development in humans is mostly deduced from animal studies. In mice, fate mapping of the anterior neural plate reveals that the eye field is in rostral regions surrounded anteriorly and laterally by the telencephalic field and caudally and medially by the hypothalamic field, indicating the proximity of their embryonic origins 1. Subsequent evagination of the eye field generates bilateral optic vesicles and optic stalks; the optic stalks connect the optic vesicles to the forebrain, forming a midline-periphery axis. The optic vesicle then invaginates ventrally, resulting in the formation of double-layered optic cups in which the inner and outer layers develop into the neuroretina and retina pigment epithelium (RPE), respectively. The posterior pole of the optic-cup forms the optic disc (also known as optic nerve head). In the central neuroretina close to the nascent optic disc, retinal ganglion cells (RGCs) start to appear as the optic fissure nearly closes. Early RGC axons find their path toward the optic disc and then enter the optic stalk to reach the brain. Concentrically organized growth- promoting and growth-inhibitory guidance molecules around the optic disc regulate RGC axon growth and pathfinding through multiple mechanisms 2–4. Coinciding with the optic-cup formation, the surface ectoderm facing the optic vesicle develops into lens. Collectively, the early development of telencephalic and ocular tissues is highly coordinated in mammals.
Early telencephalic and eye development is marked and regulated by a group of tissue-specific transcription factors and signal transduction molecules 5. In mice, Foxg1 is specifically expressed in the presumptive telencephalon and is essential for the development of the cerebral hemispheres 6. Pax6 is specifically expressed in the eye field and is essential for the development of multiple ocular lineages, such as the neuroretina, lens, and RPE 7–10. Vsx2 and Mitf are specifically expressed in the neuroretina and RPE, respectively, and are essential for retinal development 11–14. Pax2 is expressed in the optic stalk, optic vesicles, central neuroretina, and optic disc; Pax2 is essential for optic stalk and nerve development 15–18. Fgf8 is specifically expressed at the rostral forebrain at early stages, induces Foxg1 expression 19, and regulates telencephalic patterning in a dose-dependent manner 20. Fgf8 also maintains Pax2 expression in the optic stalk 21, and Fgf8 and Fgf3 coordinate the initiation of retinal differentiation in chicks 22, 23. Despite these findings in vertebrates, it is unclear how telencephalic and ocular tissues are specified in humans.
Human organoids are transformative since they enable us to study the mechanisms of cell specification and differentiation directly in humans 24. Self-organized three-dimensional (3-D) retinal organoids are originally reported by Sasai’s group and further improved in follow-up studies 25–33. We and others have demonstrated that retinal organoids derived from human embryonic stem cells (hESCs) display a stratified structure containing all major types of retinal cells. Although RGCs are differentiated in 3-D retinal organoids, there is no proper RGC axon outgrowth toward the optic disc as seen in vivo since the optic disc-like tissue is missing in retinal organoids. When these organoids are dissociated into single cells or cut into pieces for adherent culture, RGCs generate neurites 34–36. A variety of brain organoids have been described 37–41. Although rudimentary ocular tissues are occasionally found in some brain organoids 42, ocular and brain tissues are not patterned along any defined axis. Assembloids, in which retinal, thalamic, and cortical organoids are assembled 32, do not contain any optic disc and stalk tissues. Collectively, RGC axon outgrowth and pathfinding directed by optic disc and stalk tissues in organoids have not been reported. Since RGCs degenerate in glaucoma and cell replacement therapies are actively evaluated, it is imperative to establish models for studying RGC axon growth and pathfinding in humans.
Tissue patterning and coordinated specification are fundamental for body plan formation in vivo. Remarkably, concentric zones of trophectoderm, endoderm, mesoderm, and ectoderm 43, 44, neural plate and neural plate border 45, and ectodermal cells 46 are self-organized from single pluripotent stem cells, indicating patterning and coordinated specification of these tissues in vitro. Nevertheless, optic disc and stalk tissues are not reported in any of these structures.
We hypothesize that coordinated specification from the anterior ectodermal epithelium via morphogen gradients leads to self-organization of telencephalic and ocular tissues, including optic disc- and stalk-like tissues that provide guidance cues for RGC axon growth and pathfinding. In support of this hypothesis, we generated self-formed human telencephalon-eye organoids that comprise concentric zones of anterior ectodermal progenitors (CONCEPT), including tissues mimicking FOXG1+ telencephalon, PAX2+ optic stalk, PAX2+ optic disc, VSX2+ neuroretina, and PAX6+ multi-lineage tissues along the center-periphery axis. We refer these tissues as telencephalon, optic stalk, optic disc, and neuroretina for the sake of gene marker expression, tissue functions, and the ease of description; we do not claim these tissues represent in vivo tissues in all aspects. We call this structure as an organoid since it displays a well-organized structure with cell identities mimicking those tissues in vivo. In CONCEPT organoids, early differentiated RGCs grew their axons toward and then along a path defined by adjacent PAX2+ optic-disc cells. Single-cell RNA sequencing of CONCEPT organoids not only confirmed telencephalic and ocular identities but also discovered expression signatures of cell clusters. We found that PAX2+ optic-disc cells differentially expressed FGF8 and FGF9; inhibition of FGF signaling with an FGFR inhibitor during early RGC differentiation drastically decreased RGCs somas and nearly ablated directional axon growth. Using cell-surface marker CNTN2 identified in our single-cell RNA-sequencing, we developed a one-step method for isolating human electrophysiologically-excitable RGCs under a native condition. Our studies provide deeper insight into the coordinated specification of telencephalic and ocular tissues to ensure guided RGC axon growth in humans and establish resources for studying neurodegenerative diseases such as glaucoma.
Results
Generation of a telencephalon-eye organoid that is composed of concentric zones of anterior ectodermal progenitors (CONCEPT)
The telencephalon and eye in mammals are originated from adjacent fields at the anterior neuroepithelium 1. Morphogenesis of these embryonic fields leads to the formation of telencephalon, optic stalk, optic disc, and neuroretina along an axis. Early differentiated retinal ganglion cells (RGCs) in the neuroretina grow axons toward the optic disc and then along the optic stalk to reach the brain. How these telencephalic and ocular tissues are specified coordinately to ensure directional RGC axon growth is unclear in humans.
Cysts are hollow spheres of an columnar epithelium induced from human pluripotent stem cells through embedding hESC sheets in Matrigel; they are used to generate retinal cells 28, 33, 47. Nevertheless, developmental potentials of cysts have not been characterized.
Using the cysts, here we generate a telencephalon-eye organoid that is composed of concentric zones of anterior ectodermal progenitors (CONCEPT) from cysts (Fig. 1A, B). Cysts were generated as previously described 28, 33. The epithelial structure of cysts was demonstrated by apically localized TJP1::GFP reporter at the lumen (Fig. 1C), consistent with previous findings 28, 47. To assess developmental potentials of cysts, individual cysts were manually picked and then seeded onto the Matrigel-coated surface at low densities (Fig. 1A). After attaching to the culture surface, cysts initially grew as dome-shaped individual colonies. Subsequent culture of the colonies in a KSR medium (see Materials and Methods) led to the self-formation of concentric zones of anterior ectodermal progenitors: an elevated central zone surrounded by multiple zones; this morphology was distinguishable under a steoromicroscope (Fig. 1D) or an inverted microscope. CONCEPT structures were highly reproducible, which is demonstrated by consistent gene expression profiles of multiple CONCEPT organoids in whole culture wells (Fig. S1). If multiple cysts were fused together or cysts for seeding were too big or small, CONCEPT structures were affected or incomplete. CONCEPT structures expressed gene markers for telencephalon and eye in concentric patterns. In mice, Foxg1 is specifically expressed in the E10 telencephalon at high levels; it was also expressed in the optic stalk, invaginating optic cup, and lens at lower levels, with the rostral optic stalk connecting the telencephalic vesicle to the invaginating optic cup (Fig. 1E) 6; Vsx2 is specifically expressed in the E10.5 neuroretina (Fig. 1F); Pax6 is specifically expressed in the E10.5 neuroretina, RPE, lens vesicles, and surface ectoderm (Fig. 1G) 13. In CONCEPT structures, the expression of FOXG1, VSX2, and PAX6 generally exhibited concentric patterns spanning from the center to the periphery (Fig. 1H-O). Similar to FOXG1, telencephalon marker EMX2 48 was also expressed at the central region (Fig. S1F). PAX6 was expressed in multiple concentric zones at distinct levels, mimicking its expression patterns in multiple ocular tissues in E10.5 mouse eyes (Fig. 1G, J, K, N, O). Therefore, the CONCEPT structure is a telencephalon-eye organoid mimicking telencephalic and ocular tissues in the aspects of cell types and patterning at early stages.
Morphogens FGFs and BMPs play crucial roles in patterning the forebrain and eye in vivo. In mice, Fgf8 is specifically expressed at the rostral forebrain at early stages, induces Foxg1 expression 19, and regulates telencephalic patterning in a dose-dependent manner 20. Bmp4 and Bmp7 are expressed in the dorsomedial telencephalon, optic vesicles, and presumptive lens placodes 49–52. Bmp4 is required for lens induction 50, and Bmp7 is required for proper patterning of the optic fissure 53. In CONCEPT telencephalon-eye organoids, FGF8, BMP4, and BMP7 were expressed in attached cell colonies starting from early stages (Fig. 1P, S, T) and subsequently exhibited circular patterns (Fig. 1R, V, W). At day 10, the expression of BMP4 and BMP7 delineated multiple rings, with a big ring mostly at the center surrounded by numerous small rings (Fig. 1P, S). These observations suggest that the attachment of a single-lumen cyst to the culture surface caused differences in cell behaviors: some cells separated from the original cyst and migrated peripherally; some of the separated cells formed small ring-like structures; the cells that remained at the center formed a big ring-like structure. At day 17, circular patterns of BMP4 and FGF8 emerged (Fig. 1Q, U). At day 25, BMP4, FGF8, and BMP7 clearly exhibited circular patterns (Fig. 1R, V, W). Hence, FGFs and BMPs spontaneously form circular gradients, which would dictate coordinated cell specification in CONCEPT telencephalon-eye organoids.
Early differentiated RGCs grow directional long axons toward and then along a path defined by PAX2+ cell populations in CONCEPT telencephalon-eye organoids
To assess cell differentiation in CONCEPT telencephalon-eye organoids, we examined marker expression for RGCs, the first type of cells that differentiate in the neuroretina. In mice, transcription factor Pou4f2 is expressed in the early differentiated RGCs and required for the development of a large set of RGCs 54. Tubb3 is expressed in the somas and axons of differentiating RGCs.
In CONCEPT organoids, POU4F2 and TUBB3 were detectable as early as day 17 and increased to higher levels at day 22. RGC somas were marked by POU4F2 and TUBB3 co- expression; RGC axons were marked by TUBB3 expression. Interestingly, RGCs grew directional long axons that followed a circular path (Fig. 2A, B). The circular path of RGC axon outgrowth became more evident in organoids at day 26 (Fig. 2C, D). In mice, the initially differentiated RGCs are adjacent to the optic disc; their axons grow towards the optic disc to exit the eye and then navigate within the optic stalk to reach their targets in the brain; the optic disc and stalk specifically express Pax2 at distinct levels (Fig. 2E-G) 17, 55, 56; presumptive optic disc cells expressed VSX2 whereas optic stalk cells do not 13 (Fig. 1F; 2E). In CONCEPT organoids, there were two PAX2+ cell populations that formed two adjacent rings (Fig. 2H-L). POU4F2+ RGCs grew TUBB3+ axons toward and then navigated along the adjacent PAX2+ VSX2+ cell population (Fig. 2H-L), mimicking axon growth from the initial RGCs toward the PAX2+ optic disc in vivo. Meanwhile, PAX2+ VSX2- cell population at the inner zone set up an inner boundary of the path for RGC axon growth, mimicking PAX2+ optic stalk that spatially confines RGC axon growth in vivo. Based on these findings, we designate PAX2+ VSX2+ cells and PAX2+ VSX2- cells as the optic disc and optic stalk, respectively. Taken together, our findings demonstrate that RGCs grow directional axons toward and then along a path defined by PAX2+ cell populations in CONCEPT telencephalon-eye organoids.
CONCEPT telencephalon-eye organoids contain lens cells that undergo terminal differentiation
CONCEPT telencephalon-eye organoids at stages around day 25 contained transparent structures reminiscent of the ocular lens. To determine their cell identity, we performed immunostaining. Starting at day 22, lens markers CRYAA and CRY B were found (Fig. 3A, B) and continuously expressed in the transparent cell structures (Fig. 3C, D). Interestingly, these transparent structures were not stained by DAPI (Fig. 3C-F), indicating denucleation in these lens cells. When CONCEPT organoids were detached using Dispase at around day 28 and continuously grown as suspension cultures, crystal-like clusters with fused transparent spheres were found, and they continuously survived for months (Fig. 3I, J). In mice, terminally- differentiated lens fiber cells are free of organelles and featured by specialized interlocking cell membrane domains shown as ball-and-sockets and protrusions 57. Using transmission electron microscopy, we found that the crystal-like lens clusters were free of organelles and exhibited ball-and-socket structures (Fig. 3K, L). Taken together, our findings demonstrate that CONCEPT telencephalon-eye organoids contain lens cells that undergo terminal differentiation; FGFs in CONCEPT organoids likely promote terminal lens differentiation as seen in other settings 58.
Single-cell RNA sequencing analysis identifies telencephalic and ocular cell populations in CONCEPT telencephalon-eye organoids
To fully characterize cell populations in CONCEPT organoids and the mechanisms underlying RGC axon pathfinding, we performed 10x single-cell RNA sequencing of the organoids at day 24, around the stage when RGCs grew long axons toward and along the PAX2+ VSX2+ cell population. Cell Ranger mapping showed that 11158 single cells were sequenced at a depth of 27,842 reads and 2,967 genes per cell, and the dataset were then analyzed using Seurat (v3.2.0) 59. Cell filtration (nFeature_RNA > 200 & nFeature_RNA < 6000 & percent.mt < 20) resulted in 10218 cells with high quality. Cell clustering grouped cells into 14 clusters (Fig. 4A; Tab. 1). In addition, cell cycle scores were plotted using an established method (Fig. 4B) 60. Several cell clusters, e.g., clusters 4, 8, 9, were separated along cell cycle scores (Fig. 4A, B), indicating the differences in cell cycle phases across these cell clusters.
We next assessed cell identities using known markers. Mesoderm, endoderm, and neural crest are identified by a group of gene markers 61–64. In CONCEPT organoids, gene markers for mesoderm (TBXT, GATA2, HAND1), endoderm (GATA1, GATA4, SOX17), and neural crest (SNAI1, SOX10, FOXD3) were not expressed (Fig. S2). In contrast, gene markers for the anterior neuroectoderm were widely expressed. Telencephalic progenitor marker FOXG1 was expressed in clusters 10, 3, 12, 1, 4, 8, 9, 13; retinal progenitor markers PAX6 and VSX2 were expressed in clusters 2, 7, 5, 6, 11 (Fig. 4C-E). Cluster 0 was defined by a group of negative markers (Fig. S3); they expressed both FOXG1+ telencephalic cells and PAX6+ and/or VSX2+ retinal cells. In contrast to telencephalon and retinal markers, diencephalon markers (GBX2, WNT3, SOX14) 65, 66 and midbrain/hindbrain markers (EN2, PAX7, TFAP2B) 61 were rarely expressed (Fig. S4). Lens markers CRYAA and FOXE3 were expressed in a very small cell population; those denucleated lens cells were not captured in the scRNA-seq since the absence of nucleus prevented active mRNA transcription. Therefore, lens cells did not form a separate cluster probably due to their very low abundance. Taken together, these findings indicate that CONCEPT telencephalon-eye organoids at day 24 are mostly composed of FOXG1+ telencephalic cells and PAX6+ and/or VSX2+ retinal cells.
We next characterized the FOXG1+ telencephalic cells via assessing differentially expressed genes (DEGs). DEGs in clusters 4, 8, 9, 1 included POU3F3, RGMA, EDNRB, and SOX3, which orthologs in mice are expressed in the pallium. DEGs in clusters 12, 3, 10 included DLX2, RGS16, DLX1, DLL1, DLX6-AS1, NEFL, DCX, and RTN1, which orthologs in mice are expressed in the subpallium (Figs. S5, S6). Therefore, FOXG1+ telencephalic cells in CONCEPT organoids at day 24 comprise cell clusters in both the pallium and subpallium.
PAX6+ and/or VSX2+ retinal cells were also grouped into several clusters. VSX2 was expressed in clusters 2, 7, 5, and 0, with cluster 2 at G1 phase, cluster 7 in G1 and S phases, and cluster 5 in S and G2M phases (Fig. 4A, B, E). Cluster 6 did not VSX2 but expressed PAX6 and was at the G1 phase, suggesting cells in cluster 6 exited the retinal progenitor cell state and underwent cell differentiation (Fig. 4A, B, D, E). Consistently, cluster 6 differentially expressed RPE markers, e.g., PMEL, HSD17B2, DCT, and MITF (Fig. S7), indicating they were mostly differentiating RPE. Cluster 11 did not express VSX2; instead, it expressed PAX6 and was at the G1 phase (Fig. 4A, B, D, E), suggesting that cells in cluster 11 exited the retinal progenitor cell state and underwent cell differentiation.
Taken together, our single-cell RNA sequencing analysis of CONCEPT telencephalon-eye organoids at day 24 confirms their telencephalic and ocular identities, establishing a valuable transcriptomic dataset for mechanistic studies.
Identification of two PAX2+ cell populations that mimic to the optic disc and optic stalk, respectively, in the scRNA-seq dataset of CONCEPT telencephalon-eye organoids
To identify PAX2+ cell populations that defined the path for RGC axon outgrowth, we examined PAX2 expression in the dataset. PAX2 was mostly expressed in cluster 2 and subsets of clusters 7, 5, 0, 4, 8, and 9 (Fig. 4A, F). Since clusters 2, 7, 5, and 0 expressed VSX2 (Fig. 4E, F), we deduced that PAX2+ VSX2+ cells in cluster 2 and subsets of clusters 7, 5, and 0 corresponded to those PAX2+ VSX2+ cells that defined the path for RGC axon growth (Figs. 2H-L). Therefore, these PAX2+ VSX2+ cells in the dataset of single-cell RNA sequencing were assigned as the optic disc (OD) (Fig. 4F). PAX2+ VSX2+ cells also expressed optic disc and optic stalk marker SEMA5A (Fig. 4F, G) 67. We particularly focused on cluster 2 since PAX2+ VSX2+ cells were mostly found in this cluster. Interestingly, COL13A1 was differentially expressed in cluster 2 (Fig. 4H; Fig. S10); in situ hybridization indicates that COL13A1 is specifically expressed in the optic disc of human fetal retinas 68. These findings firmly support that PAX2+ VSX2+ cells in CONCEPT telencephalon-eye organoids corresponded to optic disc cells in human fetal retinas. Cluster 2 also differentially expressed glaucoma gene CYP1B1, signaling molecules LEFTY2, FGF9, and FGF8 (Fig. 4I-L; Fig. S10). The expression of PAX2, SEMA5A, CYP1B1, LEFTY2, FGF9, and FGF8 in CONCEPT organoids was validated using in situ hybridization (Figs. 1T-V; 5B-E; S10). In contrast, PAX2+ VSX2- cells in subsets of clusters 4, 8, 9 (Fig. 4A, E, F) expressed the optic stalk marker VAX1 (Fig. 4F, M); these cells corresponded to those PAX2+ VSX2- cells that set up the inner boundary of the path for RGC axon growth in CONCEPT organoids (Fig. 2H-L).
Therefore, PAX2+ VSX2- cells in subsets of clusters 4, 8, 9 were assigned as the optic stalk (OS) (Fig. 4F). PAX2+ VSX2- optic stalk cells also differentially expressed CNTNAP2, ALDHA3, and LAMP5 (Fig. 4N-P), which orthologs in mice are expressed in the optic stalk/nerve (Fig. S8). Compared to PAX2+ VSX2+ optic disc cells, PAX2+ VSX2- optic stalk cells were closer to telencephalic cells in both the UMAP plot (Fig. 4M-P; Fig. S5A-D) and their positioning in CONCEPT organoids (Fig. 2H-L), mimicking relative positions of telencephalon, optic stalk, and optic disc along the midline-periphery axis in E10.5-E13.5 mouse embryos (Figs. 1E, 2E-G). Consistently, several markers for PAX2+ VSX2- optic stalk cells were also expressed in the telencephalon (Fig. S8). Collectively, we identify two PAX2+ cell populations that mimic the optic disc and optic stalk, respectively, in the scRNA-seq dataset of CONCEPT telencephalon- eye organoids.
Identification of glycosylphosphatidylinositol (GPI)-anchored cell membrane protein CNTN2 as a specific marker for developing human RGCs
To identify RGCs in the dataset, we checked the expression of RGC markers. We found that RGC markers ATOH7, POU4F2, SNCG, and CNTN2 were differentially expressed in cluster 11, indicating its RGC identity (Fig. 4A, 4Q-T). CNTN2 caught our attention because it is a GPI- anchored cell membrane protein, which may be used as a native marker for RGC isolation. In literature, Cntn2 is specifically expressed in developing RGCs in mice and chicks 69, 70.
In CONCEPT at day 25, CNTN2 exhibited an expression pattern very similar to that of TUBB3 (Figs. 2, 5). CNTN2 was found in the cell membrane of RGCs that expressed POU4F2 in the cell nucleus (Fig. 5A, D). PAX2+ cells formed inner and outer concentric zones, mimicking the optic stalk and optic disc, respectively. POU4F2+ RGCs formed a dense circular zone adjacent to PAX2+ optic disc cells; POU4F2+ RGCs were sparse in more peripheral areas (Fig. 5B).
These findings indicate that early differentiated RGCs were adjacent to PAX2+ optic disc cells. Interestingly, RGCs in the dense POU4F2+ zone grew CNTN2+ axons toward and then along the path defined by adjacent PAX2+ optic disc cells (Fig. 5A-E). In areas where there were a gap in PAX2+ optic disc cells, CNTN2+ axons exited the circular path (diamond arrow in Fig. 5A; a gap between two arrowheads in Fig. 5B, F). In regions where POU4F2+ RGCs were a few hundreds of micrometers away from PAX2+ optic disc cells, RGCs grew axons in centrifugal directions (arrow in Fig. 5C). Very similar findings were found using hiPSCs (Fig. S9), indicating the reproducibility of CONCEPT organoids in multiple cell lines. PAX2+ optic disc cells did not express ALDH1A3; instead, the path for RGC axon growth was bordered by two cell populations that highly expressed ALDH1A3 (Fig. 5G-H). In mice, Aldh1a3 expression was low in differentiating RGCs in the central retina but high in peripheral retinal progenitors and optic stalk (Fig. 5K) 71, consistent with ALDH1A3 expression in CONCEPT organoids (Fig. 5G, H). In mice, Vax1 and Vax2 are expressed in the optic stalk and ventral retina and are jointly required for the optic stalk development 55, 72. In CONCEPT organoids, cells that set up the inner boundary for RGC axon growth also expressed optic stalk marker VAX1/2 (Fig. 5I, J; the antibody recognizes both VAX1 and VAX2). Taken together, our data demonstrate that CNTN2 is a specific cell- surface marker for differentiating human RGCs; RGCs grow axons toward and then along a path that is defined by adjacent PAX2+ VSX2+ ALDH1A3- optic disc cells.
One-step isolation of developing human RGCs via native marker CNTN2
Since cell surface protein CNTN2 was specifically expressed in developing human RGCs, we sought to test whether CNTN2 can be used as a biomarker for isolating human RGCs under a native condition. To that goal, retinal organoids in suspension culture on days 41 - 70 were dissociated using Accutase to generate a single cell suspension, which was then subject to magnetic-activated cell sorting (MACS) with an antibody against CNTN2. From 100 retinal organoids on day 41 to 48, around 385,000 RGCs were isolated. Isolated RGCs were plated onto Matrigel-coated chamber slides for 10-day adherent culture. These cells exhibited neuronal morphology and widely expressed RGC markers TUBB3 and POU4F2 (Fig. 5L). Isolated RGCs tended to form clusters in culture. In contrast to directional axon growth found in CONCEPT organoids, isolated RGCs grew neurites in random directions (Fig. 5L), indicating the differences in axon pathfinding cues between CONCEPT organoids and isolated RGC cultures. RGC neurites were also marked by CNTN2 expression (Fig. 5M). A portion of isolated RGCs expressed POU4F2 but not CNTN2 (Fig. 5M), indicating that CNTN2 was downregulated in dissociated RGC cultures. Isolated RGCs also expressed RGC markers ISL1, RBPMS, and SNCG (Fig. 5N-P). Collectively, we have developed a one-step method for the isolation of differentiating human RGCs in a native condition.
Isolated RGCs exhibit electrophysiological signature of excitable cells
In order to determine the functional properties of isolated RGCs in culture, we examined their electrophysiological properties using whole-cell patch clamp recordings (Fig. 6, see Methods). Using current-clamp configuration, we found that RGCs displayed had a hyperpolarized resting membrane potential (mean ±SD: -20.1 ±6.4mV, Fig. 6A). When cells were held at -70 mV by current injection, in most cases (6/9), depolarizing currents steps could trigger an action potential, which were often followed by a depolarization plateau if the current was injected for more than 10ms (Fig. 6B). In voltage clamp recordings we examined the nature of the voltage- gated conductances (see Methods). From a holding membrane potential of -80 mV, both inward and outward currents (Im) were observed in response to depolarizing voltage steps (Vm, Fig. 6C). Outward currents were primarily mediated by voltage-gated potassium channels, as application of 20mM TEA significantly reduced their amplitude (mean IK ±SD at 60mV; 964±537 pA in control; 279±201 pA in TEA, U=24.0; p=0.019, two-sided MannWhitneyU test, Fig. 6D). Conversely, 1µM TTX abolished all inward currents, demonstrating that they were mediated by activation of voltage-gated sodium channels (mean INa ±SD at -10mV; -338.2±121 in control; - 18.3±13 pA in TTX; U=0.0; p=0.035, two-sided MannWhitneyU test, Fig. 6E). Taken together, these results indicate that isolated RGCs exhibit functional features traditionally found in excitable cells, such as in neurons.
FGF signaling mediated by FGFRs is required for early RGC differentiation and directional axon growth in humans
Directional RGC axon growth toward and then along PAX2+ optic disc cells in CONCEPT organoids could be mediated by signaling molecules secreted from PAX2+ optic disc cells. scRNA-seq analysis identified expression signatures of cluster 2, the major component of PAX2+ optic disc cells (Fig. S10). Interestingly, FGF8 and FGF9 were differentially expressed in cluster 2 (Figs. 4K, 4L; 7A; S10). To assess the roles of FGF8 and FGF9 in CONCEPT organoids, we validated that FGF8 and FGF9 were expressed in PAX2+ optic disc cells of CONCEPT organoids (Fig. 7B-E). TUBB3+ RGC axons grew towards and then along the regions with high-level FGF8 and FGF9 (Fig. 7D, E), suggesting that FGF8 and FGF9 may attract RGC axon growth. FGFR1, FGFR2, FGFR3, MAP2K1, and MAP2K2 were expressed in multiple types of cells in CONCEPT organoids. In RGCs, FGFR1 and MAP2K2 were clearly expressed (Fig. S11), indicating that RGCs expressed the components that transduce FGF signaling. Since FGF8 and FGF9 are probably redundant and it is challenging to inactivate both FGF8 and FGF9 in CONCEPT organoids, we decided to inactivate FGF signaling with FGFR1/2/3 inhibitor PD 161570 during days 17-24, a stage at early RGC differentiation. After the FGFR inhibition, FGF8 expression was grossly unaffected. On the other hand, RGC somas were drastically reduced, and directional axon growth was nearly absent (Fig. 7F-7K). These findings indicate that a) PAX2+ optic disc cells differentially expressed FGF8 and FGF9; b) FGF signaling mediated by FGFRs is required for early RGC differentiation and directional axon growth in humans.
Discussion
In this study, we report the self-formation of concentric zones of telencephalic and ocular tissues in CONCEPT telencephalon-eye organoids from human pluripotent stem cells, establishing a model for studying the early development of telencephalic and ocular tissues in humans. RGCs grew axons toward and then along a path defined by PAX2+ cell populations, setting up a model for studying RGC axon pathfinding. We identified expression signatures of cell clusters in CONCEPT organoids using single-cell RNA sequencing and revealed mechanisms of mechanisms of early RGC differentiation and axon growth. Lastly, we established a one-step method for the isolation of human electrophysiologically-excitable RGCs via CNTN2 under a native condition. Our studies not only provide deeper insight into coordinated specification of telencephalic and ocular tissues for directional RGC axon growth in humans, but also generate resources for therapeutic studies of RGC-related diseases such as glaucoma.
The cyst is a radially symmetric epithelium mimicking the anterior ectoderm
Cysts are hollow spheres composed of homogeneous columnar epithelial cells with the apical surface at the lumen. They are induced from pluripotent stem cells via embedding small sheets of hESCs into Matrigel and subsequent growth either in a solid thin film 47 or suspensions 28, 33. Cyst growth in suspensions is cost-effective and scalable. The formation of cysts induced by Matrigel mimics the epithelization of the epiblast by the extracellular matrix (ECM) in the blastocyst 73, 74.
In this study, individual cysts efficiently generate telencephalic and ocular tissues in the absence of any extrinsic factors, indicating their default cell fates of the anterior ectoderm. In literature, anterior neural tissues are generated from re-aggregated single pluripotent stem cells through dual inhibition of Smad signaling 75 or inhibition of Wnt/ß-catenin signaling 27. Besides that, undirected cultures without extrinsic factors are used for the generation of retinal cultures 29, 30, 76. In our procedure, we did not add any extrinsic factors; the epithelial structure of cysts and subsequent adherent growth at a low density facilitate neural induction and differentiation. Our findings are consistent with the reports that epiblast cells are epigenetically primed for ectodermal fates 77 and neuroectodermal tissues are the default differentiation from pluripotent stem cells 78, 79. Collectively, cysts mimic the anterior ectoderm in the epithelial structure and cell fates.
Pattern formation and coordinated cell differentiation in CONCEPT telencephalon-eye organoids
Tissue patterning is fundamental for the formation of a body plan, which is defined by the anteroposterior, dorsoventral, and left-right axes. Self-formation of CONCEPT telencephalon- eye organoids establishes an efficient way to pattern early telencephalic and ocular tissues along an axis. In CONCEPT organoids on days 22-26, FOXG1+ telencephalon, PAX2+ optic stalk, PAX2+ optic disc, and VSX2+ neuroretinas are positioned along the center-periphery axis, mimicking the relative positions of those tissues in E10.5-13.5 mouse embryos. Our findings indicate that the formation of telencephalic and retinal tissues are highly coordinated, consistent with the prosomere model 80, 81. Collectively, we establish CONCEPT telencephalon-eye organoids for studying the early formation of telencephalic and ocular tissues in humans.
The tissue patterning in CONCEPT telencephalon-eye organoids is originated from the attachment of a radially symmetric epithelium to the culture surface for growth as colonies since individual cysts kept in suspensions do not form any apparent tissue patterning. When a floating cyst initially contacted the culture surface, the contact resulted in ECM-cell adhesions. The initial ECM-cell adhesions caused additional ECM-cell contacts in neighboring cells, resulting in the flattening and spreading of a cyst onto the culture surface. Since the cyst is a radially symmetric epithelium, ECM-cell adhesions between the cyst and the culture surface formed sequentially in a concentric manner. Remodeling of cell-cell and ECM-cell adhesions and self-organization underlay the tissue patterning. Molecular events in concentric patterns during the attachment of a cyst onto the culture surface were eventually translated to concentric gradients of morphogens that specify cell fates. The radially symmetric epithelial structure of cysts is important for the formation of a concentric pattern since such pattern would not be generated when amorphous embryoid bodies are attached to the culture surface for growth as colonies. In literature, timed BMP4 treatment is shown to promote neuroretinal differentiation from pluripotent stem cells 82, and FGF8 promotes telencephalic and eye development 5, 22. In our system, BMP4 and FGF8, along with BMP7 and other FGFs, were highly expressed starting at early stages and gradually formed concentric morphogen gradients, which would dictate tissue patterning, resulting in coordinated specification of telencephalic, optic stalk, optic disc, and neuroretinal tissues along the center-periphery axis in CONCEPT telencephalon-eye organoids. Co-culture of these tissues in the concentric zones provides mutual cues for coordinated tissue specification and growth. Nevertheless, anchorage culture of cell colonies prevents three-dimensional morphogenesis as seen in embryos, impeding proper tissue interactions at more advanced stages. When these cell colonies are detached using dispase for suspension culture, retinal progenitor cells self-organize to form protruding, translucent spheres called retinal organoids whereas other types of cells form structures with dark appearance; concentric zones no longer exist 28. It is conceivable that the simple suspension culture does not have proper physical and chemical supports provided by periocular tissues and other surrounding tissues in vivo and therefore optic stalk cells do not form a tube-like structure. It is a challenge ahead to reconstruct this three-dimensional environment to mimic the morphogenesis in vivo.
Concentric patterns of stem cell-derived cultures are also reported in a few other experiments. When dissociated single pluripotent stem cells are grown in micropatterned culture surface at certain cell densities in a medium supplemented with BMP4, concentric zones of progenitors expressing markers for trophectoderm, endoderm, mesoderm, and ectoderm are found 43, 44. Cell density and colony geometry dictate cell fate specification from pluripotent stem cells. A concentric gradient of BMP4 activity regulates the patterning 43. When dissociated single pluripotent stem cells are grown in pre-patterned geometrically confined culture surface in a medium supplemented with dual inhibitors for TGF-β and BMP4, concentric zones of progenitors expressing the markers for neural plate and neural plate border are observed.
Morphogenetic cues—cell shape and cytoskeletal contractile force—dictate the patterning of the neural plate and neural plate border via BMP-SMAD signaling 45. When dissociated single pluripotent stem cells are grown as individual colonies in a medium supplemented with knockout serum replacement, multiple zones of ectodermal cells autonomously form 46. In all three experiments, dissociated single cells are used to generate cell colonies through either cell re- aggregation or proliferation. In our case, adherent culture of a radially-symmetric epithelium – the cyst – was used to generate CONCEPT organoids. Among the three previous and our experiments, starting cells differ in their developmental potentials, tissue structures, and treatments. Despite the differences, all these organoids comprise concentric zones of distinct cell populations. Formation of CONCEPT telencephalon-eye organoids mimics the coordinated specification of early telencephalic and ocular tissues in humans.
RGC axon pathfinding cues in CONCEPT telencephalon-eye organoids
In the mouse retina, multiple RGC axon guidance cues are concentrically organized around the optic disc, regulating RGC axon growth and exit from the eye through the optic stalk 2. Early differentiated RGCs are in a short distance from the nascent optic disc, and axons of later differentiated RGCs in more peripheral retinal regions follow the path of the initial axons. It is accepted that the optic-disc regions provide growth-promoting guidance cues whereas peripheral retinal regions provide inhibitory guidance cues 2. Pax2 is specifically expressed in the ventral optic stalk, optic vesicles, central neuroretina, optic disc, and optic stalk; Pax2 is essential for optic stalk and nerve development in mice 15–17.
In CONCEPT telencephalon-eye organoids, coordinated specification of telencephalic and ocular tissues generates PAX2+ optic-disc and optic-stalk cells that define the path for RGC axon growth. To the best of our knowledge, directional RGC axon growth guided by optic-disc and optic-stalk tissues has not been reported.
Single-cell RNA sequencing of CONCEPT organoids identified DEGs of PAX2+ optic-disc and optic-stalk cells. Interestingly, FGF8 and FGF9 were differentially expressed in PAX2+ optic-disc cells; inhibition of FGF signaling with an FGFR inhibitor during early RGC differentiation drastically decreased the number of RGC somas and nearly ablated directional axon growth, indicating that early RGC differentiation and directional axon growth require FGFR-mediated FGF signaling in humans. In chicks, Fgf8 and Fgf3 coordinate the initiation of retinal differentiation 22, 23; FGF8 maintains Pax2 expression in optic nerve explants 21. In mice, FGF8 and FGF9 trigger axon outgrowth in motor neuron column explants 83. Therefore, the roles of FGF signaling in the regulation of early RGC differentiation and directional axon growth in CONCEPT organoids are consistent with literature. Dissecting DEGs of PAX2+ optic-disc cells in CONCEPT telencephalon-eye organoids elucidates the mechanisms of RGC axon growth and pathfinding in humans.
RGCs described in this study are still at their early stages in development. One prominent feature of these RGCs are the growth of their axons towards and long the path defined by optic disc cells, which is quite clear in CONCEPT organoids. Optic stalk cells in CONCEPT organoids confine RGC axon growth at inner regions, preventing RGC axons to enter telencephalic areas. We did not observe any clear evidence of synaptic or dendritic connections between RGCs and other cells at tested stages. Engineering assembloids may be needed to establish connections between RGCs and their visual targets.
One-step isolation of developing human RGCs under a native condition
RGCs are degenerated in glaucoma, a major cause of vision impairment in developed countries. Disease modeling and drug discovery to suppress RGC death will have a huge impact on saving vision. The use of human RGC models is critical for therapeutic studies since humans and rodents differ significantly in RGCs. Additionally, cell replacement therapies for glaucoma are extensively evaluated. Therefore, efficient isolation of human RGCs in a native condition will have a substantial impact on therapeutic studies of RGC-related diseases such as glaucoma. In literature, cell surface marker Thy1 is used for the isolation of adult mouse RGCs, but it is unsuccessful in the isolation of RGCs from 3D retinal organoids 84. A study reports the purification of human RGCs via Thy1 from adherent cultures 85. Tagging human RGCs with an engineered marker Thy1.2 leads to efficient isolation of human RGCs 84, but may not be unsuitable for clinical uses. Using single-cell RNA sequencing, we identified cell surface protein CNTN2 as a specific marker for developing human RGCs. We isolated human electrophysiologically-excitable RGCs using MACS via CNTN2. Therefore, we establish a one- step method for isolating human RGCs under a native condition, facilitating therapeutic studies for RGC-related retinal diseases such as glaucoma.
Disclosure
A patent application is pending.
Acknowledgements
We are grateful to Dr. Roy Chuck for support, M.R.G. Stem Cell Institute (supported by NYSTEM C029154) for service, Leslie Cummins and Frank P Macaluso at the Analytical Imaging Facility of AECOM for electron microscopy (supported by P30CA013330), David Reynolds at the Genomics Core of AECOM for the preparation of single-cell libraries, Dr. Kamran Khodakhah for technical support and critical readings, and grants from NEI, NIH (R01EY022645 and R21EY029806 to W.L.). Albert Lowe was supported by training grants T32GM007491 and C30292GG. Ludovic Spaeth was supported by a grant from NIH (5R01NS105470-06 to Dr. Khodakhah).
Materials and Methods
Maintenance of hESCs
ESCRO and IRB committees at AECOM approved the use of hESCs in this project. Undifferentiated H1 hESCs (WiCell WA01) or hiPSCs (Corriell Institute AICS 0023) were grown on Matrigel-coated 6-well plates in mTeSR1 medium and passaged using ReLeSR (STEMCELL technologies) following manufacturer instructions.
Retinal cell differentiation
CONCEPT telencephalon-eye organoids were generated as follows. A humidified incubator at 37°C with 5% CO2 was used for cell culture. H1 hESCs or iPSCs that were passaged using ReLeSR two or three days before experiments were detached using Dispase (GIBCO 17105041) and then harvested by centrifugation. After that, the cell pellets were suspended in ice-cold Matrigel. After gelling at 37 °C for 15-20 minutes, the hESC/Matrigel clump was gently dispersed in a N2B27 Medium (DMEM/F12+GlutaMAX (GIBCO):Neurobasal medium (GIBCO) = 1:1, 0.5 x B27 supplement (GIBCO), 0.5 x N2 supplement (GIBCO), 0.1 mM β- mercaptoethanol, and 0.2 mM L-GlutaMax) for floating culture. With the starting day of cell differentiation designated as day 0, cysts with a single lumen formed on day 1. Cysts with a single lumen constituted over 85% of cultures. On day 4 or 5, individual cysts with a diameter at around 150-200 μm were manually picked using a curved Pasteur pipets under an inverted microscope and then seeded onto Matrigel-coated 24-well plates at a density of 2-6 cysts per well. Cysts spontaneously attached to the culture surface and grew. From a time during days 13-16, attached cell colonies were grown in a KSR medium (GMEM medium supplemented with 10% knockout serum replacement, 1 mM sodium pyruvate, 0.1 mM non-essential amino acids, 2 mM l-glutamine, and 55 μM 2-mercaptoethanol; all the culture reagents were from Life Technologies). Culture mediums were changed every two or three days. Overall, the procedure is efficient and robust. Images in the manuscript represent 80-90% of cultures.
Inhibition of FGF signaling in CONCEPT telencephalon-eye organoids with FGFR inhibitor PD 161570
To inactivate FGF signaling in CONCEPT organoids, FGFR1/2/3 inhibitor PD 161570 (1 µM; Tocris) was supplemented to the culture medium staring on day 17, with vehicle DMSO as a control. Treated CONCEPT organoids were harvested on day 24 for assays.
Magnetic-activated cell sorting (MACS) of developing human RGCs
Retinal organoids in suspension culture were generated using the established method 28, 33. For each MACS experiment, 84 – 140 retinal organoids at stages of day 41 – 70 were dissociated into single cells using Accutase (GIBCO A1110501). Non-retinal cells were trimmed if there were any. Dissociated single cells were harvested using centrifugation and then incubated for 25 minutes at room temperature with MagnaBind goat anti-mouse IgG (ThermoScientific 21354) beads that were previously coupled with a CNTN2 antibody (DSHB 4D7) following manufacturer instructions. Cells bound to the beads were isolated using a magnetic rack and then washed one time with the KSR medium supplemented with antibiotic:Antimycotic (GEMINI 400101) while the tube was still against the magnetic rack. After the wash, the cells were released from the beads via Accutase digestion for 30 minutes and then harvested using centrifugation. The isolated cells were plated onto a chamber slide (ibidi 80826, ibidiTreat µ-Slide 8 Well, coated with poly-ornithine and Matrigel, 30,000-50,000 cells/200 µl/well) in BrainPhys neuronal medium (Stem Cell Technology 05790) supplemented with N2 and B27 (GIBCO 17502001, A3582801). From 100 retinal organoids on day 41 to 48, around 385,000 RGCs were isolated. After 10 days of culture in chamber slides, RGCs were fixed in 4% paraformaldehyde (PFA) for 10 minutes and then processed for immunostaining.
Immunostaining, antibodies, and light microscopy
CONCEPT telencephalon-eye organoids were fixed in 4% PFA for 15-30 minutes at room temperature and processed for immunostaining. See Supplemental Information for details.
In situ hybridization
DIG-labeled anti-sense RNA probes for in situ hybridization were generated via in vitro transcription using a DIG RNA labeling kit (Millipore Sigma-Aldrich 11175025910). See Supplemental Information for details. To assess the in vivo expression of DEGs identified by single-cell RNA sequencing, in situ hybridization images of their mouse orthologs in E14.5 mouse brains were downloaded from a public database 86 (https://gp3.mpg.de/) with permission and then assembled in supplemental Figs.
Electron microscopy (EM)
EM was performed by Analytical Imaging Facility in Albert Einstein College of Medicine with a standard method. Lens cell clusters were fixed in 0.1M Cacodylate buffer containing 2% paraformaldehyde and 2.5% glutaraldehyde for 60 minutes at room temperature and then processed for EM.
Single-cell RNA sequencing
CONCEPT telencephalon-eye organoids at day 24 from one culture well were dissociated into single cells using activated Papain (Worthington Biochemical Corporation LS003126) following manufacturer’s instructions. Then, 10,000 dissociated cells were captured using Chromium Controller (10x Genomics), followed by library preparation using Single Cell 3’ version 3.1 kit (10x Genomics) following manufacturer’s instructions. The library was sequenced in one lane of Illumina HiSeq (2x150 bp) in GeneWIZ company.
Fastq sequences were mapped to the human genome (GRCh38-3.0.0) using CellRanger (3.1.0) to generate a count matrix, which was then analyzed using the Seurat Package (v3.2.0) 59.
Sequenced cells were filtered (nFeature_RNA > 200 & nFeature_RNA < 6000 & percent.mt < 20), resulting in 10218 cells with high quality. Dimension reduction and clustering were performed using the following functions: NormalizeData, FindVariableFeatures, ScaleData, RunPCA, ElbowPlot, FindNeighbors (dims = 1:17), and FindClusters (resolution = 0.5).
Differentially expressed genes were identified using the function FindAllMarkers (only.pos = FALSE, min.pct = 0.25, logfc.threshold = 0.25).
Whole-cell patch clamp recordings of isolated RGCs in culture
Standdard methods were used. See Supplemental Information for details.
Statistical analysis
Statistical analysis in DEG identification was performed using the Seurat Package (v3.2.0) 59. Adjusted p-values were shown.
Data availability
Single-cell RNA sequencing data of CONCEPT telencephalon-eye organoids at day 24 is available in Gene Expression Omnibus (http://www.ncbi.nlm.nih.gov/geo) using the accession number GSExxx.
Supplemental Information
Immunostaining, antibodies, and light microscopy
CONCEPT telencephalon-eye organoids were fixed in 4% PFA for 15-30 minutes at room temperature and processed for immunostaining. These primary antibodies were used: FOXG1 (Abcam, ab18259, 1:500), TUBB3 (Covance MMS-435P, 1:1000), FGF8 (1:500, R&D MAB323), RBPMS (1:200, PhosphoSolution 1830-RBPMS), ISL1 (1:500, DSHB 40.2D6), SNCG (1:200, Abcam ab55424), PAX2 (Invitrogen, 716000, 1:200), alpha A crystallin (Santa Cruz sc 22743, 1:500, shown as CRYAA in figure panels), beta crystallin (Santa Cruz sc-22745, 1:100, shown as CRY B in figure panels), CNTN2 (DSHB 4D7, 1:100), ALDH1A3 (Invitrogen, PA529188, 1:500), VAX1/2 (Santa Cruz sc-98613, 1:200), PAX6 (1:500, Covance PRB-278P), POU4F2 (Santa Cruz, SC-6026, 1:200), SIX3 (1:500, Rockland), and VSX2 (1:500, Millipore AB9016). Primary antibodies were visualized using Alexa Fluor 488-, 568-, and 647-conjugated secondary antibodies and imaged using a Zeiss AxioObserver Z1 microscope. When the sample did not fit in one image, multiple images were stitched to obtain an overview. In dual-color immunocytochemistry for PAX2 and FGF8, FGF8 was visualized using AP-conjugated anti mouse secondary antibody (Invitrogen A16038), and PAX2 was detected by biotin-conjugated anti rabbit secondary antibody (Invitrogen B2770) followed by HRP-conjugated streptavidin (ThermoScientific 21130). For dual color immunocytochemistry of CNTN2 and FGF8 (both are mouse antibodies; no working antibodies raised in different species are available), immunocytochemistry of CNTN2 was performed first and visualized using HRP-conjugated streptavidin. Then, the samples were fixed in 4% PFA for 15 minutes to avoid antibody crosstalk. After that, FGF8 antibody was applied and then detected by an AP-conjugated secondary antibody. Brown and blue colors are well separated in Fig. 5K, indicating that antibody crosstalks did not exist.
PCR Primers for in situ hybridization probes
PCR primers are as follows: BMP4: forward, CGGAAGCTAGGTGAGTGTGG, reverse, GAGtaatacgactcactatagggGGAAGCCCCTTTCCCAATCA; BMP7: forward, gaggtccctctccattccct, reverse, GAGtaatacgactcactatagggtgcacccatcagacctccta; FGF8: forward, GTTGCACTTGCTGGTCCTCT, reverse,
GAGtaatacgactcactatagggTTGAGTTTTGGGTGCCCTAC; PAX2: forward, gctgtctgtgctgtgagagt, reverse, GAGtaatacgactcactatagggccggggacatttagcaggtt; SEMA5A: forward, CAGAGGCTCAGGCACAATGA, reverse,
GAGtaatacgactcactatagggTCCGTGTCTACCCAGGACTT; CYP1B1: forward, cccagcggttcttcatgagt, reverse, GAGtaatacgactcactataggggcacacttggttgcgttagt; LEFTY2: forward, agccctctaactgaacgtgtg, reverse, GAGtaatacgactcactatagggtcttctgagtatctacattcaattgct; EMX2: forward, ACCGAGAAAGGGAGAGGGAA, reverse, GAGtaatacgactcactatagggTCGGCCAATTTCTCCAACCA; FGF9: forward, GTCCGCTATGAACCTGTGGT, reverse,
GAGtaatacgactcactatagggATAGTCTCGCTTGCCCAAGG; FGF2: forward, aacaccgaaatgctggaggt, reverse, GAGtaatacgactcactataggggagaccacatgtacacgcca.
Whole-cell patch clamp recordings of isolated RGCs in culture
RGCs were isolated from retinal organoids on day 48 using MACS via a CNTN2 antibody and then grown on polymer coverslips in chamber slides (ibidi 80826) for 20 – 27 days. At the time of whole-cell patch clamping recordings, the polymer coverslips carrying RGCs were carefully cut out with a scalpel blade and then placed in a recording chamber under an upright microscope (Zeiss Examiner A1), containing artificial cerebrospinal fluid (aCSF) composed of (in mM): NaCl (140), MgCl2 (1), KCl (5), CaCl2 (2), Hepes (10), Glucose (10). Osmolarity and pH were adjusted to 300mOsm and 7.3 respectively. Whole-cell patch-clamp recordings in voltage and current-clamp mode were obtained at room temperature using an Optopatch amplifier (Cairn Research, UK) and acquired with WinWCP 5.2 freeware (John Dempster, SIPBS, University of Strathclyde, UK). Patch pipettes (3-4MΩ when filled with corresponding solution) were pulled from borosilicate capillaries using a horizontal puller (Sutter P97, USA) and coated with dental wax to reduce the pipette capacitance. For current clamp recordings, patch pipettes were filled with a solution containing (in mM): K-gluconate (130), Na-gluconate (10), NaCl (4), Hepes (10), Phosphocreatin (10), MgATP (4), Na2GTP (0.3). Osmolarity and pH were adjusted at 295mOsm and 7.3 respectively. Resting membrane potential was obtained from averaging membrane potential recorded for one minute in I=0 mode immediately after breaking the cell membrane. In current clamp mode, with the cell hyperpolarized to -70 mV, current steps of 100 to 500pA were made to explore whether the cells were excitable. For voltage-clamp recordings, cells were held at clamped potential of -80mV, and series resistance was monitored and compensated (>80%). Membrane potentials were corrected for the liquid junction potential, calculated at +5.4mV (https://swharden.com/LJPcalc). Patch pipettes were filled with a solution containing (in mM): KCl (140), MgCl2 (5), CaCl2 (2.5), Hepes (10), MgATP (4), Na2GTP (0.3). Osmolarity and pH were adjusted at 295mOsm and 7.3 respectively. A -P/4 subtraction protocol was used to isolate voltage-gated currents by removing linear leak current and capacitance artifacts. In all cases, voltage and current recordings were low pass filtered at 3kHz and digitized at 10-20kHz (Axon Digidata 1550b, Molecular Device, USA). Tetraethylammonium- chloride (TEA, Sigma-Aldrich, USA) and Tetrodotoxin-citrate (TTX, Fisher Scientific) stocks were diluted in aCSF to reach 20mM and 1µM respectively. All recordings were analyzed with WinWcp 5.2 and custom scripts and routines written in Python 3.9. Statistical tests were performed with corresponding function from scipy.stats package (v1.8).
Legends for supplemental Figures
Fig. S1. Reproducibility of CONCEPT telencephalon-eye organoids is demonstrated by consistent gene expression profiles of multiple organoids in whole culture wells. Related to Figs. 1, 7. (A-C) CONCEPT organoids on day 17 expressed FGF8 (A, n =5/5), BMP4 (B, n = 4/4; the broken colony was not counted since its morphology is not quite clear), and BMP7 (C, n = 4/4) in concentric zones. (D-F) CONCEPT organoids on day 25 expressed FGF8 (D, n = 5/8), RGC marker CNTN2 (E, n = 5/6), and telencephalon marker EMX2 (F, n = 2/2) in concentric zones. Scale bars, 1 mm (A-F).
Fig. S2. Mesoderm, endoderm, and neural crest markers are not expressed in CONCEPT telencephalon-eye organoids at 24. Related to Fig. 4. The dataset for Fig. 4 is used for plotting. Expression profiles of mesoderm markers TBXT, GATA2, and HAND1, endoderm markers GATA1, GATA4, and SOX17, neural crest markers SNAI1, SOX10, FOXD3 are shown.
Fig. S3. The expression of top DEGs in cluster 0. Related to Fig. 4. The dataset for Fig. 4 is used for plotting. Cluster 0 was marked by DEGs that were lowly expressed.
Fig. S4. Diencephalon markers and midbrain/hindbrain markers are rarely expressed in CONCEPT telencephalon-eye organoids at day 24. Related to Fig. 4. (A-F) Diencephalon markers GBX2, WNT3, and SOX14, and midbrain/hindbrain markers EN2, PAX7, and TFAP2B were rarely expressed. The dataset for Fig. 4 is used for plotting. (G-L) Expression of the diencephalon markers and midbrain/hindbrain markers in the E14.5 mouse brain. The images were downloaded from a public database (https://gp3.mpg.de/) with permission. Image IDs were shown following gene symbols.
Fig. S5. DEGs for telencephalic clusters in CONCEPT telencephalon-eye organoids include markers for both the pallium and subpallium. Related to Fig. 4 and Fig. S6. DEGs for telencephalic clusters were used for plotting, and expression of their orthologs in E14.5 mouse brain was shown in Fig. S6. (A-D) Expression of the DEGs POU3F3, RGMA, EDNRB, and SOX13, which orthologs are expressed in the pallium of E14.5 mouse brain (see also Fig. S6B-E). (E-L) Expression of the DEGs DLX2, RGS16, DLX1, DLL1, DLX6-AS1, NEFL, DCX, and RTN1, which orthologs are expressed in the subpallium of E14.5 mouse brain (see Fig. S6F-M).
Fig. S6. Mouse orthologs of the telencephalic DEGs are expressed in both the pallium and subpallium of the E14.5 mouse brain. Related to Fig. 4 and Fig. S5. The images were downloaded from a public database (https://gp3.mpg.de/) with permission. Image IDs wereshown following gene symbols. (A) Expression of Foxg1. (B-E) Expression of the genes Pou3f3, Rgma, Ednrb, and Sox3 in the pallium of E14.5 mouse brain. (F-M) Expression of the genes Dlx2, Rgs16, Dlx1, Dll1, Dlx6os1, Nefl, Dcx, and Rtn1 in the subpallium of E14.5 mouse brain.
Fig. S7. DEGs in cluster 6 include RPE markers. Related to Fig. 4. Top DEGs in cluster 6 include RPE markers PMEL, HSD17B2, DCT, and MITF.
Fig. S8. Mouse orthologs of the markers for Pax2+ optic disc and Pax2+ optic stalk cell clusters in CONCEPT organoids are indeed expressed in the optic disc and optic stalk/nerve, respectively, in E14.5 mouse embryos. Related to Fig. 4. In situ hybridization images of the E14.5 mouse brain were downloaded from a public database (https://gp3.mpg.de/) with permission. Image IDs were shown following gene symbols. (A-T) Expression of the gene markers in E14.5 brain is shown.
Fig. S9. CONCEPT telencephalon-eye organoids are generated using hiPSC line AICS 0023. Related to Fig. 7. hiPSCs (AICS 0023) were used for the generation of CONCEPT telencephalon-eye organoids. (A-D) POU4F2+ RGCs grew CNTN2+ axons toward and then along a circular path defined by PAX2+ cell populations. Scale bar, 500 µm (A), 100 µm (B).
Fig. S10. Expression signatures of cell cluster 2. Related to Figs. 4, 5. (A) A list of top 10 DEGs and additional DEG markers SEMA5A, PAX2, COL13A1, FGF9, and FGF8 in cluster 2 were identified using Seurat analysis. (B-E) Expression of PAX2, SEMA5A, CYP1B1, and LEFTY2 in CONCEPT organoids at day 25 was revealed by in situ hybridization. The PAX2+ optic disc at the outer zone was marked (bracket in B).
Fig. S11. FGFR1, FGFR2, FGFR3, MAP2K1, and MAP2K2 are expressed in multiple types of cells in CONCEPT organoids. Related to Fig. 4. In RGCs, FGFR1 and MAP2K2 were expressed.
References
- 1.Fate mapping of the mouse prosencephalic neural plateDev Biol 219:373–383https://doi.org/10.1006/dbio.2000.9616
- 2.Ganglion cell axon pathfinding in the retina and optic nerveSemin Cell Dev Biol 15:125–136https://doi.org/10.1016/j.semcdb.2003.09.006
- 3.The retinal ganglion cell axon’s journey: insights into molecular mechanisms of axon guidanceDev Biol 308:1–14https://doi.org/10.1016/j.ydbio.2007.05.013
- 4.Connecting the retina to the brainASN Neuro 6https://doi.org/10.1177/1759091414562107
- 5.Induction and dorsoventral patterning of the telencephalonNeuron 28:641–651
- 6.Winged helix transcription factor BF-1 is essential for the development of the cerebral hemispheresNeuron 14:1141–1152https://doi.org/10.1016/0896-6273(95)90262-7
- 7.Specification of the vertebrate eye by a network of eye field transcription factorsDevelopment 130:5155–5167https://doi.org/10.1242/dev.00723
- 8.Pax6 is required for the multipotent state of retinal progenitor cellsCell 105:43–55
- 9.Pax6 activity in the lens primordium is required for lens formation and for correct placement of a single retina in the eyeGenes Dev 14:2701–2711https://doi.org/10.1101/gad.184000
- 10.Retinal pigmented epithelium determination requires the redundant activities of Pax2 and Pax6Development 130:2903–2915
- 11.Chx10 repression of Mitf is required for the maintenance of mammalian neuroretinal identityDevelopment 132:177–187https://doi.org/10.1242/dev.01571
- 12.Transdifferentiation of the retina into pigmented cells in ocular retardation mice defines a new function of the homeodomain gene Chx10Development 131:5139–5152https://doi.org/10.1242/dev.01300131/20/5139
- 13.Neuroretina specification in mouse embryos requires Six3-mediated suppression of Wnt8b in the anterior neural plateJ Clin Invest 120:3568–3577https://doi.org/10.1172/JCI43219
- 14.A regulatory loop involving PAX6, MITF, and WNT signaling controls retinal pigment epithelium developmentPLoS Genet 8https://doi.org/10.1371/journal.pgen.1002757
- 15.Pax2 contributes to inner ear patterning and optic nerve trajectoryDevelopment 122:3381–3391
- 16.The Pax protein Noi is required for commissural axon pathway formation in the rostral forebrainDevelopment 124:2397–2408
- 17.Otx genes are required for tissue specification in the developing eyeDevelopment 128:2019–2030
- 18.Spatial specification of mammalian eye territories by reciprocal transcriptional repression of Pax2 and Pax6Development 127:4325–4334
- 19.Inductive interactions direct early regionalization of the mouse forebrainDevelopment 124:2709–2718
- 20.Dose-dependent functions of Fgf8 in regulating telencephalic patterning centersDevelopment 133:1831–1844https://doi.org/10.1242/dev.02324
- 21.Pax2 regulates neuronal- glial cell fate choice in the embryonic optic nerveDev Biol 303:800–813https://doi.org/10.1016/j.ydbio.2006.11.016
- 22.Differentiation of the vertebrate retina is coordinated by an FGF signaling centerDevelopmental cell 8:565–574https://doi.org/10.1016/j.devcel.2005.01.022
- 23.Multiple functions of fibroblast growth factor-8 (FGF-8) in chick eye developmentMech Dev 94:25–36https://doi.org/10.1016/s0925-4773(00)00320-8
- 24.Organogenesis in a dish: modeling development and disease using organoid technologiesScience 345https://doi.org/10.1126/science.1247125
- 25.Self-organizing optic-cup morphogenesis in three- dimensional cultureNature 472:51–56https://doi.org/10.1038/nature09941
- 26.Optic vesicle-like structures derived from human pluripotent stem cells facilitate a customized approach to retinal disease treatmentStem Cells 29:1206–1218https://doi.org/10.1002/stem.674
- 27.Self-formation of optic cups and storable stratified neural retina from human ESCsCell Stem Cell 10:771–785https://doi.org/10.1016/j.stem.2012.05.009
- 28.Intercellular Adhesion- Dependent Cell Survival and ROCK-Regulated Actomyosin-Driven Forces Mediate Self- Formation of a Retinal OrganoidStem Cell Reports 6:743–756https://doi.org/10.1016/j.stemcr.2016.03.011
- 29.Generation of three-dimensional retinal tissue with functional photoreceptors from human iPSCsNature communications 5https://doi.org/10.1038/ncomms5047
- 30.From confluent human iPS cells to self-forming neural retina and retinal pigmented epitheliumProc Natl Acad Sci U S A 111:8518–8523https://doi.org/10.1073/pnas.1324212111
- 31.Cell Types of the Human Retina and Its Organoids at Single-Cell ResolutionCell 182:1623–1640https://doi.org/10.1016/j.cell.2020.08.013
- 32.Extension of retinofugal projections in an assembled model of human pluripotent stem cell-derived organoidsStem Cell Reports https://doi.org/10.1016/j.stemcr.2021.05.009
- 33.Generation, transcriptome profiling, and functional validation of cone-rich human retinal organoidsProc Natl Acad Sci U S A 116:10824–10833https://doi.org/10.1073/pnas.1901572116
- 34.Retinal Ganglion Cell Diversity and Subtype Specification from Human Pluripotent Stem CellsStem Cell Reports 10:1282–1293https://doi.org/10.1016/j.stemcr.2018.02.010
- 35.Three-Dimensional Retinal Organoids Facilitate the Investigation of Retinal Ganglion Cell Development, Organization and Neurite Outgrowth from Human Pluripotent Stem CellsSci Rep 8https://doi.org/10.1038/s41598-018-32871-8
- 36.Generation of Functional Human Retinal Ganglion Cells with Target Specificity from Pluripotent Stem Cells by Chemically Defined Recapitulation of Developmental MechanismStem Cells 35:572–585https://doi.org/10.1002/stem.2513
- 37.Cerebral organoids model human brain development and microcephalyNature 501:373–379https://doi.org/10.1038/nature12517
- 38.Self-organization of axial polarity, inside-out layer pattern, and species-specific progenitor dynamics in human ES cell-derived neocortexProc Natl Acad Sci U S A 110:20284–20289https://doi.org/10.1073/pnas.1315710110
- 39.Modeling human cortical development in vitro using induced pluripotent stem cellsProc Natl Acad Sci U S A 109:12770–12775https://doi.org/10.1073/pnas.1202944109
- 40.Using brain organoids to understand Zika virus-induced microcephalyDevelopment 144:952–957https://doi.org/10.1242/dev.140707
- 41.Individual brain organoids reproducibly form cell diversity of the human cerebral cortexNature 570:523–527https://doi.org/10.1038/s41586-019-1289-x
- 42.Human brain organoids assemble functionally integrated bilateral optic vesiclesCell Stem Cell https://doi.org/10.1016/j.stem.2021.07.010
- 43.A Balance between Secreted Inhibitors and Edge Sensing Controls Gastruloid Self-OrganizationDevelopmental cell 39:302–315https://doi.org/10.1016/j.devcel.2016.09.016
- 44.High-resolution transcriptional and morphogenetic profiling of cells from micropatterned human ESC gastruloid culturesElife 9https://doi.org/10.7554/eLife.59445
- 45.Mechanics-guided embryonic patterning of neuroectoderm tissue from human pluripotent stem cellsNat Mater 17:633–641https://doi.org/10.1038/s41563-018-0082-9
- 46.Co-ordinated ocular development from human iPS cells and recovery of corneal functionNature 531:376–380https://doi.org/10.1038/nature17000
- 47.Three-dimensional neuroepithelial culture from human embryonic stem cells and its use for quantitative conversion to retinal pigment epitheliumPLoS One 8https://doi.org/10.1371/journal.pone.0054552
- 48.The same enhancer regulates the earliest Emx2 expression in caudal forebrain primordium, subsequent expression in dorsal telencephalon and later expression in the cortical ventricular zoneDevelopment 137:2939–2949https://doi.org/10.1242/dev.048843
- 49.BMP and BMP receptor expression during murine organogenesisGene Expr Patterns 9:255–265https://doi.org/10.1016/j.gep.2009.04.002
- 50.BMP4 is essential for lens induction in the mouse embryoGenes Dev 12:3764–3775https://doi.org/10.1101/gad.12.23.3764
- 51.Overlapping expression domains of bone morphogenetic protein family members potentially account for limited tissue defects in BMP7 deficient embryosDev Dyn 208:349–362https://doi.org/10.1002/(SICI)1097-0177(199703)208:3<349::AID-AJA6>3.0.CO;2-I
- 52.Mice lacking Bmp6 functionDev Genet 22:321–339https://doi.org/10.1002/(SICI)1520-6408(1998)22:4<321::AID-DVG3>3.0.CO;2-8
- 53.Proper patterning of the optic fissure requires the sequential activity of BMP7 and SHHDevelopment 133:3179–3190https://doi.org/10.1242/dev.02493
- 54.POU domain factor Brn-3b is required for the development of a large set of retinal ganglion cellsProc Natl Acad Sci U S A 93:3920–3925
- 55.Vax genes ventralize the embryonic eyeGenes Dev 19:1249–1259https://doi.org/10.1101/gad.1276605
- 56.AP-2alpha knockout mice exhibit optic cup patterning defects and failure of optic stalk morphogenesisHum Mol Genet 19:1791–1804https://doi.org/10.1093/hmg/ddq060
- 57.Gap junctions are selectively associated with interlocking ball-and-sockets but not protrusions in the lensMol Vis 16:2328–2341
- 58.FGF-induced lens cell proliferation and differentiation is dependent on MAPK (ERK1/2) signallingDevelopment 128:5075–5084
- 59.Comprehensive Integration of Single-Cell DataCell 177:1888–1902https://doi.org/10.1016/j.cell.2019.05.031
- 60.Dissecting the multicellular ecosystem of metastatic melanoma by single-cell RNA-seqScience 352:189–196https://doi.org/10.1126/science.aad0501
- 61.A Single-Cell Roadmap of Lineage Bifurcation in Human ESC Models of Embryonic Brain DevelopmentCell Stem Cell 20:120–134https://doi.org/10.1016/j.stem.2016.09.011
- 62.Generation of organized germ layers from a single mouse embryonic stem cellNat Commun 5
- 63.Signal requirement for cortical potential of transplantable human neuroepithelial stem cellsbiorxiv https://doi.org/10.1101/2021.03.27.437311
- 64.Establishing neural crest identity: a gene regulatory recipeDevelopment 142:242–257https://doi.org/10.1242/dev.105445
- 65.Patterning and compartment formation in the diencephalonFront Neurosci 6https://doi.org/10.3389/fnins.2012.00066
- 66.Molecular regionalization of the diencephalonFront Neurosci 6https://doi.org/10.3389/fnins.2012.00073
- 67.Invariant Sema5A inhibition serves an ensheathing function during optic nerve developmentDevelopment 130:775–784https://doi.org/10.1242/dev.00299
- 68.Type XIII collagen is widely expressed in the adult and developing human eye and accentuated in the ciliary muscle, the optic nerve and the neural retinaExp Eye Res 70:401–410https://doi.org/10.1006/exer.1998.0826
- 69.Structural requirement of TAG-1 for retinal ganglion cell axons and myelin in the mouse optic nerveJ Neurosci 28:7624–7636https://doi.org/10.1523/JNEUROSCI.1103-08.2008
- 70.Expanding the Ig superfamily code for laminar specificity in retina: expression and role of contactinsJ Neurosci 32:14402–14414https://doi.org/10.1523/JNEUROSCI.3193-12.2012
- 71.A retinoic acid synthesizing enzyme in ventral retina and telencephalon of the embryonic mouseMech Dev 95:283–289https://doi.org/10.1016/s0925-4773(00)00352-x
- 72.Hedgehog signalling maintains the optic stalk-retinal interface through the regulation of Vax gene activityDevelopment 130:955–968https://doi.org/10.1242/dev.00305
- 73.Self-organizing properties of mouse pluripotent cells initiate morphogenesis upon implantationCell 156:1032–1044https://doi.org/10.1016/j.cell.2014.01.023
- 74.Signals for death and survival: a two-step mechanism for cavitation in the vertebrate embryoCell 83:279–287
- 75.Highly efficient neural conversion of human ES and iPS cells by dual inhibition of SMAD signalingNat Biotechnol 27:275–280https://doi.org/10.1038/nbt.1529
- 76.Differentiation of brain and retinal organoids from confluent cultures of pluripotent stem cells connected by nerve-like axonal projections of optic originStem Cell Reports 17:1476–1492https://doi.org/10.1016/j.stemcr.2022.04.003
- 77.Multi-omics profiling of mouse gastrulation at single-cell resolutionNature 576:487–491https://doi.org/10.1038/s41586-019-1825-8
- 78.Direct neural fate specification from embryonic stem cells: a primitive mammalian neural stem cell stage acquired through a default mechanismNeuron 30:65–78https://doi.org/10.1016/s0896-6273(01)00263-x
- 79.Neural induction, the default model and embryonic stem cellsNat Rev Neurosci 3:271–280https://doi.org/10.1038/nrn786
- 80.Modularity in vertebrate brain development and evolutionBioessays 23:1100–1111https://doi.org/10.1002/bies.10014
- 81.Eye development: a view from the retina pigmented epitheliumBioessays 26:766–777https://doi.org/10.1002/bies.20064
- 82.Generation of a ciliary margin-like stem cell niche from self-organizing human retinal tissueNature communications 6https://doi.org/10.1038/ncomms7286
- 83.FGF as a target-derived chemoattractant for developing motor axons genetically programmed by the LIM codeNeuron 50:841–853https://doi.org/10.1016/j.neuron.2006.04.030
- 84.Enhanced Stem Cell Differentiation and Immunopurification of Genome Engineered Human Retinal Ganglion CellsStem Cells Transl Med 6:1972–1986https://doi.org/10.1002/sctm.17-0059
- 85.Generation of a Transplantable Population of Human iPSC-Derived Retinal Ganglion CellsFront Cell Dev Biol 8https://doi.org/10.3389/fcell.2020.585675
- 86.GenePaint.org: an atlas of gene expression patterns in the mouse embryoNucleic Acids Res 32:D552–556https://doi.org/10.1093/nar/gkh029
Metrics
- views
- 1,222
- downloads
- 75
- citation
- 1
Views, downloads and citations are aggregated across all versions of this paper published by eLife.